JBC PeproTech; Our Business is Cytokines!

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Andjelkovic, M.
Right arrow Articles by Hemmings, B. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Andjelkovic, M.
Right arrow Articles by Hemmings, B. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 8, Issue of February 24, 1995 pp. 4066-4075
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Developmental Regulation of Expression and Activity of Multiple Forms of the Drosophila RAC Protein Kinase (*)

(Received for publication, September 9, 1994; and in revised form, November 22, 1994)

Mirjana Andjelkovic (1) Pamela F. Jones (1)(§) Ueli Grossniklaus(¶)(**) Peter Cron (1) Alexander F. Schier(¶)(§§) Mathias Dick (1)(¶¶) Graeme Bilbe (2) Brian A. Hemmings (1)(A)

From the  (1)Friedrich Miescher-Institut, P.O. Box 2543, CH-4002, Basel, Switzerland,Biozentrum der Universität Basel, Klingelbergstrasse 70, CH-4056 Basel, Switzerland, and (2)Biotechnology, Ciba-Geigy Ltd., CH-4002 Basel, Switzerland

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

We have characterized the Drosophila homologue of the proto-oncogenic RAC protein kinase (DRAC-PK). The DRAC-PK gene gives rise to two transcripts with the same coding potential, generated by the use of two different polyadenylation signals. Each transcript encodes two polypeptides because of the presence of a weaker initiator ACG codon, upstream from the major AUG, such that the larger protein contains an N-terminal extension. Like the human isoforms, DRAC-PKs possess a novel signaling region, the pleckstrin homology domain. DRAC-PK proteins have a similar expression pattern, being regulated both maternally and zygotically, and are expressed throughout Drosophila development. Antisera specific for recombinant DRAC-PK and for its C terminus detected two polypeptides of 66 and 85 kDa in Drosophila extracts. The antirecombinant antisera also recognized a polypeptide of 120 kDa from Drosophila, which apparently shared an epitope related to DRAC-PK sequences. The role of p120 appears to be restricted compared with that of DRAC-PK, since it was not detected in larvae or adult flies. There was no spatial restriction of DRAC-PK expression during embryogenesis, suggesting that localized activation might be a regulatory mechanism for its function. DRAC-PK possesses an intrinsic kinase activity that is 8-fold higher in adult flies than in 0-3-h embryos undergoing rapid mitotic cycles.


INTRODUCTION

Protein phosphorylation is involved in many developmental processes in Drosophila melanogaster(1, 2) . To date, at least 13 tyrosine-specific (3) and 25 serine/threonine-specific protein kinases(3, 4, 5, 6, 7, 8, 9, 10, 11) have been identified in the genome of the fruit fly. The fusion of both molecular biological and classical genetic approaches affords a powerful method for the determination of the developmental function of a given gene product. Some kinases have been shown to have a very specific function in Drosophila, such as sevenless, which plays a role in the differentiation of the R7 photoreceptor cell during the development of the eye(12) , and torso, which is important in the terminal system(2) . In contrast, some display pleiotropic effects, since they lie on signaling pathways that are active during different developmental processes. Most of these are serine/threonine protein kinases, for example fused(13) , shaggy(14, 15) , D-raf(16) , pelle(7) , and cAMP-dependent protein kinase(17) .

We previously reported the molecular cloning of a new subfamily of the serine/threonine protein kinases, termed RAC protein kinase (RAC-PK)(^1)(18) . Two closely related forms, RAC-PKalpha and RAC-PKbeta, have been identified(19) , and phylogenetically they appear to represent the midpoint between protein kinase C and cAMP-dependent protein kinase (protein kinase A). Although the catalytic domain of RAC-PKs displays the highest level of homology to the second messenger-regulated kinases, they seem to have a different mode of regulation. Members of the RAC-PK family contain a pleckstrin homology (PH) domain whose role is probably similar to those of SH2 and SH3 domains, i.e. interaction with other signaling or cytoskeletal molecules(20, 21, 22, 23) . Unlike its closest relatives, protein kinase C and protein kinase A, which are both non-oncogenic protein kinases, RAC-PKalpha was identified as the cellular homologue of v-akt, an oncogene encoding a 105-kDa phosphoprotein(24) .

In order to gain insight into the possible functions of RAC-PK, we have isolated and characterized the Drosophila homologue of the RAC-PK gene, termed DRAC-PK. In our study we demonstrate that the DRAC-PK gene encodes two polypeptides whose expression is under both maternal and zygotic control. Both proteins contain a PH domain and possess kinase activity. During the preparation of this manuscript Franke et al.(25) published a report on the molecular cloning of the Drosophila homologue of RAC-PK (Dakt1).


MATERIALS AND METHODS

Isolation of cDNA and Genomic Clones Encoding DRAC-PK

A Drosophila adult cDNA library in gt11 (kindly provided by Dr. B. Hovemann of the Center for Molecular Biology, Heidelberg) and a 2-14-h embryo library in the Uni-ZAP XR vector (Stratagene) were screened as described previously(26) . The EcoRI inserts obtained from positive gt11 clones were subcloned into the pBluescript vector (Stratagene) for further analysis, whereas pBluescript plasmids were excised from the ZAPII phage using R408 helper phage according to the manufacturer's protocols.

Genomic clones were isolated from a Drosophila library (27) constructed in EMBL4. Several clones were isolated and characterized by restriction enzyme analysis. One of the clones, SDGL-DRAC 10 with a 12-kb-long EcoRI insert, contained the entire DRAC-PK gene. Fragments of the SDGL-DRAC 10 were subcloned into the pBluescript vector following digestion with EcoRI, BamHI, and ClaI. The DRAC-PK gene was sequenced on both strands using overlapping restriction subclones.

DNA Sequencing

cDNAs and genomic subclones were sequenced by the dideoxynucleotide chain termination method (28) using Sequenase version 2.0 (U. S. Biochemical Corp.). Sequencing reactions were primed with either the universal or reverse sequencing primers or specific oligonucleotides. DNA sequence analysis was performed using the University of Wisconsin Genetics Computer Group (GCG) software package (29) . Data base (GenBank, EMBL, Swissprot, and GP) searches were performed with Fasta and Tfasta programs(30) .

Northern Blot Analysis

Total RNA was isolated from staged embryos, larvae, and adult flies using the method of Chomczynski and Sacchi(31) . For Northern analysis 20 µg of total RNA was fractionated on a 0.8% formaldehyde/agarose gel and transferred to a nylon membrane (Zeta-probe, Bio-Rad) according to the manufacturer's protocols. Hybridization was performed overnight at 42 °C in a solution containing 50% formamide, 5 times SSC, 5 times Denhardt's solution, 2% SDS, 0.05% PP(i), and 0.25 mg/ml herring sperm DNA, with probes that were radiolabeled by random priming(32) , followed by three 30-min washes at 60 °C in 1 times SSC. Autoradiography was at -70 °C with two intensifying screens. Two probes were used for Northern analysis, the DRAC 7 cDNA and a specific probe located between the two putative polyadenylation sites at 4374-4379 and 5013-5018 that was prepared by PCR amplification of this region using two oligonucleotide primers, 5`GGGAATTCTTATACCATGATAACGAAGG (EcoRI site underlined) and 3` CCTCTAGACATAAAGCACAGCACATAGAG (XbaI site underlined).

Primer Extension

To map the 5`-end of the DRAC-PK gene two antisense 27-base pair oligonucleotides (positions 551-577 and 2079-2105) were used with poly(A) RNA prepared from an overnight Drosophila embryo collection and from adult females. Primers were end-labeled with [-P]ATP (7000 Ci/mmol, ICN) by T4 polynucleotide kinase. Labeled primer (2.5 times 10^5 cpm) was hybridized with 10 µg of poly(A) RNA at 65 °C for 75 minutes, in 50 µl of a buffer containing 40 mM PIPES, pH 6.4, 400 mM NaCl, and 1 mM EDTA. After precipitation with 0.3 M sodium acetate/ethanol, samples were resuspended in 20 µl of reverse transcriptase buffer (50 mM Tris-HCl, pH 8.5, 8 mM MgCl(2), 30 mM KCl, 2.5 mM dithiothreitol, 1 mM of each dNTP, 20 units of RNAsin, 50 µg/ml of actinomycin D, and 25 units of avian reverse transcriptase) and incubated at 42 °C for 2 h. Reactions were terminated by precipitating with 0.3 M ammonium acetate/ethanol and analyzed on a sequencing gel. The size markers were sequencing reactions of the DRAC-PK genomic subclone containing the promoter region, primed with the same oligonucleotides.

In Situ Hybridization to Whole-mount Embryos and Ovaries

The DRAC 7 cDNA was labeled with digoxygenin-dUTP (Boehringher Manheim) by random priming(32) . Embryos were prepared according to the modified method of Tautz and Pfeifle(33) . Fixation was performed in 10% formaldehyde made in PBS (8 mM Na(2)HPO(4), 1.5 mM NaH(2)PO(4), pH 7.5, 140 mM NaCl, and 2.5 mM KCl) containing 50 mM EGTA and an equal volume of heptane. After a 20-min incubation the aqueous phase was removed, an equal volume of methanol was added, and embryos were devitelinized by vigorous shaking. Ovaries were dissected and fixed as described(34) . The peritoneal sheaths were removed from the ovaries for better accessibility to the ovarioles. Subsequent steps were the same for both embryos and ovaries. They were rehydrated in methanol/PBST (PBS and 0.1% Tween-20). Prehybridization, hybridization, and detection were as described(33) .

In Situ Hybridization to Polytene Chromosomes

To determine the localization of the DRAC-PK gene on polytene chromosome squashes, the DRAC 7 cDNA probe was biotinylated by nick-translation(35) . Hybridization was detected using the Vectastain Elite ABC kit (Vector Laboratories) according to the manufacturer's protocols.

Preparation of Recombinant DRAC-PK66 and DRAC-PK85

For the preparation of the DRAC-PK66 expression construct an NdeI site was introduced at the initiator ATG by PCR. Amplification was performed using the 5`-oligonucleotide CCCATATGTCAATAAACACAACTTTCG (NdeI site underlined) and a vector primer. The amplified product was subcloned into pRK172 (36) as an NdeI-EcoRI fragment. To prepare recombinant DRAC-PK85 the initiator ACG in the SDE-RAC 109 cDNA was mutated into an ATG by PCR with the 5`-oligonucleotide CCCATATGAATTACCTACAGTTTGTTC (NdeI site underlined) and a vector primer and subcloned into the pRSET-A vector (Invitrogen) as an NdeI-XhoI fragment. The recombinant DRAC-PK proteins were expressed in Escherichia coli JM109 (DE3) (Promega).

Generation and Purification of Antisera Specific for the Recombinant Protein

Recombinant DRAC-PK66 was partially purified by sedimentation and washing of inclusion bodies, followed by anion exchange chromatography in the presence of 8 M urea. Initially rabbits were immunized subcutaneously with 600 µg of purified recombinant DRAC-PK66 in complete Freund's adjuvant, followed by booster injections at 4-week intervals. Antisera (No. 36) was purified by protein A chromatography(37) , followed by ``negative'' purification on a column prepared from bacterial extracts coupled to Affi-Gel 10/15 agarose (Bio-Rad). Antirecombinant antisera were finally affinity-purified on polyvinylidene difluoride (PVDF) strips with bound recombinant DRAC-PK66 protein. After overnight incubation at 4 °C, the strips were washed with a buffer containing 1 times TBS (50 mM Tris-HCl, pH 7.6, and 150 mM NaCl) 1% Triton X-100, and 0.5% Tween-20, followed by washes in 1 times TBS and H(2)O. Specific antibodies were eluted in a buffer containing 50 mM glycine, pH 2.3, 500 mM NaCl, 0.02% bovine serum albumin, and 0.2% Nonidet P-40, immediately neutralized with 100 mM Tris-HCl, pH 8.0, dialyzed against 1 times TBS, and concentrated 5-fold.

Generation and Purification of Antisera Specific for the C-terminal peptide of DRAC-PK85/66 and for the N-terminal Peptide of DRAC-PK85-

Peptides No. 239 (STSTSLASMQ with 4 alanine residues introduced as a spacer at the N terminus) and No. 334 (^3YLPFVLQRRSTVVASA^18 containing an alanine residue at the N terminus) were coupled to keyhole limpet hemocyanin (38) and used to immunize rabbits. Anti-C-terminal antisera (No. 41) were purified by precipitation with 50% ammonium sulfate, followed by affinity chromatography on a column prepared from peptide 239 coupled to Affi-Gel 15 (Bio-Rad) according to the manufacturer's instructions. Anti-N-terminal antisera (No. 46) were negatively purified on PVDF strips containing bacterial extracts, followed by affinity purification with recombinant DRAC-PK85 immobilized on PVDF strips.

Transient Transfection of COS-1 Cells

The cDNA clone DRAC 7 was subcloned in both orientations into the EcoRI site of the mammalian expression vector pECE(39) . Constructs were designated as pECE. DRAC 7a (for the antisense orientation) and pECE.DRAC 7s (for the sense orientation). The cDNAs SDE-RAC 109 and SDE-RAC 105 were released from pBluescript as EcoRI-XhoI fragments and ligated into the pECE vector digested with EcoRI and XbaI together with an oligonucleotide adapter containing XhoI-EcoRI-XbaI restriction sites. The pECE.SDE-RAC 109.ATG construct was prepared by mutating the initiator ACG into an ATG by PCR, using the 5`-oligonucleotide CCCAAGCTTCAACATGAATTACCTACCGTTTGT (HindIII site underlined) and a vector primer, which allowed subcloning into the pECE vector following digestion with HindIII and KpnI. COS-1 cells were maintained in 10-cm dishes in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum (Life Technologies, Inc.), at 37 °C, and in an atmosphere with 6% CO(2). COS-1 cells at 70-80% confluency were transfected 24-48 h after plating by a DEAE-dextran method (40) . Cells were harvested 48-60 h after transfection.

Western Blot Analysis

Whole cells and Drosophila adults and embryos were lysed by 15 strokes in a Dounce homogenizer in a buffer containing 50 mM Tris-HCl, pH 7.6, 120 mM NaCl, 1% Nonidet P-40, 1 mM EDTA, 1 mM EGTA, 25 mM NaF, 25 mM beta-glycerol phosphate, 15 mM PP(i), 30 mMp-nitrophenyl phosphate, 1 mM sodium vanadate, 2 µg/ml leupeptin, 2 µg/ml aprotinin, 2 µg/ml pepstatin A, 1 mM phenylmethylsulfonyl fluoride, and 1 mM benzamidine. Homogenates were centrifuged at 4 °C once (for cell extracts) or twice (for Drosophila extracts) for 15 min at 15,000 times g. Proteins were separated by 7.5% SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to PVDF-Immobilon membranes (Millipore Corp.). The filters were blocked for 1 h with 5% non-fat dry milk in 1 times TBS, 1% Triton X-100, and 0.5% Tween-20 and then incubated for 2 h with affinity-purified anti-DRAC-PK antibodies diluted 10-fold in the same blocking solution. After three washes in blocking buffer membranes were incubated for 1 h with 0.1 µCi/ml of I-labeled anti-rabbit IgGs from donkey (Amersham Corp.). Specific bands were detected by autoradiography after exposure at -70 °C with two intensifying screens. For quantification blots were exposed to a PhosphorImager screen (Molecular Dynamics). Apparent molecular masses were determined using molecular size standards from Bio-Rad.

Immunoprecipitation and in Vitro Kinase Assay

Freshly prepared Drosophila extracts (see above) were used to immunoprecipitate active DRAC-PK. Protein concentration was adjusted to 1 mg/ml. Extracts were precleared twice with volume Pansorbin (Calbiochem) and volume Sepharose 4B (Pharmacia Biotech Inc.). Protein A-Sepharose, washed extensively with lysis buffer, was incubated with affinity-purified anti-DRAC-PK antibody No. 36 overnight at 4 °C and then washed extensively. Precleared extracts were added to antibody-saturated protein A-Sepharose and incubated for 3 h on ice with occasional mixing. Pelleted beads were washed extensively with lysis buffer (containing 1 M NaCl), followed by a wash with kinase buffer (50 mM Tris-HCl, pH 7.5, and 1 mM dithiothreitol) and resuspended in 30 µl of the same buffer. In vitro kinase assays were performed for 30 min at 30 °C in a reaction volume of 50 µl containing 30 µl of immunoprecipitate, 0.5 mg/ml myelin basic protein (MBP) (Sigma), 10 mM MgCl(2), 1 µM protein kinase A inhibitor peptide (Peninsula Laboratories, Inc.), and 50 µM [-P]ATP (1600 cpm/pmol). The reaction was stopped by the addition of SDS sample buffer. Samples were resolved by 13.5% SDS-PAGE, and phosphorylated MBP was visualized by autoradiography. To determine the DRAC-PK-specific activity, phosphorylated bands were excised, and incorporated phosphate was measured by scintillation spectrophotometry.

Immunolocalization Studies

Drosophila embryos were fixed and devitelinized as described above. After rehydration they were blocked for 30 min with 1% bovine serum albumin in PBST and incubated overnight at 4 °C with affinity-purified antibody No. 36. Biotinylated anti-rabbit IgGs (Vector Laboratories) were preadsorbed with fixed embryos to reduce the background. Detection was performed with the Vectastain Elite ABC kit (Vector Laboratories) according to the manufacturer's protocols.


RESULTS

Structure of the Drosophila RAC-PK Gene

Initially we used the RAC-PKalpha cDNA (18) to isolate clones that encode the Drosophila homologue. Subsequently DRAC-PK cDNAs were used to screen adult and embryo cDNA libraries. Several cDNAs were isolated and partially sequenced (Fig. 1). The DRAC 7 and the SDE-RAC 109 clones were sequenced completely. In parallel we isolated a genomic clone, SDGL-DRAC 10, that contains the entire DRAC-PK gene. Restriction, Southern blot, and sequence analyses showed that the DRAC-PK gene spans a 6-kb region and has seven exons (Fig. 1).


Figure 1: Structure of the DRAC-PK gene. The restriction map of the genomic clone SDGL-DRAC 10 is presented, and the DRAC-PK gene is shown as a thick bar. Exons are represented as boxes.Filled and open areas are coding and noncoding sequences, respectively. Initiator codons are shown as filled inverted triangles for the ATG, and open triangles for the ACG. The two polyadenylation signals are indicated by arrows. The cDNAs DRAC 7 (from an adult fly library) and SDE-RAC 109 and 105 (from a Drosophila embryo library) are drawn below. Note that the cDNA SDE-RAC 105 contains at the 5`-end 45 nucleotides derived from the intronic sequence. E, EcoRI; B, BamHI; C, Cla; S, SacII.



Sequence Analysis of DRAC-PK

The nucleotide sequence of the DRAC-PK gene and predicted amino acid sequence are presented in Fig. 2. A sequence ATCAGTT, which fits well to the consensus for transcription initiation in Drosophila (ATCA(G/T)T(C/T) (41) ) was found in the promoter region, about 20 nucleotides from the 5`-end of cDNA SDE-RAC 109 (nucleotide 389). However, this sequence is not preceded by a typical TATA box, and the first one is present 260 nucleotides upstream from the putative transcription initiation site. Analysis of the promoter region by primer extension using an oligonucleotide that hybridizes 185 nucleotides downstream of the 5`-end of the SDE-RAC 109 cDNA revealed that transcription of the DRAC-PK gene initiates at four major sites (nucleotides 367, 378, 417, and 432) that all mapped in close proximity to the SDE-RAC 109 start site (Fig. 3). The same pattern was observed with poly(A) RNA from both embryos and adult females, whereas the signal could not be detected in a control reaction in which tRNA was used (Fig. 3). A similar result was obtained upon extension of a primer that hybridizes at the 5`-end of the second exon (data not shown).


Figure 2: Nucleotide sequence of the DRAC-PK gene and predicted amino acid sequence. The promoter and exon sequences are in uppercase letters; intron sequences are in lowercase letters. The putative transcription initiation site (found at positions 366-372) is in italic letters, and the start of the cDNA SDE-RAC 109 is indicated by an arrow. Each of the four transcription initiation sites are indicated by an asterisk. opa repeats in the first exon are underlined. The two initiator codons and the corresponding methionine residues are in boldface letters. Translation from the first initiator codon (ACG at position 2092 in the genomic sequence) would give a 611-amino acid-long polypeptide, whereas usage of the second one (at 2335) would produce a 580-amino acid-long polypeptide. Four putative mRNA destabilization signals in the 3`-untranslated region are underlined, and the two polyadenylation signals are double-underlined.




Figure 3: Mapping the 5`-end of the DRAC-PK gene by primer extension. An oligonucleotide that is complementary to the upper part of the first exon (positions 551-577) was hybridized either with yeast tRNA as a control or with poly(A) RNA from Drosophila embryos (E) and adult females (A). A sequencing reaction where the same unlabeled oligonucleotide was used to sequence the DRAC-PK genomic subclone that contains the promoter region is shown to the left. The 5`-end of the SDE-RAC 109 cDNA is indicated by an arrow. Each of the four putative transcription initiation sites is marked by an asterisk.



The first, noncoding exon, which is located 1.2 kb upstream of exon 2, contains opa repeats, which are also present in several developmentally regulated Drosophila genes(42) . The remaining six exons are coding and are separated by five small introns (60-70 base pairs long). The SDE-RAC 105 cDNA (which contains exons 2-7) has at its 5`-end 45 nucleotides derived from the 3`-end of the 1.2-kb-long intron and probably represents a splicing intermediate (see Fig. 1).

The last exon encodes multiple polyadenylation signals. Analysis of the 3`-end of DRAC-PK cDNAs isolated from a Drosophila embryo library revealed that two of these are used (at positions 4374-4379 and 5590-5595). Also, four potential mRNA AUUUA destabilization signals (43, 44) are found in the 3`-untranslated region between the two polyadenylation signals. The same AUUUA sequences are present in the 3`-untranslated region of both human RAC-PKs, at positions 1709 and 1849 in the alpha isoform(18) , and at position 1800 in the beta isoform sequence(19) .

A putative initiation codon (AACCATG) in the correct context for translation initiation (45) was found in the second exon. The predicted open reading frame encodes a 530-amino acid polypeptide highly homologous to human RAC-PKalpha and -beta, with a predicted molecular mass of 59.9 kDa and an isoelectric point of 5.7. This reading frame remained open almost to the 5`-end of the second exon, but no upstream in-frame initiator codons could be found. Expression of the cDNA DRAC 7 in COS-1 cells produced a protein of the expected size (66 kDa), but expression of the longer cDNAs SDE-RAC 109 and 105 revealed the presence of a higher molecular weight form (85 kDa) besides the major 66-kDa protein (see Fig. 7A). These data suggested the existence of an upstream weaker initiation codon near the 5`-end of the second exon. Analysis of the genomic and cDNA sequences suggested that the putative initiator codon was an ACG preceded by CAAC, a sequence compatible with the consensus for translation initiation in Drosophila (C/A)AA(C/A)(45) ). The open reading frame that starts from this upstream initiation codon translates into a 611amino acid-long polypeptide, with a predicted molecular mass 68.5 kDa and an isoelectric point of 6.2. The apparent molecular mass on SDS-PAGE (85 kDa) is higher than the predicted molecular mass, which could be explained by a high proline content (11%) in the N-terminal extension of the larger DRAC-PK polypeptide. The two protein forms were therefore termed DRAC-PK66 and DRAC-PK85, according to their apparent molecular masses on SDS-PAGE.


Figure 7: Identification of DRAC-PK protein in transfected COS-1 cells and in Drosophila extracts by Western blot analysis. COS-1 cells were transfected with the following constructs: pECE. DRAC 7 antisense (DRAC7a) and pECE.DRAC 7 sense (DRAC7s), pECE.SDE-RAC 105 (RAC105), pECE.SDE-RAC 109 (RAC109), and pECE.SDE-RAC 109.ATG (109.ATG). 25 µg of COS-1 cell extracts were subjected to 7.5% SDS-PAGE. Proteins were transferred to PVDF membrane, and specific bands were detected using affinity-purified anti-DRAC-PK antibody No. 36 (A), No. 41 (B), or No. 46 (C). 20 and 40 µg of protein from Drosophila 0-3-h-old embryo, adult, and S2 cell extracts were analyzed by Western blotting with the No. 36 antisera (D). Molecular size markers in kDa are shown.



The deduced amino acid sequences of the DRAC-PK proteins possess all conserved motifs of serine/threonine protein kinases(46) . The motif -Gly-X-Gly-X-X-Gly-, residues 273-278 in the DRAC-PK85 sequence (Fig. 4), with a Lys residue at position 295 conformed exactly to a consensus ATP binding motif (47) . Two motifs, -Asp-Leu-Lys-Leu-Glu-Asn- and -Gly-Thr-Pro-Glu-Tyr-Leu-Ala-Pro-Glu-, which confer serine/threonine specificity, were found at amino acids 389-394 and 426-434, respectively.


Figure 4: Homology between predicted amino acid sequences of DRAC-PK and human RAC-PKalpha and beta isoforms. The sequences were aligned using the PileUp program based on the progressive alignment method (73) and then optimized by eye. Gaps (.) were introduced for maximum alignment. -, identical amino acids. The beginning and end of the PH domain are indicated by vertical bars. The catalytic domain is boxed, with asterisks indicating consensus residues of the ATP binding domain and serine/threonine-specific protein kinases. Serine and threonine residues at the N-terminal extension of DRAC-PK85 and at the C terminus are highlighted.



Comparison of the predicted Drosophila and human peptide sequences (Fig. 4) showed the conserved nature of RAC-PKs. Overall, the degree of homology between RAC-PKalpha and DRAC-PK was 76% (62% identity), and homology between RAC-PKbeta and DRAC-PK was 75% (61% identity). The catalytic domain of DRAC-PK exhibited a high degree of homology to those of the human alpha and beta isoforms (86 and 87%, respectively). As in the human isoforms, DRAC-PKs also possess a PH domain that is located N-terminal to the catalytic domain (20) and is 71% homologous to the PH domain of human RAC-PKs. This region has been identified in 71 signaling and cytoskeletal molecules, indicating its involvement in signal transduction, possibly by interacting with GTP binding proteins(22, 23) . Between the PH and catalytic domains DRAC-PKs have an 11-amino acid insertion (positions 224-234), which is not present in the human isoforms.

DRAC-PKs have an extension at the amino-terminal region in comparison with human homologues. DRAC-PK85 possesses an additional 81 amino acid residues at its N terminus that did not show any significant homology to sequences in the data bases (GenBank, EMBL, Swissprot, and GP). The predicted extension of DRAC-PK85 has an isoelectric point of 10.7 and is rich in serine/threonine residues (highlighted in Fig. 4). At the C terminus, both DRAC-PK forms have an 18-amino acid extension, which, like the similar extension found in human RAC-PKbeta(19) , has a high serine/threonine content (highlighted in Fig. 4).

Homology to Other Protein Kinases

The DRAC-PK catalytic domain showed the highest degree of homology to serum and glucocorticoid-regulated kinase, sgk (72% homology, 57% identity(48) ), protein kinase C (76% homology, 56% identity (49) ), mitogen-stimulated ribosomal S6 kinase (69% homology(50) ), and the alpha catalytic subunit of bovine protein kinase A (65% homology (51) ). These were similar to the homologies seen with RAC-PKalpha and -beta(19) . DRAC-PKs have slightly lower homology to the Drosophila homologues of protein kinase C and protein kinase A. Of the three known Drosophila protein kinase C genes, DRAC-PK shows 72% homology to 98F (52) and 62% to the Drosophila protein kinase A catalytic subunit DC0(53) .

Expression of DRAC-PK Transcripts

We analyzed the temporal and spatial expression of the DRAC-PK transcripts during development. For Northern blot analysis two probes were used: the cDNA DRAC 7 and a probe from the 3`-untranslated region located between the first polyadenylation signal (nucleotides 4374-4379) and a polyadenylation signal at nucleotides 5013-5018 in the DRAC-PK genomic sequence. Whereas DRAC 7 recognizes all classes of transcripts, the 3`-end probe would detect only those that use the second polyadenylation signal. Northern analysis of total RNA isolated from staged collections of embryos and larvae and from adult female flies using DRAC 7 as a probe revealed the presence of two major transcripts of 2.7 and 3.9 kb (Fig. 5, A and B). The 2.7-kb transcript was expressed at high levels in 0-3-h embryos and was also expressed in adult females, indicating that this is a maternally regulated mRNA. The 3.9-kb transcript was expressed throughout embryogenesis and larval stages (Fig. 5, A and B) and was also detected in early and late pupal stages (data not shown). This transcript was also expressed in the adult female flies, indicating both maternal and zygotic regulation of gene expression. When the 3`-probe was used, only the larger transcript could be detected (Fig. 5C), suggesting that the 2.7-kb transcript was generated by use of the first polyadenylation signal. This indicates that the cDNA SDE-RAC 109 was derived from the 2.7-kb maternal transcript.


Figure 5: Northern blot analysis of DRAC-PK transcript. Total RNA (20 µg) isolated from the indicated developmental stages was fractionated on a 0.8% agarose/formaldehyde gel and transferred to a nylon membrane. Blots were hybridized either with cDNA DRAC 7 (A and B) or a 3`-end probe detecting only transcripts that use the second polyadenylation signal (C). After hybridization blots were washed at 60 °C in 1 times SSC for 3 times 30 min, and exposed at -70 °C between two intensifying screens.



In situ hybridization to whole-mount embryos and dissected ovaries, using DRAC 7 as a probe, demonstrated that maternally provided DRAC-PK transcripts were synthesized in the nurse cells of the ovaries (Fig. 6A). During oocyte maturation there was no apparent localization of the mRNA (Fig. 6B). No variation in expression could be detected throughout embryogenesis. Before cellularization (Fig. 6C), after cellularization (Fig. 6D), and throughout gastrulation, germ band extension, and retraction (Fig. 6E) DRAC-PK transcripts remained uniformly distributed and were expressed at a high level.


Figure 6: In situ localization of DRAC-PK transcript during oogenesis and embryogenesis. Whole-mount embryos and ovaries were hybridized with cDNA DRAC 7 as a probe. A, stage 10 oocyte; B, stage 12 oocyte; C, syncytial embryo before nuclear migration; D, embryo at cellular blastoderm; E, dorsal view of embryo after germ band retraction. The anterior is to the left.



Chromosomal Localization

In situ hybridization showed that the DRAC-PK gene is localized at the 89B4-10 region of polytene chromosomes, which agrees with the finding of Franke et al.(25) , who mapped it to 89BC. Only one signal was detected. Two recessive embryonic mutations map to this locus: serpent and pannier(54) . In situ hybridization to polytene chromosomes of Drosophila strains carrying deficiencies in this region, Df(3R)sbd and Df(3R)sbd, suggested that the DRAC-PK gene might correspond to the pannier locus, but our attempts to rescue the pannier phenotype were unsuccessful, and subsequently the pannier locus was shown to encode a GATA transcription factor(55, 56) . In order to achieve fine mapping of the DRAC-PK gene, we isolated genomic clones spanning a 70-kb region by bidirectional chromosomal walking. We were therefore able to establish that the DRAC-PK gene is 30 kb proximal to the Stubble gene(57) . This finding places the DRAC-PK gene at 89B9, between the pannier and the Stubble genes, with its 5`-end closest to thecentromere.

Identification of the DRAC-PK Protein

In order to gain insight into the different forms of the protein and their functions in vivo, we generated antisera specific for the bacterially expressed recombinant DRAC-PK66 protein (No. 36), for the C terminus of the DRAC-PKs (No. 41), and for the N terminus of DRAC-PK85 (No. 46). Specificity and sensitivity of the antirecombinant antisera were tested by Western blotting using serial dilutions of the partially purified recombinant proteins. To further confirm specificity of the antisera, we analyzed protein products of COS-1 cells transfected with pECE.DRAC 7a (antisense) and pECE.DRAC 7s (sense) constructs. Western blot analysis revealed a specific signal in COS-1 cells transfected with the sense, but not with the antisense construct (Fig. 7A, lanes 1 and 2). The polypeptide expressed in COS-1 cells had an apparent molecular mass of 66 kDa, which agrees with the predicted molecular mass (60 kDa). We also expressed cDNAs SDE-RAC 109 and 105 in COS-1 cells (Fig. 7A, lanes 3 and 4). We detected two molecular size forms, of 66 and 85 kDa, with the lower molecular mass form approximately 6 times more abundant. This implied that both forms could be produced from a single transcript. To further confirm that DRAC-PK85 initiates from a weaker initiator codon, the ACG in the SDE-RAC 109 cDNA was mutated into an ATG by PCR, and the resulting plasmid (pECE.SDE-RAC 109.ATG) was expressed in COS-1 cells. This produced a major 85-kDa form and a less abundant 66-kDa form, converting the DRAC-PK66:DRAC-PK85 ratio from 6:1 to 1:3 (Fig. 7A, lane 5). Both DRAC-PK proteins could also be detected by the No. 41 antisera (Fig. 7B). As expected, only the larger form was detected by the antisera (No. 46) specific for the N terminus of DRAC-PK85 (Fig. 7C).

To analyze DRAC-PK expression in flies, we examined the protein products in early embryos (0-3 hours), adult flies and S2 cells (which are of late embryonic origin). Western blot analysis revealed the presence of three distinct molecular size forms with apparent molecular masses of 66, 85, and 120 kDa that were differentially expressed (Fig. 7D). These bands were not detected by the preimmune antisera or after competition with the DRAC-PK recombinant protein (data not shown). The two lower molecular size forms (DRAC-PK66 and -85) were present in all extracts examined, whereas the 120-kDa form (p120) was detected only in embryos and S2 cells (see below). The major form was DRAC-PK66 that comigrated with protein product from COS-1 cells expressing the DRAC 7 cDNA. Although the expression of DRAC-PK66 and -85 was about 2-fold higher in embryos and S2 cells, they appeared with a constant 3:1 ratio in Drosophila extracts, which is slightly lower than in COS-1 cells expressing the SDE-RAC 109 and 105 cDNAs.

In order to better characterize p120, we performed Western blot analysis of Drosophila embryos with an anti-peptide antibody No. 41, specific for the C terminus of DRAC-PK. Only two bands were detected, DRAC-PK66 and DRAC-PK85, that could be competed with the antigenic peptide (data not shown). We also performed Western blot analysis of late mutant embryos homozygous for the deficiency Df(3R)sbd (the DRAC-PK gene is deleted in such flies). The signal for DRAC-PK66 was 10-fold decreased, probably representing a carry-over from the mother, and DRAC-PK85 could not be detected. In contrast, p120 levels remained unchanged. Therefore, we concluded that p120 is not a product of a DRAC-PK transcript.

Western blot analysis with the No. 46 antisera specific for the N-terminal peptide of DRAC-PK85 detected only the 85-kDa form in Drosophila extracts. This band comigrated with DRAC-PK85 that was expressed in COS-1 cells transfected with the pECE.SDE-RAC 109.ATG construct (data not shown).

Developmental Regulation of the DRAC-PK Gene Protein Products

Northern analysis demonstrated that the DRAC-PK gene expression was both maternally and zygotically regulated (see Fig. 5). Also Western blot analysis (Fig. 7D) revealed differences in DRAC-PK protein forms and abundance between embryos and adult flies. Thus, we decided to analyze the expression of the DRAC-PK gene protein products during the Drosophila life cycle (Fig. 8). The major form detected throughout development was DRAC-PK66. The highest level of expression (arbitrarily taken as 100%) was found in 0-3-h embryos and subsequently declined to 60% during late embryogenesis. A further decline in DRAC-PK66 levels was observed during larval development (20% in the third instar larvae), followed by a sharp increase in the early pupae (80%). The protein levels were 30% in adult flies. DRAC-PK85 followed the expression of DRAC-PK66, except in the three larval stages where it could not be detected. There was no difference in the expression of DRAC-PK66 and -85 between female and male flies. p120 was detected during embryogenesis, where its expression followed the pattern of DRAC-PK66 and -85. It was found to be significantly higher in early than in late pupae, which was not the case with DRAC-PK66 and -85. These results suggest the involvement of DRAC-PK and the p120 protein in embryogenesis, as well as postembryonically.


Figure 8: Developmental time course of DRAC-PK protein expression. Protein extracts were made from Drosophila at the indicated stages, and 20 µg was analyzed by Western blotting using affinity-purified anti-DRAC-PK antibody No. 36.



The spatial expression of the DRAC-PK proteins during embryogenesis was analyzed using the affinity-purified antirecombinant antibody No. 36. We found that the proteins were uniformly distributed in all embryonic stages, which is in good correlation with the transcript localization (data not shown). Also, during the syncytial blastoderm stage, specific staining was detected in the cytoplasm surrounding dividing nuclei and was always excluded from the chromatin.

DRAC-PK Possesses an Intrinsic Kinase Activity

Since DRAC-PK is highly homologous to the human RAC-PKalpha, which shows the highest specific activity toward MBP(18) , we decided to use this substrate to assay kinase activity in immunoprecipitates prepared from Drosophila extracts. The DRAC-PK protein immunoprecipitated with antirecombinant antibody No. 36 from 0-3-h embryos and adult flies (in the presence of phosphatase inhibitors) phosphorylated MBP in vitro (Fig. 9). Only DRAC-PK66 and -85 were detected in the immunoprecipitates, whereas p120 could not be detected (Fig. 9). The DRAC-PK protein and the associated kinase activity could not be detected in a control experiment, when the antibody was either omitted (Fig. 9) or preincubated with the recombinant protein immobilized on PVDF strips.


Figure 9: Demonstration of the DRAC-PK activity. Proteins were immunoprecipitated from 0.3 and 0.6 mg of 0-3-hour-old embryos and adult flies using affinity-purified antibody No. 36, which was omitted in a control experiment. In vitro kinase assays were performed as described under ``Materials and Methods,'' and 50% of the assay mixture was analyzed by SDS-PAGE. Phosphorylated MBP was visualized by autoradiography. The DRAC-PK protein was detected in immunoprecipitates by Western blot analysis, using the same antibody.



The specific activity of DRAC-PK immunoprecipitated from early embryos was 0.04 pmol/min/mg, whereas that from adult flies was 0.1 pmol/min/mg. When the DRAC-PK protein levels in immunoprecipitates were quantified, the activity of DRAC-PK from adult flies was 8-fold higher.


DISCUSSION

In this report we present the characterization of the Drosophila RAC protein kinase gene and protein products. The DRAC-PK gene consists of seven exons producing two differentially regulated mRNA species via the use of two different polyadenylation signals. This may represent a regulatory mechanism for the temporal and spatial expression of the DRAC-PK gene. This hypothesis is supported by the presence of four putative AUUUA mRNA destabilization signals (43, 44) located between the first and the second polyadenylation sites. The cDNA cloned by Franke et al.(25) is derived from the zygotic DRAC-PK transcript, since it contains the second polyadenylation signal. However, in contrast to their observations, we found that the smaller DRAC-PK transcript represents a maternally derived mRNA and that DRAC-PK gene expression is regulated not only at the zygotic level, but also by the mother.

Heterogeneity of transcripts has been observed in the case of some other Drosophila genes that encode protein kinases, such as DC0 (53) and shaggy(15) . The DC0 gene for the catalytic subunit of protein kinase A contains four polyadenylation signals that give rise to 4 different transcripts encoding the same protein, whereas the shaggy gene encodes at least 10 transcripts and five related proteins that differ in their N-terminal domains and/or the C termini. In the case of the DRAC-PK gene both transcripts encode two protein forms with distinct N termini. Translation of the larger 611-amino acid polypeptide apparently initiates from an ACG codon that is less efficiently used than the AUG for the shorter, 530-amino acid polypeptide. Several viral and mammalian mRNAs ( (58, 59, 60) and references therein) use non-AUG codons for translation initiation. Some Drosophila proteins also initiate from non-AUG codons (61, 62, 63, 64) . Experiments in COS-1 cells (65) have demonstrated that non-AUG codons can initiate translation when they are in a good context, but they differ in their initiation potential. Some of the messages use an upstream non-AUG codon to produce two or more polypeptides (Refs. 59, 60, 63, and references therein), but the abundance of the N-terminally extended protein depends on the start codon. In all of the cases the larger form is thought to have a regulatory role, since its synthesis is usually at a lower level. It is possible that DRAC-PK85 has a similar function. Also, the weaker upstream initiation codon acts as a negative regulator of DRAC-PK66 expression from the downstream AUG. In addition, the 460-nucleotide 5`-untranslated region attenuates expression of both DRAC-PK forms.

Both protein forms encoded by the DRAC-PK gene have a common domain structure, except that the larger polypeptide has an 81-amino acid-long N-terminal extension. The degree of homology between DRAC-PK and the human isoforms (75-76%) is comparable with that between Drosophila and mammalian homologues of protein kinase C (85%(66) ) and protein kinase A (80%(53) ). Such a high level of homology suggests a functional conservation of RAC-PKs. This is also supported by the presence of a PH domain in both Drosophila and human isoforms(20, 67) , showing 71% homology/60% identity. However, it is not known if the N-terminal extension of DRAC-PK85 would affect the interaction of the PH domain with its putative partner and thus modify DRAC-PK85 functional characteristics. A similar degree of homology in the PH domain has also been observed between the human and Caenorhabditis elegans RAC-PK homologues (68) as well as between the Drosophila and C. elegans RAC-PK homologues (71 and 69%, respectively). A high degree of homology (62%) in a PH domain has been observed between the mammalian and the Drosophila homologues of the beta-adrenergic receptor protein kinase (betaARK; (4) and (22) ), whereas the degree of homology in the PH domains between the members of the RAC-PK and betaARK families, and the other protein kinases containing a PH domain (67) is lower (ranging from 39 to 50%, see Fig. 10). Such a divergence suggests that different PH domains may interact with similar but not necessarily identical molecules. The PH domain of betaARK was shown to interact with the beta subunits of G-proteins, which could then lead to translocation of betaARK to the membrane(22) . A similar type of interaction was postulated for the PH domains of phospholipases(69) . There are some other examples of signaling molecules containing a PH domain that have been conserved in both mammals and Drosophila. They include SOS and GAP that are known to interact with small GTPases, as well as an SH3 binding protein, dynamin, and a cytoskeletal protein beta-spectrin(22) . It is possible that members of the RAC-PK family also fulfill their function(s) in cell signaling through an interaction with GTP binding proteins.


Figure 10: Alignment of the PH domains from serine/threonine and tyrosine protein kinases. Initially, the sequences were aligned using the PileUp program and then optimized by eye. Accession numbers of the sequences are given in brackets. Human (M77198 and M63167), Drosophila, and C. elegans RAC-PK (M88917) contain a PH domain at the N terminus (residues 6-106 in human RAC-PKs, 108-209 in DRAC-PK85, and 27-128 in DRAC-PK66). The betaARK family members contain a PH domain at the C terminus (residues 560-650 in human betaARK (M80776) and rat betaARK2 (M87855)) and residues 559-655 in the Drosophila G protein-coupled receptor kinase 1 (GPRK1 (M80493)). nrkA is a Trypanosoma brucei serine/threonine protein kinase (L03778) that has a PH domain at the C terminus (residues 333-427). atk (or Btk) is a human B-cell specific tyrosine kinase (X58957), whereas Tsk (or itk) is a mouse T-cell-specific tyrosine kinase (L03778). Their PH domains are located at the N terminus (5-133 in atk, and 6-111 in Tsk) and have a high degree of homology (68.5%). The degree of homology between the RAC-PK family members and the betaARK family members is 39-46%, and between RAC-PKs and nrkA it is 41.5-43.6%. Between RAC-PKs and atk, and RAC-PKs and Tsk, homology is 46-50 and 44-48%, respectively.



We detected three distinct protein forms in Drosophila extracts with apparent molecular sizes of 66, 85, and 120 kDa. By using three different antibodies, we demonstrated that p66 and p85 are products of the DRAC-PK gene, whereas p120 is derived from a distinct gene. The fact that it was detected by antirecombinant antibody (No. 36) and that the signal could be competed with DRAC-PK recombinant protein suggests that p120 shares a common strong epitope or epitopes with DRAC-PK. The expression of all forms is under both maternal and zygotic control, and levels of DRAC-PK66 and DRAC-PK85 show a good correlation to the expression of DRAC-PK mRNA. Although there was no difference in the DRAC-PK protein between female and male flies, message levels were higher in females, which could be explained by higher levels of maternal transcripts in nurse cells and oocytes.

The highest level of expression of DRAC-PK was observed during embryogenesis, when some other Drosophila serine/threonine kinases are known to act: pelle is involved in establishing the dorsoventral polarity in embryos(7) , D-raf and Dsor are transducing signals in the terminal system(70, 8) , fused and shaggy are segment polarity genes(13, 14) , and protein kinase A mediates communication between cells(17) . Mutations in these genes show a maternal effect phenotype. The pattern of DRAC-PK expression suggests it plays a role in embryogenesis.

There was no spatial restriction in the expression of the DRAC-PK transcripts and proteins during embryogenesis, thus resembling protein kinase A(17) , D-raf(16, 70) , and shaggy(15) . The DRAC-PK gene is also expressed postembryonically. The level of DRAC-PK protein decreases during the larval stages and increases again during pupation. Such a pattern of expression has been observed for the D-raf(70) and the Dsor messages(8) . Mutants of the D-raf gene display abnormal proliferation of both somatic and germ line cells(71) , which is consistent with the function that Raf-1 plays in mammalian cells, i.e. transduction of growth-stimulating signals (reviewed in (72) ). Like Raf-1, RAC-PKalpha is also a proto-oncogene. The viral oncogene v-akt transforms cells in culture(24) , suggesting that the proto-oncogene RAC-PKalpha transduces signals that regulate cell growth. It is possible that DRAC-PK might play a similar role in Drosophila development.

We demonstrate that the DRAC-PK protein has intrinsic kinase activity. The specific activity of immunoprecipitated DRAC-PK using MBP as a substrate was estimated to be in the range of 0.04 pmol/min/mg for embryos and 0.1 pmol/min/mg for adult flies. The difference in the DRAC-PK activity between early embryos and adult flies can be explained by different activation states in the two stages. It is likely that the DRAC-PK activity increases after cellularization, when cell signaling through cell surface receptors is taking place. It has been shown that human RAC-PKalpha is heavily phosphorylated in vivo,(^2)which is also the case with the v-akt oncogene(24) , implying that phosphorylation regulates RAC-PK activity. It is therefore possible that a similar mechanism controls DRAC-PK activity.

In summary, our results demonstrate that expression and translation of DRAC-PK transcripts is tightly regulated, implying functional significance of the two DRAC-PK protein forms. Further analysis and isolation of mutant flies will provide information on the role of DRAC-PK and its PH domain in signal transduction.


FOOTNOTES

(^1)
The abbreviations used are: RAC-PK, RAC protein kinase; PH, pleckstrin homology; DRAC-PK, Drosophila RAC protein kinase; bp, base pair; SSC, standard saline citrate; PBS, phosphate-buffered saline; TBS, Tris-buffered saline; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis; PVDF, polyvinylidene difluoride; MBP, myelin basic protein; PIPES, 1,4-piperazinediethanesulfonic acid; kb, kilobase pair(s).

(^2)
T. Jakubowicz, P. F. Jones, and B. A. Hemmings, unpublished data.

*
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank(TM)/EMBL Data Bank with accession number(s) X83510[GenBank].

§
Present address: Regeneron Pharmaceuticals, Inc., 777 Old Saw Mill River Rd., Tarrytown, NY 10591.

**
Present address: Cold Spring Harbor Laboratory, P.O. Box 100, Cold Spring Harbor, NY 11724.

§§
Present address: Massachusetts General Hospital, Harvard Medical School, East 4 13th Street, Bldg. 149, Charlestown, MA 02129.

Present address: Central Laboratory, Blood Transfusion Service, Swiss Red Cross, and Institute of Biochemistry, University of Bern, Freiestrasse 3, CH-3012 Bern, Switzerland.

A
To whom correspondence should be addressed. Tel.: 061-697-40-46; Fax: 061-697-39-76; hemmings{at}fmi.ch.


ACKNOWLEDGEMENTS

We thank Prof. W. Gehring for his encouragement and generous support throughout the project; Prof. C. Nüsslein-Volhard for fly strains; Prof. J. Fristrom for providing the phage from the Stubble chromosome walk; G. Halder for help with immunolocalization experiments; U. Kloter for performing in situ hybridization to chromosomal squashes; F. Fischer, G. Aeschbacher, and P. Müller for synthesis of the peptides and oligonucleotides; and Prof. R. Franklin, Dr. E. Ingley, T. Millward, and N. Andjelkovic for critical comments on this manuscript.


REFERENCES

  1. Siegfried, E., Ambrosio, L., and Perrimon, N. (1990) Trends Genet. 6, 357-362 [CrossRef][Medline] [Order article via Infotrieve]
  2. Perrimon, N. (1993) Cell 74, 219-222 [CrossRef][Medline] [Order article via Infotrieve]
  3. Hunter, T. (1991) Methods Enzymol. 200, 3-37 [CrossRef][Medline] [Order article via Infotrieve]
  4. Cassil, J. A., Whitney, M., Joazeiro, C. A. P., Becker, A., and Zuker, C. S. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 11067-11070 [Abstract/Free Full Text]
  5. Bigs, W. H., III, and Zipursky, S. L. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 6295-6299 [Abstract/Free Full Text]
  6. Ohsako, S., Nishida, Y., Ryo, H., and Yamauchi, T. (1993) J. Biol. Chem. 268, 2052-2062 [Abstract/Free Full Text]
  7. Shelton, C. A., and Wasserman, S. A. (1993) Cell 72, 515-525 [CrossRef][Medline] [Order article via Infotrieve]
  8. Tsuda, L., Inoue, Y. H., Yoo, M.-A., Mizuno, M., Hata, M., Lim, Y.-M., Adachi-Yamada, T., Ryo, H., Masamune, Y., and Nishida, Y. (1993) Cell 72, 407-414 [CrossRef][Medline] [Order article via Infotrieve]
  9. Sugaya, R., Ishimuru, S., Saigo, K., and Emori, Y. (1994) J. Biochem. 115, 150-155 [Abstract/Free Full Text]
  10. Wrana, J. L., Tran, H., Attisano, L., Arora, K., Childs, S. R., Massagué, J., and O'Connor, M. B. (1994) Mol. Cell. Biol. 14, 944-950 [Abstract/Free Full Text]
  11. Yun, B., Farkas, R., Lee, K., and Rabinow, L. (1994) Genes & Dev. 8, 1160-1173
  12. Rubin, G. M. (1991) Trends Genet. 7, 372-377 [Medline] [Order article via Infotrieve]
  13. Préat, T., Thérond, P., Lamour-Isnard, C., Limbourgt-Bouchon, B., Tricoire, H., Erk, I., Mariol, M.-C., and Busson, D. (1990) Nature 347, 87-89 [CrossRef][Medline] [Order article via Infotrieve]
  14. Bourouis, M., Moore, P., Ruel, L., Grau, Y., Heitzler, P., and Simpson, P. (1990) EMBO J. 9, 2877-2884 [Medline] [Order article via Infotrieve]
  15. Ruel, L., Pantesco, V., Lutz, Y., Simpson, P., and Bourouis, M. (1993) EMBO J. 12, 1657-1669 [Medline] [Order article via Infotrieve]
  16. Melnick, M. B., Perkins, L. A., Lee, M., Ambrosio, L., and Perrimon, N. (1993) Development 118, 127-138 [Abstract]
  17. Lane, M. E., and Kalderon, D. (1993) Genes & Dev. 7, 1229-1243
  18. Jones, P. F., Jakubowicz, T., Pitossi, F. J., Maurer, F., and Hemmings, B. A. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 4171-4175 [Abstract/Free Full Text]
  19. Jones, P. F., Jakubowicz, T., and Hemmings, B. A. (1991) Cell Regul. 2, 1001-1009 [Medline] [Order article via Infotrieve]
  20. Haslam, R. J., Koide, H. B., and Hemmings, B. A. (1993) Nature 363, 309-310 [Medline] [Order article via Infotrieve]
  21. Mayer, B. J., Ren, R., Clark, K. L., and Baltimore, D. (1993) Cell 73, 629-630 [CrossRef][Medline] [Order article via Infotrieve]
  22. Musacchio, A., Gibson, T. J., Rice, P., Thomson, J., and Saraste, M. (1993) Trends Biochem. Sci. 18, 343-348 [CrossRef][Medline] [Order article via Infotrieve]
  23. Gibson, T. J., Hyvönen, M., Musacchio, A., and Saraste, M. (1994) Trends Biochem. Sci. 19, 349-353 [CrossRef][Medline] [Order article via Infotrieve]
  24. Bellacosa, A., Testa, J. R., Staal, S. P., and Tsichlis, P. N. (1991) Science 254, 274-277 [Abstract/Free Full Text]
  25. Franke, T. F., Tartof, K. D., and Tsichlis, P. N. (1994) Oncogene 9, 141-148 [Medline] [Order article via Infotrieve]
  26. Stone, S. R., Hofsteenge, J., and Hemmings, B. A. (1987) Biochemistry 26, 7215-7220 [CrossRef][Medline] [Order article via Infotrieve]
  27. Baumgartner, S., Bopp, D., Burri, M., and Noll, M. (1987) Genes & Dev. 1, 1247-1267
  28. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467 [Abstract/Free Full Text]
  29. Devereux, J., Haeberli, P., and Smithies, O. (1984) Nucleic Acids Res. 12, 387-395
  30. Pearson, W. R., and Lipman, D. J. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 2444-2448 [Abstract/Free Full Text]
  31. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159 [Medline] [Order article via Infotrieve]
  32. Feinberg, A. P., and Vogelstein, B. (1983) Anal. Biochem. 132, 6-13 [CrossRef][Medline] [Order article via Infotrieve]
  33. Tautz, D., and Pfeifle, C. (1989) Chromosoma 98, 81-85 [CrossRef][Medline] [Order article via Infotrieve]
  34. Grossniklaus, U., Bellen, H. J., Wilson, C., and Gehring, W. J. (1989) Development 107, 189-200 [Abstract]
  35. Langer-Safer, P. R., Levine, M., and Ward, D. C. (1982) Proc. Natl. Acad. Sci. U. S. A. 79, 4381-4385 [Abstract/Free Full Text]
  36. McLeod, M., Stein, M., and Beach, D. (1987) EMBO J. 6, 729-736 [Medline] [Order article via Infotrieve]
  37. Harlow, E., and Lane, D. (1988) Antibodies: A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  38. Doolitlle, R. F. (1986) Of URFs and ORFs: A Primer on How To Analyze Derived Amino Acid Sequence , University Science Books, Mill Valley, CA
  39. Ellis, L., Clauser, E., Morgan, D. O., Edery, M., Roth, R. A., and Rutter, W. J. (1986) Cell 45, 721-732 [CrossRef][Medline] [Order article via Infotrieve]
  40. Seed, B., and Aruffo, A. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 3365-3369 [Abstract/Free Full Text]
  41. Hultmark, D., Klemenz, R., and Gehring, W. J. (1986) Cell 44, 429-438 [CrossRef][Medline] [Order article via Infotrieve]
  42. Wharton, K. A., Yedvobnick, B., Finnerty, V. G., and Artavanis-Tsakonas, S. (1985) Cell 40, 55-62 [CrossRef][Medline] [Order article via Infotrieve]
  43. Malter, J. S. (1989) Science 246, 664-666 [Abstract/Free Full Text]
  44. Savant-Bhonsale, S., and Cleveland, D. W. (1992) Genes & Dev. 6, 1927-1939
  45. Cavener, D. R. (1987) Nucleic Acids Res. 15, 1353-1361 [Abstract/Free Full Text]
  46. Hanks, S. K., Quinn, A. M., and Hunter, T. (1988) Science 241, 42-52 [Abstract/Free Full Text]
  47. Wierenga, R. K., and Hol, W. G. J. (1983) Nature 302, 842-844 [CrossRef][Medline] [Order article via Infotrieve]
  48. Webster, M. K., Goya, L., Ge, Y., Maiyar, A. M., and Firestone, G. L. (1993) Mol. Cell. Biol. 13, 2031-2040 [Abstract/Free Full Text]
  49. Osada, S., Mizuno, K., Saido, T. C., Akita, Y., Suzuki, K., Kuroki, T., and Ohno, S. (1990) J. Biol. Chem. 265, 22434-22440 [Abstract/Free Full Text]
  50. Kozma, S. C., Ferrari, S., Bassand, P., Siegmann, M., Totty, N., and Thomas, G. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 7365-7369 [Abstract/Free Full Text]
  51. Shoji, S., Ericsson, L. H., Walsh, K. A., Fischer, E. H., and Titani, K. (1983) Biochemistry 22, 3702-3709 [CrossRef][Medline] [Order article via Infotrieve]
  52. Schaeffer, E., Smith, D., Mardon, G., Quinn, W., and Zuker, C. (1989) Cell 57, 403-412 [CrossRef][Medline] [Order article via Infotrieve]
  53. Kalderon, D., and Rubin, G. M. (1988) Genes & Dev. 2, 1539-1556
  54. Jürgens, G., Wieschaus, E., Nüsslein-Volhard, C., and Kluding, H. (1984) Roux's Arch. Dev. Biol. 193, 283-295 [CrossRef]
  55. Ramain, P., Heitzler, P., Haenlin, M., and Simpson, P. (1993) Development 119, 1277-1291 [Abstract]
  56. Winick, J., Abel, T., Leonard, M. W., Michelson, A. M., Chardon-Loriaux, I., Holmgren, R. A., Maniatis, T., and Engel, J. D. (1993) Development 119, 1055-1065 [Abstract]
  57. Appel, L. F., Prout, M., Abu-Shumays, R., Hammonds, A., Garbe, J. C., Fristrom, D., and Fristrom, J. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 4937-4941 [Abstract/Free Full Text]
  58. Boeck, R., Curran, J., Matsuoka, Y., Compans, R., and Kolakofsky, D. (1992) J. Virol. 66, 1765-1768 [Abstract/Free Full Text]
  59. Saris, C. J. M., Domen, J., and Berns, A. (1991) EMBO J. 10, 655-664 [Medline] [Order article via Infotrieve]
  60. Xiao, J. H., Davidson, I., Matthes, H., Garnier, J.-M., and Chambon, P. (1991) Cell 65, 551-568 [CrossRef][Medline] [Order article via Infotrieve]
  61. Sugihara, H., Andrisani, V., and Salvaterra, P. M. (1990) J. Biol. Chem. 265, 21714-21719 [Abstract/Free Full Text]
  62. Bellen, H. J., Kooyer, S., D'Evelyn, D., and Pearlman, J. (1992) Genes & Dev. 6, 2125-2136
  63. Boyd, L., and Thummel, C. S. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 9164-9167 [Abstract/Free Full Text]
  64. DeSimone, S. M., and White, K. (1993) Mol. Cell. Biol. 13, 3641-3649 [Abstract/Free Full Text]
  65. Gupta, K. C., Ono, E., Ariztia, E. V., and Inaba, M. (1994) Bichem. Biophys. Res. Commun. 201, 567-573 [CrossRef][Medline] [Order article via Infotrieve]
  66. Rosenthal, A., Rhee, L., Yadegari, R., Paro, R., Ullrich, A., and Goeddel, D. V. (1987) EMBO J. 6, 433-441 [Medline] [Order article via Infotrieve]
  67. Ingley, E., and Hemmings, B. A. (1994) J. Cell. Biochem. 56, 436-443 in press [CrossRef][Medline] [Order article via Infotrieve]
  68. Waterston, R., Martin, C., Craxton, M., Huynh, C., Coulson, A., Hillier, L., Durbin, R. K., Green, P., Shownkeen, R., Halloran, N., Hawkins, T., Wilson, R., Berks, M., Du, Z., Thomas, K., Tieery-Mieg, J., and Sulston, J. (1992) Nature Genet. 1, 114-123 [CrossRef][Medline] [Order article via Infotrieve]
  69. Parker, P. J., Hemmings, B. A., and Gierschik, P. (1994) Trends Biochem. Sci. 19, 54-55 [CrossRef][Medline] [Order article via Infotrieve]
  70. Ambrosio, L., Mahowald, A. P., and Perrimon, N. (1989) Nature 342, 288-291 [CrossRef][Medline] [Order article via Infotrieve]
  71. Nishida, Y., Hata, M., Ayaki, T., Ryo, H., Yamagata, M., Shimizu, K., and Nishizuka, Y. (1988) EMBO J. 7, 775-781 [Medline] [Order article via Infotrieve]
  72. Li, P., Wood, K., Mamon, H., Haser, W., and Roberts, T. (1991) Cell 64, 479-482 [CrossRef][Medline] [Order article via Infotrieve]
  73. Feng, D.-F., and Doolitlle, R. F. (1987) J. Mol. Evol. 25, 351-360 [Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike