Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stanley, S. L.
Right arrow Articles by Li, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stanley, S. L., Jr.
Right arrow Articles by Li, E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 8, Issue of February 24, 1995 pp. 4121-4126
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
The Serine-rich Entamoeba histolytica Protein Is a Phosphorylated Membrane Protein Containing O-Linked Terminal N-Acetylglucosamine Residues (*)

(Received for publication, November 4, 1994; and in revised form, December 15, 1994)

Samuel L. Stanley Jr. (1) (2)(§) Kairong Tian (1) Joseph P. Koester (3) Ellen Li (1) (4)(¶)

From the  (1)Departments of Medicine, (2)Molecular Microbiology, (3)Cell Biology, and (4)Biochemistry and Molecular Biophysics, Washington University School of Medicine, St. Louis, Missouri, 63110

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Previously, we described the isolation of a cDNA clone and the gene encoding a protective antigen of the protozoan parasite Entamoeba histolytica, the serine-rich Entamoeba histolytica protein (SREHP). The derived amino acid sequence of the SREHP cDNA clone was remarkable for a high serine content (52/233 amino acids), a putative signal sequence, multiple hydrophilic dodecapeptide and octapeptide tandem repeats, and a hydrophobic C-terminal putative membrane-spanning region. Here, we show that SREHP is modified by the addition of phosphate at serine residues, O-linked terminal N-acetylglucosamine residues, and by acylation. When the SREHP gene is expressed in baculovirus transformed Sf-9 cells, the product is also phosphorylated and glycosylated and is localized to the plasma membrane of the insect cells. The native SREHP molecule also serves as a potent chemoattractant for amebic trophozoites. The data presented here suggest that SREHP is a unique membrane protein with phosphorylation and glycosylation patterns usually associated with nuclear or cytoplasmic proteins.


INTRODUCTION

The intestinal protozoan parasite Entamoeba histolytica, the cause of amebic dysentery and amebic liver abscess, remains a major cause of morbidity and mortality worldwide. Previously, we described the isolation of a cDNA clone and the gene encoding an antigenic peptide of amebae, the serine-rich E. histolytica protein (SREHP)(^1)(1) . The derived amino acid sequence of SREHP contains a putative signal sequence, multiple tandem repeats, and a probable transmembrane domain, but lacks a putative cytosolic domain(1) . The SREHP molecule is naturally immunogenic(1) , and an Escherichia coli-derived maltose-binding protein-SREHP fusion protein has been used as the target in a serologic test to diagnose invasive amebiasis(2, 3) . More importantly, SREHP is a protective antigen. A recombinant SREHP fusion protein has been used to successfully vaccinate gerbils against amebic liver abscess(4) , and the passive transfer of antibodies directed against SREHP to mice with severe combined immunodeficiency prevents the development of amebic liver abscess(5) .

The native SREHP molecule migrates at 47-kDa on SDS-PAGE, suggesting the SREHP peptide (25 kDa) undergoes post-translational modifications (1) . Herein we report the results of structural analysis of the native SREHP molecule, which indicate that this antigen is phosphorylated, glycosylated, and acylated. We also describe an alternative approach to the study of the post-translational modifications and function of SREHP through the expression of the SREHP gene in baculovirus-infected insect cells.


EXPERIMENTAL PROCEDURES

Cell Culture and Reagents

Axenic E. histolytica strain HM1:IMSS was obtained from the American Type Tissue Culture Collection, (Rockville, MD) and was grown in TYI-S-33 medium as described previously(6) . Sf-9 insect cells were grown at 28 °C in Grace's medium as described previously(7) . D-[6-^3H]Glucosamine HCl (60 Ci/mmol) [9,10-^3H]palmitic acid (60 Ci/mmol), and UDP-[6-^3H]galactose (60 Ci/mmol) were purchased from American Radiolabeled Chemicals, Inc. Orthophosphate (PO(4)) was purchased from DuPont NEN. The murine monoclonal anti-SREHP antibody 2D4 (IgG1,kappa), which reacts with a synthetic peptide containing the dodecapeptide repeat S-S-S-D-K-P-D-N-K-P-E-A(1, 3) , was purified from ascites using a protein A-Sepharose column. 2D4-Sepharose was prepared by coupling 2D4 to cyanogen bromide-activated Sepharose as recommended by the manufacturer.

Metabolic Labeling of Ameba

Metabolic radiolabeling of 48-h cultures containing 4 times 10^6 HM1:IMSS trophozoites using [^3H]glucosamine, carrier-free [P]phosphate, or [9,10-^3H]palmitate was performed exactly as detailed(8) . After labeling, trophozoites were harvested, washed three times in phosphate-buffered saline (PBS), and were lysed in 1% Triton X-100 in 20 mM Tris-Cl, pH 8.0, 0.15 M sodium chloride (TBS) containing 0.2 mML-trans-epoxysuccinyl-leucylamido(4-guanidino)butane, 2 mM phenylmethylsulfonyl fluoride, 1 mM EDTA. The lysate was spun at 10,000 times g at 4 °C for 10 min. For immunoprecipitation, cell lysates were incubated with either rabbit polyclonal anti-SREHP antibodies adsorbed to protein A-Sepharose CL-4B (Pharmacia LKB Biotech) using the manufacturer's protocol or with 2D4 Sepharose(8) .

Purification of SREHP

The native SREHP molecule was isolated from detergent lysates of trophozoites by affinity chromatography over 2D4-Sepharose. The column was washed with lysis buffer, 20 mM Tris-Cl, pH 8.0, 0.5 M NaCl, and with 20 mM Tris-Cl, pH 8.0, 1.0 M NaCl. SREHP was eluted from the column with 3.2 M MgCl(2) and was immediately dialyzed under vacuum against 0.1 M NH(4) acetate. The SREHP was further purified by anion-exchange chromatography over QAE-Sepharose or by preparative SDS-PAGE. Affinity purified SREHP was applied to a 3-ml QAE column which was serially washed with 10 mM Tris-Cl, pH 8.0, containing no additional salt, 0.1 M NaCl, and 0.2 M NaCl. The SREHP was eluted with 10 mM Tris-Cl, pH 8.0, containing 0.4 M NaCl. SREHP was eluted from the excised polyacrylamide gel slice and acetone precipitated to remove residual detergent. The purity of the SREHP fraction was checked by SDS-PAGE and detected either by autoradiography in the case of radiolabeled SREHP and by silver stain (in the case of unlabeled material). Silver staining of SDS-PAGE separated fractions was performed using the Bio-Rad Silver Stain Kit (Bio-Rad) according to the manufacturer's protocol.

Amino Acid Analysis/Phosphate Analysis/Carbohydrate Analysis/Phosphoamino Acid Analysis

Aliquots of gel-purified SREHP were subjected to quantitative amino acid analysis, phosphate analysis, and carbohydrate analysis. The amount of protein was quantified by amino acid analysis after acid hydrolysis as described previously(9) . 54 pmol of SREHP was acid hydrolyzed in 0.5 ml of 4 N HCl for 4 h at 100 °C in an evacuated sealed tube. After hydrolysis the HCl was removed by lyophilization, and the hydrolysate was dissolved in 16 mM NaOH. Total phosphate was quantitated using the ashing procedure described by Ames(10) . Monosaccharide composition was determined, after acid hydrolysis in 4 N HCl at 100 °C for 4 h in an evacuated sealed tube, by high pH anion-exchange chromatography-pulsed amperometric detection on a Dionex CarboPac PA1 column using 2-deoxyglucose as an internal standard. Phosphoamino acid analysis of [P]phosphatelabeled SREHP was performed as described(11) .

Lectin Binding

1 µg of purified SREHP was separated on an SDS-PAGE gel and transferred to nitrocellulose. The nitrocellulose filters were probed using the DIG glycan differentiation kit (Boehringer Mannheim) and digoxigenin-labeled Galanthus nivilus agglutinin (GNA), Concanavalin A agglutinin (ConA), Ricinus communis agglutinin (RCA), and Datura stramonium agglutinin (DSA), according to the manufacturer's protocol.

Galactosylation and beta-Elimination

0.5 µg of purified SREHP was labeled with 5 µCi of UDP-[6-^3H]galactose (60 Ci/ml) using beta-galactosyltransferase provided in the O-GlcNAc detection kit (Oxford GlycoSystems, Rosedale, NY) according to the manufacturer's protocol(12) . Bovine serum albumin (BSA) covalently linked to N-acetylglucosamine through a CETE spacer arm ((beta-D-GlcNAc-O-CETE)-BSA) was used as a positive control. After labeling, the reaction mixture was precipitated with 10 volumes of cold acetone and analyzed by SDS-PAGE or used for beta-elimination analysis. For beta-elimination, the [^3H]galactose-labeled SREHP was treated with 0.3 ml of 0.1 N sodium hydroxide, 1 M sodium borohydride for 18 h at 37 °C as described by Holt and Hart(13) . Samples were analyzed by paper chromatography. The chromatogram was developed using pyridine/ethyl acetate/acetic acid/water (5:5:1:3) for 18 h. Reduced forms of disaccharide standards (lactose and N-acetyllactosamine) were run simultaneously and visualized by silver nitrate staining.

Chemical Hydrolysis of [^3H]Palmitate from SREHP

The purified [^3H]palmitate-labeled SREHP was aliquoted into 70-µl samples (80,000 counts/mim/sample) and lyophilized. For sodium hydroxide cleavage, samples were reconstituted with 180 µl of 100% ethanol, followed by addition of either 20 µl of H(2)O or 20 µl of 0.5 M NaOH, and they were incubated for 1 h at room temperature, acidified, and extracted with toluene(14) . Samples were lyophilized, then reconstituted in sample buffer for SDS-PAGE analysis. For thin layer chromatography, the toluene phase was concentrated under a N(2) stream and spotted on reverse-phase high performance thin layer chromatography plates (RP 18; Merck) with labeled fatty acid standards. The plates were developed in acetonitrile/acetic acid (1:1, v/v) as described previously(15) . The plates were sprayed with EN^3HANCE (DuPont NEN) and exposed to Kodak XAR film (Eastman Kodak, Rochester NY) at -70 °C. For hydroxylamine release, samples were reconstituted with either 60 µl of 1 M NH(2)OHHCl, pH 8.0, or 60 µl of 1 M Tris, pH 8.0, incubated for 1 h at room temperature, then processed for SDS-PAGE autoradiography as above(16) . For nitrous acid deamination, samples were reconstituted in 30 µl of 0.1 M sodium acetate/acetic acid buffer, pH 4.0, and 30 µl of freshly prepared 0.5 M NaNO(2) or in 30 µl of sodium acetate/acetic acid buffer and 30 µl of 0.5 M NaCl(14) . Samples were incubated at room temperature for 3 h, then prepared for SDS-PAGE autoradiography as above.

Expression of SREHP in Baculovirus-infected Sf-9 Cells

The cDNA encoding the full-length SREHP sequence was amplified in order to incorporate convenient restriction sites using the polymerase chain reaction with the forward primer I, GCCATGGTCGCATTTTTATTGTTTATTGCATTCACTAGTGCA (with the recognition sequence for NcoI) the reverse primer II, TGAGCTCCTATTAGAAGATGATAGCTATAAT (with the recognition sequence for SacI), and pF3F1 as the template DNA(1) . The NcoI/SacI cDNA insert was ligated with NcoI/SacI-digested donor plasmid pMON14327 in order to insert the SREHP coding sequences into an expression cassette comprising a baculovirus promoter that is flanked by the left and right ends of Tn7. The resulting donor plasmid was transformed into E. coli DH 10B harboring the target bacmid bMON14272 and the helper plasmid pMON 7124(17) . The recombinant bacmid, bSREHP was isolated, then transfected into Sf-9 cells using a calcium phosphate-mediated transfection protocol(17) . Monolayers of 3 times 10^6Sf-9 cells were infected with recombinant virus at a multiplicity of 10 plaque-forming units/cell and incubated at 28 °C for 72 h(7) . For isolation of SREHP, the infected cells were lysed by sonication, spun at 4000 times g for 10 min, and the pellet resuspended in 4% CHAPS in PBS. After a second spin, the supernatant was collected, diluted to 1% CHAPS, then loaded on a 2D4-Sepharose column or used for immunoprecipitation studies as described above. Metabolic labeling of Sf-9 cells was performed 48 h post infection. [P]Phosphate labeling was performed in phosphate-free Grace's medium containing inorganic [P]phosphate (0.8 mCi/ml) for 5 h at 28 °C(7) . [^3H]Palmitate labeling was performed in 5 ml of complete Grace's media containing 1 mCi of [^3H]palmitate (6 h at 28 °C), and Sf-9 cells were labeled with glucosamine by incubation in glucose-free Grace's media (5 ml) containing 1 mCi of [^3H]glucosamine for 6 h at 28 °C.

Immunofluorescence

Staining was carried out on live trophozoites, fixed and permeabilized trophozoites, and on fixed and permeabilized baculovirus-infected Sf-9 cells expressing SREHP. Immunostaining of live trophozoites was carried out by incubating live trophozoites with a 1:500 dilution of two-dimensional-4 or an isotype matched control antibody HDP-1 in alpha-minimal essential medium with 5.7 mM cysteine, 10 mM HEPES, and 1% BSA (test medium) at 4 °C for 1 h. In some samples the synthetic peptide containing the SREHP dodecapeptide repeat S-S-S-D-K-P-D-N-K-P-E-A was added during incubation with the primary antibody. After washing with test media, fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit IgG (Sigma) was added to the trophozoites (1:300 dilution in test media) at 4 °C for 1 h. Following washes with test media, and PBS, 10^4 trophozoites were resuspended in 50% glycerol in PBS, placed on coverslips, and mounted on microscope slides. For immunostaining of fixed, permeabilized trophozoites, 6 times 10^4 HM1:IMSS trophozoites were incubated on coverslips in 24-well plates at 37 °C for 1 h. After washing with PBS, the adherent trophozoites were fixed in 50% methanol, 50% acetone for 2 min at room temperature, washed with PBS three times, permeabilized in 0.1% Triton X-100 for 20 min, washed two times with PBS, and blocked for with 2% BSA in PBS. Coverslips were incubated with monoclonal antibody 2D4 or an isotype-matched control monoclonal antibody HDP-1 (diluted 1:500 in 0.2% BSA) overnight at 4 °C(18) . After four washes, (FITC)-conjugated goat anti-rabbit IgG secondary antibody (1:300 dilution) was added for 45 min at room temperature in the dark, then coverslips were mounted in 50% glycerol in PBS on microscope slides, and sealed with nail polish. Immunofluorescence staining of formalin-fixed baculovirus-infected Sf-9 cells permeabilized with 0.1% Triton X-100 was carried out using a 1:500 dilution of monoclonal antibody 2D4 or an isotype-matched control monoclonal antibody 1B10 as described previously(7) .

Images were analyzed on a Zeiss Axioplan Microscope fitted with a Bio-Rad MRC Confocal Imaging System under a times 63 objective. Photomultiplier amplification was kept constant in each experiment. Images were normalized over five scans and photographed directly from a NEC Multisync monitor.

Chemotaxis Assay

This assay, which uses 6.5-mm Transwell plates (Costar, Cambridge, MA), measures the migration of E. histolytica trophozoites from an upper chamber to a lower chamber through a 8.0-µm pore polycarbonate membrane and was performed as described by Bailey et al.(19) . In brief, E. histolytica HM1:IMSS trophozoites were suspended in a reference media (RM) of 10 mM potassium phosphate, 140 mM NaCl, 2 mM MgCl(2), 1 mM CaCl(2), 0.57 mM cysteine, pH 6.3, at a concentration of 10^6/ml. The top and lower chambers of the Transwells were separated, and 50 µl of the amebic suspension was added to 100 µl of RM in each of the top wells. To the lower chambers was added 0.5 ml of the sample to be tested, dissolved in RM. The chambers were replaced, incubated for 2 h at 37 °C, then the top chamber was removed, and the number of amebae present in the lower chamber counted using an inverted microscope.


RESULTS

SREHP Is Phosphorylated, Glycosylated, and Acylated

In vivo labeling immunoprecipitation experiments revealed that [^3H]glucosamine, [P]phosphate, and [^3H]palmitate were incorporated into SREHP (see Fig. 1, A-C). SREHP did not incorporate either [^3H]ethanolamine, [^3H]myo-inositol, or [^3H]myristate (data not shown). The native SREHP molecule was isolated from HM1:IMSS trophozoite lysates using affinity chromatography with monoclonal antibody 2D4. This material was further purified by anion-exchange chromatography or by preparative SDS-PAGE. A silver stain of a SDS-PAGE analysis of the purified SREHP molecule is shown in Fig. 2. The phosphate content of purified unlabeled SREHP was estimated to be 17 mol/mol SREHP (as determined by quantitative amino acid analysis). The amount of protein purified was insufficient for accurate stoichiometric determination of carbohydrate content but confirmed the presence of glucosamine (1 mol/mol SREHP). Galactosamine was not detected in the sample.


Figure 1: SREHP incorporates [^3H]glucosamine, [P]phosphate, and [^3H] palmitate. Panel A: lane 1, supernatant from lysates of [^3H]glucosamine-labeled E. histolytica trophozoites; lane 2, immunoprecipitation by preimmune rabbit serum; lane 3, immunoprecipitation by anti-SREHP rabbit serum. A band is visible in lane 3 at 54 kDa, with the location of SREHP presumably displaced upward by the IgG used in immunoprecipitation. Molecular mass standards in kDa are shown at left. Panel B: lane 1, supernatant from lysates of P-labeled E. histolytica trophozoites; lane 2, immunoprecipitation by preimmune rabbit serum; lane 3, immunoprecipitation by anti-SREHP rabbit serum. A species at 54 kDa is seen in lane 3. Panel C: lane 1, supernatant from lysates of [^3H]palmitate-labeled E. histolytica trophozoites; lane 2, pellet; lane 3, immunoprecipitation by preimmune rabbit serum; lane 4, immunoprecipitation by anti-SREHP rabbit serum. A band is seen at 52 kDa in lane 4.




Figure 2: Purification of SREHP. Silver stain of SDS-PAGE separated fraction obtained after QAE-Sepharose purification. Molecular mass standards in kDa are shown on the left.



SREHP Is Phosphorylated on Serine Residues

SREHP was purified from [P]phosphate-labeled E. histolytica trophozoites and analyzed for phosphoamino acids. As shown in Fig. 3, phosphoserine but not phosphotyrosine or phosphothreonine was detected in SREHP.


Figure 3: SREHP contains phosphoserine. P-Labeled SREHP was hydrolyzed in 6 N HCl at 110 °C for 1.5 h, unlabeled internal standards were added, and the phosphoamino acids were separated by electrophoresis as described under ``Experimental Procedures,'' stained with ninhydrin, and analyzed by autoradiography. Phosphoserine (P-ser), but not phosphothreonine (P-thr) or phosphotyrosine (P-tyr) is present. The lower bands seen represent incompletely hydrolyzed peptides.



SREHP Contains O-Linked N-Acetylglucosamine

Inspection of the amino acid sequence of SREHP revealed the absence of any N-linked glycosylation sites but multiple potential O-glycosylation sites. The amount of radiolabeled glucosamine label incorporated into purified SREHP during in vivo labeling was insufficient to directly characterize. Binding of GNA, PNA, ConA, RCA, and DSA to purified SREHP could not be detected under conditions in which GNA binding to the E. histolytica lipophosphoglycan-like molecule (8) was observed (data not shown). In order to investigate the possibility that SREHP contained terminal N-acetylglucosamine residues, purified SREHP was incubated with bovine milk galactosyltransferase and UDP-[^3H]galactose. As shown in Fig. 4, SREHP was labeled with [^3H]galactose. The label was sensitive to mild alkali-induced beta-elimination. The major labeled beta-eliminated product of galactosyltransferase-labeled SREHP co-migrated with the major beta-eliminated product of galactosyltransferase-labeled (beta-D-GlcNAc-O-CETE)-BSA and with Galbeta1-4GlcNAcitol, (Fig. 5) thus demonstrating that single GlcNac residues are O-glycosidically linked to SREHP.


Figure 4: Galactosyltransferase labeling of SREHP. SREHP (lane 1) and a positive control beta-D-GlcNAc-O-CETE)-BSA (lane 2), were labeled with galactosyltransferase and UDP-[^3H]galactose as described under ``Experimental Procedures'' by SDS-polyacrylamide gel electrophoresis. The fluorograph is shown, and the positions of the molecular mass standards in kDa are indicated at left.




Figure 5: The product of beta-elimination of galactosyltransferase-labeled SREHP is Galbeta1-4GlcNAcitol. Descending paper chromatogram of the products of the beta-elimination reaction of SREHP labeled with galactosyltransferase (see ``Experimental Procedures''). Numbered arrows mark the migration of the standards: 1) unidentified peak also present in the beta-elimination reaction of beta-D-GlcNAc-O-CETE)-BSA; 2) Galbeta1-4Glucitol; 3) Galbeta1-4GlcNAcitol. The peak of radiolabel comigrates with Galbeta1-4GlcNAcitol (standard 3).



Acyl Chains Are Attached by O-Ester Bonds

Treatment of acylated proteins with hydroxylamine or with dithiothreitol releases S-ester-bound acyl chains or very labile O-ester-bound acyl chains(15, 16) . Treatment with NaOH in ethanol will also release O-ester-bound chains, whereas amide bonds are resistant to both of these treatments(14) . Treatment with NaOH caused release of incorporated [^3H]palmitate from SREHP (Fig. 6). Analysis of the released product revealed that 50% of the incorporated [^3H]palmitate was released by treatment with NaOH, and the released radioactivity comigrated with palmitate (data not shown). No release of ^3H was observed after treatment with hydroxylamine (Fig. 6), and treatment with 200 mM dithiothreitol (15) failed to release the label from SREHP, although another 95 kDa species that was labeled with [^3H]]palmitate was sensitive to this treatment (data not shown). These results indicate that acyl chains in SREHP are attached by O-ester bonds rather than S-ester bonds. In order to determine whether the acyl chains are incorporated via a glycosylphosphatidylinositol linkage, [^3H]palmitate-labeled SREHP was subjected to treatment with nitrous acid, phosphatidylinositol-specific phospholipase C, and phosphatidylinositol-specific phospholipase D. As shown in Fig. 6, nitrous acid failed to release the lipid. Neither treatment with phosphatidylinositol-specific phospholipase C nor phosphatidylinositol-specific phospholipase D released the radiolabel (data not shown) under conditions in which label was released from [^3H]myristate-labeled trypanosomal variant surface glycoprotein or from E. histolytica lipophosphoglycan (data not shown).


Figure 6: [^3H]palmitate label is released from SREHP by mild base treatment. Fluorograph of SDS-PAGE separated [^3H]palmitate-labeled SREHP treated with NaOH (lane 1), hydroxylamine (lane 3), or nitrous acid (lane 5). Controls for each treatment (see text) are found in lanes 2, 4, and 6. Molecular mass standards in kDa are shown at left.



Immunolocalization of SREHP in E. histolytica Trophozoites

The monoclonal antibody 2D4, which is directed against the repeating dodecapeptide sequence in SREHP, was used to detect SREHP on live and fixed trophozoites (see Fig. 7). Immunostaining of live trophozoites demonstrated surface labeling (see Fig. 7A), which was blocked by the addition of the synthetic peptide corresponding to the dodecapeptide repeat (data not shown). The control monoclonal antibody HDP-1 did not react with intact trophozoites (see Fig. 7B). Immunostaining of fixed, permeabilized trophozoites with 2D4 revealed internal staining with a focal distribution, which may correspond to the tubular network or reticulum of anastomosing endoexocytic channels and vesicles present in these organisms (reviewed in (20) ), in addition to surface labeling (see Fig. 7C). The background level of staining observed with a control antibody HDP-1 is shown in Fig. 7D.


Figure 7: Cellular localization of SREHP in E. histolytica trophozoites. Confocal images of live E. histolytica trophozoites stained with monoclonal antibody 2D4 then FITC-conjugated goat anti-mouse IgG antibody (A); live E. histolytica trophozoites stained with the isotype-matched control monoclonal antibody HDP-1 followed by FITC-conjugated goat anti-mouse IgG antibody (B); fixed and permeabilized E. histolytica trophozoites stained with monoclonal antibody 2D4 then FITC-conjugated goat anti-mouse IgG antibody (C); fixed and permeabilized E. histolytica trophozoites stained with the isotype-matched control monoclonal antibody HDP-1 followed by FITC-conjugated goat anti-mouse IgG antibody (D).



SREHP Expression in Sf-9 Cells

Expression of SREHP in baculovirus infected Sf-9 cells was confirmed by Western blotting which revealed a species at 45 kDa which reacted with monoclonal antibody 2D4 in SREHP-transformed Sf-9 cells, but not in cells expressing a Na,K-ATPase polypeptide (7) (data not shown). SREHP expression and localization to the surface membrane was confirmed by confocal immunofluorescence using monoclonal antibody 2D4 (Fig. 8). 2D4 reacted with the surface membrane of baculovirus-infected Sf-9 cells expressing SREHP (panel A) but showed no reactivity with control baculovirus-infected Sf-9 cells expressing the Na,K-ATPase polypeptide (panel B) (7) . To determine whether SREHP expressed in Sf-9 cells was also phosphorylated, glycosylated, and acylated, we immunoprecipitated the SREHP molecule from lysates of SREHP-expressing Sf-9 cells which had been metabolically labeled with [P]phosphate, [^3H]glucosamine, or [^3H]palmitate. As shown in Fig. 9, SREHP expressed in baculovirus-infected Sf-9 cells is phosphorylated. SREHP expressed in Sf-9 cells also incorporated glucosamine, but we were unable to detect [^3H]palmitate label in baculovirus-expressed SREHP (data not shown).


Figure 8: SREHP is found on the surface membrane of transfected Sf-9 cells. Confocal image of Sf-9 cells stained with the anti-SREHP monoclonal antibody 2D4, followed by rhodamine-conjugated goat anti-mouse antibody. Panel A, baculovirus-infected Sf-9 cells expressing SREHP; panel B, baculovirus-infected Sf-9 cells expressing the Na,K-ATPase polypeptide(7) .




Figure 9: SREHP expressed in transfected Sf-9 cells is phosphorylated. Immunoprecipitation of lysates of P-labeled Sf-9 cells by preimmune rabbit serum (lane A) or anti-SREHP antiserum (lane B). A band at 47/52 kDa consistent with SREHP is seen in lane B (arrow); Western blotting of the immunoprecipitated material with monoclonal antibody 2D4 confirmed SREHP was migrating at 47/52 kDa. Several other lower and higher molecular weight species are present which may represent aggregated or degraded SREHP or other phosphorylated membrane proteins which may have co-immunoprecipitated with SREHP. Molecular mass standards in kDa are shown at left.



SREHP Is a Chemoattractant for Amebae

Bailey et al.(19) described a number of substances that were capable of attracting amebic migration through an 8-µm filter. Potent chemoattractants included TYI-S-33 media and bacteria. An enzymatic digest of casein, a secreted phosphoprotein that contains multiple phosphorylated serine and threonine residues, appears to be the chief component of TYI-S-33 media exhibiting chemoattractant properties(19) . Because the SREHP molecule contains multiple phosphorylated serine residues, we were interested in determining whether the purified native SREHP had chemoattractant properties. We examined the chemoattractant properties of a reference media (negative control), TYI-33 media, a 1% and 0.2% solution of casein, an amebic lysate (8) diluted 1:50, a 0.01% solution of purified native SREHP, a 0.01% solution of purified amebic lipophosphoglycan molecule(8) , and a 1% solution of BSA. Trophozoites migrated to the lower chamber in response to SREHP in numbers greater than the reference media (p < 0.001), amebic lysate (p < 0.04), BSA (p < 0.005), and the amebic lipophosphoglycan (p < 0.002) (Table 1). The concentration of SREHP utilized was equipotent to a 1% casein solution and TYI-33 media in attracting amebae and was significantly more potent than the lower concentration of casein.




DISCUSSION

A number of putative surface molecules of E. histolytica have now been described, but structural information on only a few of these molecules is available ((8, 21, 22), reviewed in (23) ). Previously, we described the isolation and sequence analysis of a cDNA clone and the gene encoding the SREHP(1, 24) . The derived amino acid sequence of the SREHP cDNA clone possessed a high serine content (52 of 233 amino acids) and contained a putative signal sequence, multiple hydrophilic octapeptide and dodecapeptide tandem repeats, and a C-terminal hydrophobic probable membrane spanning domain giving it a secondary structure reminiscent of the circumsporozoite proteins of malaria(1) .

We have previously shown that SREHP was associated with the membrane fraction in amebic lysates(1) . Furthermore, the observation that antibodies to bacterially expressed recombinant SREHP inhibited amebic adhesion to Chinese hamster ovary cells (1) was consistent with a surface location for native SREHP molecule on trophozoites. In order to examine the distribution of SREHP, live intact or permeabilized trophozoites were stained with 2D4, a monoclonal antibody directed against the tandem repeating units, and were examined by confocal microscopy. These studies indicated that these repeating units of SREHP were exposed on the extracellular surface. Examination of permeabilized cells revealed that this epitope was also present in a focal distribution within the organism.

We have found that the native SREHP molecule is phosphorylated and contains terminal O-linked GlcNAc residues. Proteins containing terminal O-linked GlcNAc residues have been described previously in a number of eukaryotes including the parasites Schistosoma mansoni(25) , and P. falciparum(26) . Terminal O-GlcNAc residues have been found in a wide variety of proteins, many of which are also phosphorylated and specifically associate with other proteins to form multimeric complex structures. This modification appears to be restricted largely to the nucleoplasmic and cytoplasmic compartments (reviewed in (27) ). Although initial studies detected O-GlcNAc on the surfaces of lymphocytes (12) , further studies with refined methods of lymphocyte isolation have shown that surface localization is virtually undetectable(27) . It is possible that this modification may take place in other compartments since galactose labeling was detected within the lumen as well as on the cytosolic face of the endoplasmic reticulum(28) . A P. falciparum 195-kDa merozoite surface antigen (MSA-1) which has been localized to the surface membrane of free merozoites (29) has been reported to contain terminal O-linked GlcNac residues(26) .

There are multiple potential sites for phosphorylation and for the addition of terminal O-linked N-acetylglucosamine residues in the dodecapeptide repeats (S-S-S-D-K-P-D-N-K-P-E-A) and the octapeptide repeats (S-S-T-A-K-P-E-A). Little is known about which form of kinase is responsible for phosphorylating the SREHP molecule. Examination of the derived amino acid sequence of SREHP reveals multiple potential sites for phosphorylation of serine residues by either casein kinase I or casein kinase II. Specifically, the dodecapeptide repeats of SREHP contain both the sequence S-X-X-D (S-S-S-D), which is the minimum requirement for substrate recognition by casein kinase II, and E-X-S-S (E-A-S-S), a sequence recognized by casein kinase I(30) . A possible candidate is a rac family protein kinase that was recently identified in E. histolytica (Ehrac1)(31) , which appears to phosphorylate serine and threonine residues, but not tyrosine residues in vitro(32) . The observation that rat liver cytosolic O-GlcNAc:peptide glycosyltransferase appears to require nearby proline residues and is affected by the distance of the hydroxy amino acid from the proline moiety (reviewed in (27) ) is of interest since proline residues are also present in the vicinity of the hydroxyamino acids within the repeating units.

It remains a paradox how the SREHP molecule, which has been localized to the surface membrane, and does not contain a putative cytosolic domain, contains modifications that are generally associated with the cytosolic compartment. One potential explanation is that the modifications are restricted to SREHP molecules which are present in internal structures. Another is that this modification may not be restricted to the cytoplasmic compartment in E. histolytica. Little is known about how E. histolytica processes membrane-bound and secreted proteins. Ultrastructural studies of the trophozoite reveal a poorly developed smooth endoplasmic reticulum and the absence of Golgi (reviewed in (20) ). They appear to be functionally replaced by a tubular network or reticulum of anastomosing endoexocytic channels and vacuoles (reviewed in (20) ). Interestingly, when the SREHP gene is expressed in baculovirus infected Sf-9 cells, the recombinant protein is also detected at the surface membrane and undergoes both phosphorylation and glycosylation (although we have not yet determined whether baculovirus produced SREHP contains phosphoserine or O-GlcNAc).

The native SREHP is also acylated via an O-ester linkage. The lipid does not appear to be linked via a GPI anchor, (a prevalent motif among parasite surface proteins, including at least one E. histolytica protein(21) ) or via an S-ester linkage. O-ester linkages via a threonine residue have been previously reported in bovine brain myelin lipophilin(33) . There are multiple potential sites in the SREHP molecule for direct O-ester acylation. Ser and Ser of SREHP are located within the otherwise hydrophobic putative transmembrane domain of the molecule and would appear to be likely locations for acylation. Of note, we were unable to incorporate [^3H]palmitate into SREHP expressed by baculovirus infected Sf-9 cells. While the function of SREHP remains to be defined, the native SREHP molecule promoted migration of amebae in vitro. Two other phosphoproteins, casein and osteopontin, have been reported to promote migration for amebae (19) and smooth muscle cells(34) , respectively, in vitro. We have observed that amebae tend to aggregate together when placed on a monolayer of target cells and that trophozoite-trophozoite contact appears to be associated with increased motility of amebae and increased destruction of the monolayer(35) . (^2)We can speculate that SREHP might serve as a signal to attract E. histolytica trophozoites to one another; trophozoite-trophozoite contact might be a stimulus for increased motility, and increased production of soluble factors (amebapore, cysteine proteinase) involved in amebic invasion and tissue destruction(23) .


FOOTNOTES

*
This work was supported by Grant AI30084 from the National Institutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
Recipient of National Institutes of Health Research Career Development Award AI01231. To whom correspondence should be addressed. Tel.: 314-362-1080; Fax: 314-362-9230; sstanley{at}visar.wustl.edu.

Recipient of National Institutes of Health Research Career Development Award DK02072.

(^1)
The abbreviations used are: SREHP, serine-rich E. histolytica protein; PBS, phosphate-buffered saline; PAGE, polyacrylamide gel electrophoresis; GNA, Galanthus nivilus agglutinin; ConA, Concanavalin A agglutinin; RCA, Ricinus communis agglutinin; DSA, Datura stramonium agglutinin; BSA, bovine serum albumin; FITC, fluorescene isothiocyanate; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid.

(^2)
E. Li, unpublished observations.


ACKNOWLEDGEMENTS

We thank Drs. Jacques Baenziger and Rosalind Kornfeld for assistance with the carbohydrate analysis and many helpful discussions, Drs. Vernon Luckow and Robert Mercer for assistance with the baculovirus system, Dr. Linda Pike for help in phosphoamino acid analysis, and Lynne Foster for technical assistance. We also thank Dr. Michael Davitz for graciously providing phosphatidylinositolspecific phospholipase D, and Dr. Martin Low for the generous gift of phosphatidylinositol-specific phospholipase C.


REFERENCES

  1. Stanley, S. L., Jr., Becker, A., Kunz-Jenkins, C., Foster, L., and Li, E. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 4976-4980 [Abstract/Free Full Text]
  2. Stanley, S. L., Jr., Jackson, T. F. H. G., Reed, S. L., Calderon, J., Kunz-Jenkins, C., Gathiram, V., and Li, E. (1991) J. Am. Med. Assoc. 266, 1984-1986 [Abstract/Free Full Text]
  3. Myung, K., Burch, D., Jackson, T. F. H. G., and Stanley, S. L., Jr. (1992) Arch. Med. Res. 23, 285-288 [Medline] [Order article via Infotrieve]
  4. Zhang, T., Cieslak, P. R., and Stanley, S. L., Jr. (1994) Infect. Immun. 62, 1166-1170 [Abstract/Free Full Text]
  5. Zhang, T., Cieslak, P. R., Foster, L., Kunz-Jenkins, C., and Stanley, S. L., Jr. (1994) Parasite Immunol. 16, 225-230 [Medline] [Order article via Infotrieve]
  6. Li, E., Becker, A., and Stanley, S. L., Jr. (1988) J. Exp. Med. 167, 1725-1730 [Abstract/Free Full Text]
  7. DeTomaso, A. W., Xie, Z. J., Liu, G., and Mercer, R. W. (1993) J. Biol. Chem. 268, 1470-1478 [Abstract/Free Full Text]
  8. Stanley, S. L., Jr., Huizenga, H., and Li, E. (1992) Mol. Biochem. Parasitol. 50, 127-138 [CrossRef][Medline] [Order article via Infotrieve]
  9. Li, E., Locke, B., Yang, N. C., Ong, D. E., and Gordon, J. I. (1987) J. Biol. Chem. 262, 13773-13779
  10. Ames, B. N. (1966) Methods Enzymol. 8, 115-118
  11. Heisermann, G. J. and Gill, G. N. (1988) J. Biol. Chem. 263, 13152-13158 [Abstract/Free Full Text]
  12. Torres, C.-R., and Hart, G. W. (1984) J. Biol. Chem. 259, 3308-3317 [Abstract/Free Full Text]
  13. Holt, G. D., and Hart, G. W. (1986) J. Biol. Chem. 261, 8049-8057 [Abstract/Free Full Text]
  14. Ferguson, M. A. J. (1988) in Post-translational Modifications of Proteins by Lipids : A Laboratory Manual (Brodbeck, U., and Bordier, C., eds) pp. 1-8, Springer-Verlag, Berlin
  15. Bizzozero, O. A., Fridal, K., and Pastuszyn, A. (1994) J. Neurochem. 62, 1163-1171 [Medline] [Order article via Infotrieve]
  16. Magee, A. I., Koyama, A. H., Malfer, C., Wen, D., and Schlesinger, M. J. (1984) Biochim. Biophys. Acta 798, 156-166 [Medline] [Order article via Infotrieve]
  17. Luckow, V. A., Lee, S. C., Barry, G. F., and Olins, P. O. (1993) J. Virol. 67, 4566-4579 [Abstract/Free Full Text]
  18. Stanley, S. L., Jr., Li, E., and Davie, J. M. (1988) Mol. Immunol. 25, 285-294 [CrossRef][Medline] [Order article via Infotrieve]
  19. Bailey, G. B., Leitch, G. J., and Day, D. B. (1985) J. Protozool. 32, 341-346 [Medline] [Order article via Infotrieve]
  20. Lushbaugh, W. B., and Miller, J. H. (1988) in Amebiasis : Human Infection by Entamoeba Histolytica (Ravdin, J. I., ed) pp. 41-68, John Wiley & Sons, New York
  21. McCoy, J. J., Mann, B. J., Vedvick, T. S., Pak, Y., Heimark, D. B., and Petri, W. A., Jr. (1993) J. Biol. Chem. 268, 24223-24231 [Abstract/Free Full Text]
  22. Petri, W. A., Jr., Chapman, M. D., Snodgrass, T., Mann, B. J., Broman, J., and Ravdin, J. I. (1989) J. Biol. Chem. 264, 3007-3012 [Abstract/Free Full Text]
  23. Stanley, S. L., Jr. and Li, E. (1993) Sem. Gastroint. Dis. 4, 214-223
  24. Li, E., Kunz-Jenkins, C., and Stanley, S. L., Jr. (1992) Mol. Biochem. Parasitol. 50, 355-358 [CrossRef][Medline] [Order article via Infotrieve]
  25. Nyame, K., Cummings, R. D., and Damian, R. T. (1987) J. Biol. Chem. 262, 7990-7995 [Abstract/Free Full Text]
  26. Din, N.-U., Drager-Dayal, R., Decrind, C., Hu, B.-H., Del Giudice, G., and Hoessli, D. (1992) Biochem. Int. 27, 55-64 [Medline] [Order article via Infotrieve]
  27. Haltiwanger, R. S., Kelly, W. G., Roquemore, E. P., Blomberg, M. A., Dong, L.-Y., D., Kreppel, L., Chou, T.-Y., and Hart, G. W. (1992) Biochem. Soc. Trans. 20, 264-269 [Medline] [Order article via Infotrieve]
  28. Abeijon, C., and Hirschberg, C. B. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 1010-1014 [Abstract/Free Full Text]
  29. Holder, A. A. (1988) Progr. Allergy 41, 148-172 [Medline] [Order article via Infotrieve]
  30. Tuazon, T. P., and Traugh, J. A. (1991) Adv. Second Messenger Phosphoprotein Res. 23, 123-164 [Medline] [Order article via Infotrieve]
  31. Que, X., Samuelson, J., and Reed, S. (1993) Mol. Biochem. Parasitol. 60, 161-170 [CrossRef][Medline] [Order article via Infotrieve]
  32. Que, X., and Reed, S. L. (1994) Mol. Biochem. Parasitol. 66, 111-118 [CrossRef][Medline] [Order article via Infotrieve]
  33. Stoffel, W., Hillen, H., Schroder, W., and Deutzman, R. (1983) Hoppes-Seyler's Z. Physiol. Chem. 364, 1455-1466
  34. Liaw, L., Almeida, M., Hart, C. E., Schwartz, S. M., and Giachelli, C. M. (1994) Circ. Res. 74, 214-224 [Abstract/Free Full Text]
  35. Li, E., Becker, A., and Stanley, S. L., Jr. (1989) Infect. Immun. 57, 8-12 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Balan, V. N. Foltyn, M. Zehl, E. Dumin, E. Dikopoltsev, D. Knoh, Y. Ohno, A. Kihara, O. N. Jensen, I. S. Radzishevsky, et al.
Feedback inactivation of D-serine synthesis by NMDA receptor-elicited translocation of serine racemase to the membrane
PNAS, May 5, 2009; 106(18): 7589 - 7594.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. E. Teixeira and C. D. Huston
Participation of the Serine-Rich Entamoeba histolytica Protein in Amebic Phagocytosis of Apoptotic Host Cells
Infect. Immun., March 1, 2008; 76(3): 959 - 966.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. M. Bredeston, C. E. Caffaro, J. Samuelson, and C. B. Hirschberg
Golgi and Endoplasmic Reticulum Functions Take Place in Different Subcellular Compartments of Entamoeba histolytica
J. Biol. Chem., September 16, 2005; 280(37): 32168 - 32176.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
X. Zhang, Z. Zhang, D. Alexander, R. Bracha, D. Mirelman, and S. L. Stanley Jr.
Expression of Amoebapores Is Required for Full Expression of Entamoeba histolytica Virulence in Amebic Liver Abscess but Is Not Necessary for the Induction of Inflammation or Tissue Damage in Amebic Colitis
Infect. Immun., February 1, 2004; 72(2): 678 - 683.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
J. A. HANOVER
Glycan-dependent signaling: O-linked N-acetylglucosamine
FASEB J, September 1, 2001; 15(11): 1865 - 1876.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
W. F. Stenson, Z. Zhang, T. Riehl, and S. L. Stanley Jr.
Amebic Infection in the Human Colon Induces Cyclooxygenase-2
Infect. Immun., May 1, 2001; 69(5): 3382 - 3388.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
A. Guha-Niyogi, D. R. Sullivan, and S. J. Turco
Glycoconjugate structures of parasitic protozoa
Glycobiology, April 1, 2001; 11(4): 45R - 59R.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. M. Cevallos, N. Bhat, R. Verdon, D. H. Hamer, B. Stein, S. Tzipori, M. E. A. Pereira, G. T. Keusch, and H. D. Ward
Mediation of Cryptosporidium parvum Infection In Vitro by Mucin-Like Glycoproteins Defined by a Neutralizing Monoclonal Antibody
Infect. Immun., September 1, 2000; 68(9): 5167 - 5175.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. Frisardi, S. K. Ghosh, J. Field, K. Van Dellen, R. Rogers, P. Robbins, and J. Samuelson
The Most Abundant Glycoprotein of Amebic Cyst Walls (Jacob) Is a Lectin with Five Cys-Rich, Chitin-Binding Domains
Infect. Immun., July 1, 2000; 68(7): 4217 - 4224.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. K. Ghosh, J. Field, M. Frisardi, B. Rosenthal, Z. Mai, R. Rogers, and J. Samuelson
Chitinase Secretion by Encysting Entamoeba invadens and Transfected Entamoeba histolytica Trophozoites: Localization of Secretory Vesicles, Endoplasmic Reticulum, and Golgi Apparatus
Infect. Immun., June 1, 1999; 67(6): 3073 - 3081.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Cao, D. M. Jefferson, and N. Panjwani
Role of Carbohydrate-mediated Adherence in Cytopathogenic Mechanisms of Acanthamoeba
J. Biol. Chem., June 19, 1998; 273(25): 15838 - 15845.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
F. Sultan, L.-l. Jin, M. G. Jobling, R. K. Holmes, and S. L. Stanley Jr.
Mucosal Immunogenicity of a Holotoxin-Like Molecule Containing the Serine-Rich Entamoeba histolytica Protein (SREHP) Fused to the A2 Domain of Cholera Toxin
Infect. Immun., February 1, 1998; 66(2): 462 - 468.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
Z. Mai and J. Samuelson
A New Gene Family (ariel) Encodes Asparagine-Rich Entamoeba histolytica Antigens, Which Resemble the Amebic Vaccine Candidate Serine-Rich E. histolytica Protein
Infect. Immun., January 1, 1998; 66(1): 353 - 355.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. Marinets, T. Zhang, N. Guillen, P. Gounon, B. Bohle, U. Vollmann, O. Scheiner, G. Wiedermann, S. L. Stanley Jr., and M. Duchene
Protection against Invasive Amebiasis by a Single Monoclonal Antibody Directed against a Lipophosphoglycan Antigen Localized on the Surface of Entamoeba histolytica
J. Exp. Med., November 3, 1997; 186(9): 1557 - 1565.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stanley, S. L.
Right arrow Articles by Li, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stanley, S. L., Jr.
Right arrow Articles by Li, E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement