|
Volume 270,
Number 8,
Issue of February 24, 1995 pp. 4121-4126
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
The
Serine-rich Entamoeba histolytica Protein Is a Phosphorylated
Membrane Protein Containing O-Linked Terminal N-Acetylglucosamine Residues (*)
(Received for publication, November
4, 1994; and in revised form, December 15, 1994)
Samuel
L.
Stanley
Jr.
(1), (2), (§),
Kairong
Tian
(1),
Joseph
P.
Koester
(3),
Ellen
Li
(1) (4)(¶)From the
(1)Departments of Medicine,
(2)Molecular Microbiology,
(3)Cell Biology, and
(4)Biochemistry and Molecular Biophysics, Washington
University School of Medicine, St. Louis, Missouri, 63110
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
Previously, we described the isolation of a cDNA clone and the
gene encoding a protective antigen of the protozoan parasite Entamoeba histolytica, the serine-rich Entamoeba
histolytica protein (SREHP). The derived amino acid sequence of
the SREHP cDNA clone was remarkable for a high serine content (52/233
amino acids), a putative signal sequence, multiple hydrophilic
dodecapeptide and octapeptide tandem repeats, and a hydrophobic
C-terminal putative membrane-spanning region. Here, we show that SREHP
is modified by the addition of phosphate at serine residues, O-linked terminal N-acetylglucosamine residues, and
by acylation. When the SREHP gene is expressed in baculovirus
transformed Sf-9 cells, the product is also phosphorylated and
glycosylated and is localized to the plasma membrane of the insect
cells. The native SREHP molecule also serves as a potent
chemoattractant for amebic trophozoites. The data presented here
suggest that SREHP is a unique membrane protein with phosphorylation
and glycosylation patterns usually associated with nuclear or
cytoplasmic proteins.
INTRODUCTION
The intestinal protozoan parasite Entamoeba
histolytica, the cause of amebic dysentery and amebic liver
abscess, remains a major cause of morbidity and mortality worldwide.
Previously, we described the isolation of a cDNA clone and the gene
encoding an antigenic peptide of amebae, the serine-rich E.
histolytica protein (SREHP)( )(1) . The derived
amino acid sequence of SREHP contains a putative signal sequence,
multiple tandem repeats, and a probable transmembrane domain, but lacks
a putative cytosolic domain(1) . The SREHP molecule is
naturally immunogenic(1) , and an Escherichia
coli-derived maltose-binding protein-SREHP fusion protein has been
used as the target in a serologic test to diagnose invasive
amebiasis(2, 3) . More importantly, SREHP is a
protective antigen. A recombinant SREHP fusion protein has been used to
successfully vaccinate gerbils against amebic liver
abscess(4) , and the passive transfer of antibodies directed
against SREHP to mice with severe combined immunodeficiency prevents
the development of amebic liver abscess(5) . The native
SREHP molecule migrates at 47-kDa on SDS-PAGE, suggesting the SREHP
peptide (25 kDa) undergoes post-translational modifications (1) . Herein we report the results of structural analysis of
the native SREHP molecule, which indicate that this antigen is
phosphorylated, glycosylated, and acylated. We also describe an
alternative approach to the study of the post-translational
modifications and function of SREHP through the expression of the SREHP
gene in baculovirus-infected insect cells.
EXPERIMENTAL PROCEDURES
Cell Culture and ReagentsAxenic E.
histolytica strain HM1:IMSS was obtained from the American Type
Tissue Culture Collection, (Rockville, MD) and was grown in TYI-S-33
medium as described previously(6) . Sf-9 insect cells
were grown at 28 °C in Grace's medium as described
previously(7) . D-[6- H]Glucosamine HCl (60 Ci/mmol)
[9,10- H]palmitic acid (60 Ci/mmol), and
UDP-[6- H]galactose (60 Ci/mmol) were purchased
from American Radiolabeled Chemicals, Inc. Orthophosphate ( PO ) was purchased from DuPont NEN. The murine
monoclonal anti-SREHP antibody 2D4 (IgG1, ), which reacts with a
synthetic peptide containing the dodecapeptide repeat
S-S-S-D-K-P-D-N-K-P-E-A(1, 3) , was purified from
ascites using a protein A-Sepharose column. 2D4-Sepharose was prepared
by coupling 2D4 to cyanogen bromide-activated Sepharose as recommended
by the manufacturer.
Metabolic Labeling of AmebaMetabolic
radiolabeling of 48-h cultures containing 4 10 HM1:IMSS trophozoites using [ H]glucosamine,
carrier-free [ P]phosphate, or
[9,10- H]palmitate was performed exactly as
detailed(8) . After labeling, trophozoites were harvested,
washed three times in phosphate-buffered saline (PBS), and were lysed
in 1% Triton X-100 in 20 mM Tris-Cl, pH 8.0, 0.15 M sodium chloride (TBS) containing 0.2 mML-trans-epoxysuccinyl-leucylamido(4-guanidino)butane,
2 mM phenylmethylsulfonyl fluoride, 1 mM EDTA. The
lysate was spun at 10,000 g at 4 °C for 10 min.
For immunoprecipitation, cell lysates were incubated with either rabbit
polyclonal anti-SREHP antibodies adsorbed to protein A-Sepharose CL-4B
(Pharmacia LKB Biotech) using the manufacturer's protocol or with
2D4 Sepharose(8) .
Purification of SREHPThe native SREHP molecule
was isolated from detergent lysates of trophozoites by affinity
chromatography over 2D4-Sepharose. The column was washed with lysis
buffer, 20 mM Tris-Cl, pH 8.0, 0.5 M NaCl, and with
20 mM Tris-Cl, pH 8.0, 1.0 M NaCl. SREHP was eluted
from the column with 3.2 M MgCl and was
immediately dialyzed under vacuum against 0.1 M NH acetate. The SREHP was further purified by anion-exchange
chromatography over QAE-Sepharose or by preparative SDS-PAGE. Affinity
purified SREHP was applied to a 3-ml QAE column which was serially
washed with 10 mM Tris-Cl, pH 8.0, containing no additional
salt, 0.1 M NaCl, and 0.2 M NaCl. The SREHP was
eluted with 10 mM Tris-Cl, pH 8.0, containing 0.4 M NaCl. SREHP was eluted from the excised polyacrylamide gel slice
and acetone precipitated to remove residual detergent. The purity of
the SREHP fraction was checked by SDS-PAGE and detected either by
autoradiography in the case of radiolabeled SREHP and by silver stain
(in the case of unlabeled material). Silver staining of SDS-PAGE
separated fractions was performed using the Bio-Rad Silver Stain Kit
(Bio-Rad) according to the manufacturer's protocol.
Amino Acid Analysis/Phosphate Analysis/Carbohydrate
Analysis/Phosphoamino Acid AnalysisAliquots of gel-purified
SREHP were subjected to quantitative amino acid analysis, phosphate
analysis, and carbohydrate analysis. The amount of protein was
quantified by amino acid analysis after acid hydrolysis as described
previously(9) . 54 pmol of SREHP was acid hydrolyzed in 0.5 ml
of 4 N HCl for 4 h at 100 °C in an evacuated sealed tube.
After hydrolysis the HCl was removed by lyophilization, and the
hydrolysate was dissolved in 16 mM NaOH. Total phosphate was
quantitated using the ashing procedure described by Ames(10) .
Monosaccharide composition was determined, after acid hydrolysis in 4 N HCl at 100 °C for 4 h in an evacuated sealed tube, by
high pH anion-exchange chromatography-pulsed amperometric detection on
a Dionex CarboPac PA1 column using 2-deoxyglucose as an internal
standard. Phosphoamino acid analysis of
[ P]phosphatelabeled SREHP was performed as
described(11) .
Lectin Binding1 µg of purified SREHP was
separated on an SDS-PAGE gel and transferred to nitrocellulose. The
nitrocellulose filters were probed using the DIG glycan differentiation
kit (Boehringer Mannheim) and digoxigenin-labeled Galanthus nivilus agglutinin (GNA), Concanavalin A agglutinin (ConA), Ricinus communis agglutinin (RCA), and Datura stramonium agglutinin (DSA), according to the manufacturer's protocol.
Galactosylation and -Elimination0.5 µg
of purified SREHP was labeled with 5 µCi of
UDP-[6- H]galactose (60 Ci/ml) using
-galactosyltransferase provided in the O-GlcNAc detection
kit (Oxford GlycoSystems, Rosedale, NY) according to the
manufacturer's protocol(12) . Bovine serum albumin (BSA)
covalently linked to N-acetylglucosamine through a CETE spacer
arm (( -D-GlcNAc-O-CETE) -BSA) was used as
a positive control. After labeling, the reaction mixture was
precipitated with 10 volumes of cold acetone and analyzed by SDS-PAGE
or used for -elimination analysis. For -elimination, the
[ H]galactose-labeled SREHP was treated with 0.3
ml of 0.1 N sodium hydroxide, 1 M sodium borohydride
for 18 h at 37 °C as described by Holt and Hart(13) .
Samples were analyzed by paper chromatography. The chromatogram was
developed using pyridine/ethyl acetate/acetic acid/water (5:5:1:3) for
18 h. Reduced forms of disaccharide standards (lactose and N-acetyllactosamine) were run simultaneously and visualized by
silver nitrate staining.
Chemical Hydrolysis of [ H]Palmitate
from SREHPThe purified
[ H]palmitate-labeled SREHP was aliquoted into
70-µl samples (80,000 counts/mim/sample) and lyophilized. For
sodium hydroxide cleavage, samples were reconstituted with 180 µl
of 100% ethanol, followed by addition of either 20 µl of
H O or 20 µl of 0.5 M NaOH, and they were
incubated for 1 h at room temperature, acidified, and extracted with
toluene(14) . Samples were lyophilized, then reconstituted in
sample buffer for SDS-PAGE analysis. For thin layer chromatography, the
toluene phase was concentrated under a N stream and spotted
on reverse-phase high performance thin layer chromatography plates (RP
18; Merck) with labeled fatty acid standards. The plates were developed
in acetonitrile/acetic acid (1:1, v/v) as described
previously(15) . The plates were sprayed with
EN HANCE (DuPont NEN) and exposed to Kodak XAR film (Eastman
Kodak, Rochester NY) at -70 °C. For hydroxylamine release,
samples were reconstituted with either 60 µl of 1 M NH OHHCl, pH 8.0, or 60 µl of 1 M Tris, pH
8.0, incubated for 1 h at room temperature, then processed for SDS-PAGE
autoradiography as above(16) . For nitrous acid deamination,
samples were reconstituted in 30 µl of 0.1 M sodium
acetate/acetic acid buffer, pH 4.0, and 30 µl of freshly prepared
0.5 M NaNO or in 30 µl of sodium
acetate/acetic acid buffer and 30 µl of 0.5 M NaCl(14) . Samples were incubated at room temperature for
3 h, then prepared for SDS-PAGE autoradiography as above.
Expression of SREHP in Baculovirus-infected Sf-9
CellsThe cDNA encoding the full-length SREHP sequence was
amplified in order to incorporate convenient restriction sites using
the polymerase chain reaction with the forward primer I,
GCCATGGTCGCATTTTTATTGTTTATTGCATTCACTAGTGCA (with the recognition
sequence for NcoI) the reverse primer II,
TGAGCTCCTATTAGAAGATGATAGCTATAAT (with the recognition sequence for SacI), and pF3F1 as the template DNA(1) . The NcoI/SacI cDNA insert was ligated with NcoI/SacI-digested donor plasmid pMON14327 in order
to insert the SREHP coding sequences into an expression cassette
comprising a baculovirus promoter that is flanked by the left and right
ends of Tn7. The resulting donor plasmid was transformed into E.
coli DH 10B harboring the target bacmid bMON14272 and the helper
plasmid pMON 7124(17) . The recombinant bacmid, bSREHP was
isolated, then transfected into Sf-9 cells using a calcium
phosphate-mediated transfection protocol(17) . Monolayers of 3
10 Sf-9 cells were infected with
recombinant virus at a multiplicity of 10 plaque-forming units/cell and
incubated at 28 °C for 72 h(7) . For isolation of SREHP,
the infected cells were lysed by sonication, spun at 4000 g for 10 min, and the pellet resuspended in 4% CHAPS in PBS. After a
second spin, the supernatant was collected, diluted to 1% CHAPS, then
loaded on a 2D4-Sepharose column or used for immunoprecipitation
studies as described above. Metabolic labeling of Sf-9 cells
was performed 48 h post infection. [ P]Phosphate
labeling was performed in phosphate-free Grace's medium
containing inorganic [ P]phosphate (0.8 mCi/ml)
for 5 h at 28 °C(7) . [ H]Palmitate
labeling was performed in 5 ml of complete Grace's media
containing 1 mCi of [ H]palmitate (6 h at 28
°C), and Sf-9 cells were labeled with glucosamine by
incubation in glucose-free Grace's media (5 ml) containing 1 mCi
of [ H]glucosamine for 6 h at 28 °C.
ImmunofluorescenceStaining was carried out on
live trophozoites, fixed and permeabilized trophozoites, and on fixed
and permeabilized baculovirus-infected Sf-9 cells expressing
SREHP. Immunostaining of live trophozoites was carried out by
incubating live trophozoites with a 1:500 dilution of two-dimensional-4
or an isotype matched control antibody HDP-1 in -minimal essential
medium with 5.7 mM cysteine, 10 mM HEPES, and 1% BSA
(test medium) at 4 °C for 1 h. In some samples the synthetic
peptide containing the SREHP dodecapeptide repeat
S-S-S-D-K-P-D-N-K-P-E-A was added during incubation with the primary
antibody. After washing with test media, fluorescein isothiocyanate
(FITC)-conjugated goat anti-rabbit IgG (Sigma) was added to the
trophozoites (1:300 dilution in test media) at 4 °C for 1 h.
Following washes with test media, and PBS, 10 trophozoites
were resuspended in 50% glycerol in PBS, placed on coverslips, and
mounted on microscope slides. For immunostaining of fixed,
permeabilized trophozoites, 6 10 HM1:IMSS
trophozoites were incubated on coverslips in 24-well plates at 37
°C for 1 h. After washing with PBS, the adherent trophozoites were
fixed in 50% methanol, 50% acetone for 2 min at room temperature,
washed with PBS three times, permeabilized in 0.1% Triton X-100 for 20
min, washed two times with PBS, and blocked for with 2% BSA in PBS.
Coverslips were incubated with monoclonal antibody 2D4 or an
isotype-matched control monoclonal antibody HDP-1 (diluted 1:500 in
0.2% BSA) overnight at 4 °C(18) . After four washes,
(FITC)-conjugated goat anti-rabbit IgG secondary antibody (1:300
dilution) was added for 45 min at room temperature in the dark, then
coverslips were mounted in 50% glycerol in PBS on microscope slides,
and sealed with nail polish. Immunofluorescence staining of
formalin-fixed baculovirus-infected Sf-9 cells permeabilized
with 0.1% Triton X-100 was carried out using a 1:500 dilution of
monoclonal antibody 2D4 or an isotype-matched control monoclonal
antibody 1B10 as described previously(7) .Images were
analyzed on a Zeiss Axioplan Microscope fitted with a Bio-Rad MRC
Confocal Imaging System under a 63 objective. Photomultiplier
amplification was kept constant in each experiment. Images were
normalized over five scans and photographed directly from a NEC
Multisync monitor.
Chemotaxis AssayThis assay, which uses 6.5-mm
Transwell plates (Costar, Cambridge, MA), measures the migration of E. histolytica trophozoites from an upper chamber to a lower
chamber through a 8.0-µm pore polycarbonate membrane and was
performed as described by Bailey et al.(19) . In
brief, E. histolytica HM1:IMSS trophozoites were suspended in
a reference media (RM) of 10 mM potassium phosphate, 140
mM NaCl, 2 mM MgCl , 1 mM CaCl , 0.57 mM cysteine, pH 6.3, at a
concentration of 10 /ml. The top and lower chambers of the
Transwells were separated, and 50 µl of the amebic suspension was
added to 100 µl of RM in each of the top wells. To the lower
chambers was added 0.5 ml of the sample to be tested, dissolved in RM.
The chambers were replaced, incubated for 2 h at 37 °C, then the
top chamber was removed, and the number of amebae present in the lower
chamber counted using an inverted microscope.
RESULTS
SREHP Is Phosphorylated, Glycosylated, and
AcylatedIn vivo labeling immunoprecipitation
experiments revealed that [ H]glucosamine,
[ P]phosphate, and
[ H]palmitate were incorporated into SREHP (see Fig. 1, A-C). SREHP did not incorporate either
[ H]ethanolamine,
[ H]myo-inositol, or
[ H]myristate (data not shown). The native SREHP
molecule was isolated from HM1:IMSS trophozoite lysates using affinity
chromatography with monoclonal antibody 2D4. This material was further
purified by anion-exchange chromatography or by preparative SDS-PAGE. A
silver stain of a SDS-PAGE analysis of the purified SREHP molecule is
shown in Fig. 2. The phosphate content of purified unlabeled
SREHP was estimated to be 17 mol/mol SREHP (as determined by
quantitative amino acid analysis). The amount of protein purified was
insufficient for accurate stoichiometric determination of carbohydrate
content but confirmed the presence of glucosamine ( 1 mol/mol
SREHP). Galactosamine was not detected in the sample.
Figure 1:
SREHP incorporates
[ H]glucosamine,
[ P]phosphate, and [ H]
palmitate. Panel A: lane 1, supernatant from lysates
of [ H]glucosamine-labeled E. histolytica trophozoites; lane 2, immunoprecipitation by preimmune
rabbit serum; lane 3, immunoprecipitation by anti-SREHP rabbit
serum. A band is visible in lane 3 at 54 kDa, with the
location of SREHP presumably displaced upward by the IgG used in
immunoprecipitation. Molecular mass standards in kDa are shown at left. Panel B: lane 1, supernatant from
lysates of P-labeled E. histolytica trophozoites; lane 2, immunoprecipitation by preimmune rabbit serum; lane 3, immunoprecipitation by anti-SREHP rabbit
serum. A species at 54 kDa is seen in lane 3. Panel
C: lane 1, supernatant from lysates of
[ H]palmitate-labeled E. histolytica trophozoites; lane 2, pellet; lane 3,
immunoprecipitation by preimmune rabbit serum; lane 4,
immunoprecipitation by anti-SREHP rabbit serum. A band is seen at 52
kDa in lane 4.
Figure 2:
Purification of SREHP. Silver stain of
SDS-PAGE separated fraction obtained after QAE-Sepharose purification.
Molecular mass standards in kDa are shown on the left.
SREHP Is Phosphorylated on Serine ResiduesSREHP
was purified from [ P]phosphate-labeled E.
histolytica trophozoites and analyzed for phosphoamino acids. As
shown in Fig. 3, phosphoserine but not phosphotyrosine or
phosphothreonine was detected in SREHP.
Figure 3:
SREHP contains phosphoserine. P-Labeled SREHP was hydrolyzed in 6 N HCl at 110
°C for 1.5 h, unlabeled internal standards were added, and the
phosphoamino acids were separated by electrophoresis as described under
``Experimental Procedures,'' stained with ninhydrin, and
analyzed by autoradiography. Phosphoserine (P-ser), but not
phosphothreonine (P-thr) or phosphotyrosine (P-tyr)
is present. The lower bands seen represent incompletely
hydrolyzed peptides.
SREHP Contains O-Linked
N-AcetylglucosamineInspection of the amino acid sequence of
SREHP revealed the absence of any N-linked glycosylation sites
but multiple potential O-glycosylation sites. The amount of
radiolabeled glucosamine label incorporated into purified SREHP during in vivo labeling was insufficient to directly characterize.
Binding of GNA, PNA, ConA, RCA, and DSA to purified SREHP could not be
detected under conditions in which GNA binding to the E.
histolytica lipophosphoglycan-like molecule (8) was
observed (data not shown). In order to investigate the possibility that
SREHP contained terminal N-acetylglucosamine residues,
purified SREHP was incubated with bovine milk galactosyltransferase and
UDP-[ H]galactose. As shown in Fig. 4,
SREHP was labeled with [ H]galactose. The label
was sensitive to mild alkali-induced -elimination. The major
labeled -eliminated product of galactosyltransferase-labeled SREHP
co-migrated with the major -eliminated product of
galactosyltransferase-labeled
( -D-GlcNAc-O-CETE) -BSA and with
Gal 1-4GlcNAcitol, (Fig. 5) thus demonstrating that
single GlcNac residues are O-glycosidically linked to SREHP.
Figure 4:
Galactosyltransferase labeling of SREHP.
SREHP (lane 1) and a positive control
-D-GlcNAc-O-CETE) -BSA (lane
2), were labeled with galactosyltransferase and
UDP-[ H]galactose as described under
``Experimental Procedures'' by SDS-polyacrylamide gel
electrophoresis. The fluorograph is shown, and the positions of the
molecular mass standards in kDa are indicated at left.
Figure 5:
The product of -elimination of
galactosyltransferase-labeled SREHP is Gal 1-4GlcNAcitol.
Descending paper chromatogram of the products of the -elimination
reaction of SREHP labeled with galactosyltransferase (see
``Experimental Procedures''). Numbered arrows mark
the migration of the standards: 1) unidentified peak also
present in the -elimination reaction of
-D-GlcNAc-O-CETE) -BSA; 2) Gal 1-4Glucitol; 3)
Gal 1-4GlcNAcitol. The peak of radiolabel comigrates with
Gal 1-4GlcNAcitol (standard
3).
Acyl Chains Are Attached by O-Ester
BondsTreatment of acylated proteins with hydroxylamine or with
dithiothreitol releases S-ester-bound acyl chains or very
labile O-ester-bound acyl chains(15, 16) .
Treatment with NaOH in ethanol will also release O-ester-bound
chains, whereas amide bonds are resistant to both of these
treatments(14) . Treatment with NaOH caused release of
incorporated [ H]palmitate from SREHP (Fig. 6). Analysis of the released product revealed that 50% of
the incorporated [ H]palmitate was released by
treatment with NaOH, and the released radioactivity comigrated with
palmitate (data not shown). No release of H was observed
after treatment with hydroxylamine (Fig. 6), and treatment with
200 mM dithiothreitol (15) failed to release the label
from SREHP, although another 95 kDa species that was labeled with
[ H]]palmitate was sensitive to this
treatment (data not shown). These results indicate that acyl chains in
SREHP are attached by O-ester bonds rather than S-ester bonds. In order to determine whether the acyl chains
are incorporated via a glycosylphosphatidylinositol linkage,
[ H]palmitate-labeled SREHP was subjected to
treatment with nitrous acid, phosphatidylinositol-specific
phospholipase C, and phosphatidylinositol-specific phospholipase D. As
shown in Fig. 6, nitrous acid failed to release the lipid.
Neither treatment with phosphatidylinositol-specific phospholipase C
nor phosphatidylinositol-specific phospholipase D released the
radiolabel (data not shown) under conditions in which label was
released from [ H]myristate-labeled trypanosomal
variant surface glycoprotein or from E. histolytica lipophosphoglycan (data not shown).
Figure 6:
[ H]palmitate label
is released from SREHP by mild base treatment. Fluorograph of SDS-PAGE
separated [ H]palmitate-labeled SREHP treated with
NaOH (lane 1), hydroxylamine (lane 3), or nitrous
acid (lane 5). Controls for each treatment (see text) are
found in lanes 2, 4, and 6. Molecular mass
standards in kDa are shown at left.
Immunolocalization of SREHP in E. histolytica
TrophozoitesThe monoclonal antibody 2D4, which is directed
against the repeating dodecapeptide sequence in SREHP, was used to
detect SREHP on live and fixed trophozoites (see Fig. 7).
Immunostaining of live trophozoites demonstrated surface labeling (see Fig. 7A), which was blocked by the addition of the
synthetic peptide corresponding to the dodecapeptide repeat (data not
shown). The control monoclonal antibody HDP-1 did not react with intact
trophozoites (see Fig. 7B). Immunostaining of fixed,
permeabilized trophozoites with 2D4 revealed internal staining with a
focal distribution, which may correspond to the tubular network or
reticulum of anastomosing endoexocytic channels and vesicles present in
these organisms (reviewed in (20) ), in addition to surface
labeling (see Fig. 7C). The background level of
staining observed with a control antibody HDP-1 is shown in Fig. 7D.
Figure 7:
Cellular localization of SREHP in E.
histolytica trophozoites. Confocal images of live E.
histolytica trophozoites stained with monoclonal antibody 2D4 then
FITC-conjugated goat anti-mouse IgG antibody (A); live E.
histolytica trophozoites stained with the isotype-matched control
monoclonal antibody HDP-1 followed by FITC-conjugated goat anti-mouse
IgG antibody (B); fixed and permeabilized E. histolytica trophozoites stained with monoclonal antibody 2D4 then
FITC-conjugated goat anti-mouse IgG antibody (C); fixed and
permeabilized E. histolytica trophozoites stained with the
isotype-matched control monoclonal antibody HDP-1 followed by
FITC-conjugated goat anti-mouse IgG antibody (D).
SREHP Expression in Sf-9 CellsExpression of SREHP
in baculovirus infected Sf-9 cells was confirmed by Western
blotting which revealed a species at 45 kDa which reacted with
monoclonal antibody 2D4 in SREHP-transformed Sf-9 cells, but
not in cells expressing a Na ,K -ATPase
polypeptide (7) (data not shown). SREHP expression and
localization to the surface membrane was confirmed by confocal
immunofluorescence using monoclonal antibody 2D4 (Fig. 8). 2D4
reacted with the surface membrane of baculovirus-infected Sf-9
cells expressing SREHP (panel A) but showed no reactivity with
control baculovirus-infected Sf-9 cells expressing the
Na ,K -ATPase polypeptide (panel
B) (7) . To determine whether SREHP expressed in Sf-9 cells was also phosphorylated, glycosylated, and
acylated, we immunoprecipitated the SREHP molecule from lysates of
SREHP-expressing Sf-9 cells which had been metabolically
labeled with [ P]phosphate,
[ H]glucosamine, or
[ H]palmitate. As shown in Fig. 9, SREHP
expressed in baculovirus-infected Sf-9 cells is
phosphorylated. SREHP expressed in Sf-9 cells also
incorporated glucosamine, but we were unable to detect
[ H]palmitate label in baculovirus-expressed SREHP
(data not shown).
Figure 8:
SREHP is found on the surface membrane of
transfected Sf-9 cells. Confocal image of Sf-9 cells
stained with the anti-SREHP monoclonal antibody 2D4, followed by
rhodamine-conjugated goat anti-mouse antibody. Panel A,
baculovirus-infected Sf-9 cells expressing SREHP; panel
B, baculovirus-infected Sf-9 cells expressing the
Na,K-ATPase polypeptide(7) .
Figure 9:
SREHP expressed in transfected Sf-9 cells is phosphorylated. Immunoprecipitation of lysates
of P-labeled Sf-9 cells by preimmune rabbit serum (lane A) or anti-SREHP antiserum (lane B). A band at
47/52 kDa consistent with SREHP is seen in lane B (arrow); Western blotting of the immunoprecipitated
material with monoclonal antibody 2D4 confirmed SREHP was migrating at
47/52 kDa. Several other lower and higher molecular weight species are
present which may represent aggregated or degraded SREHP or other
phosphorylated membrane proteins which may have co-immunoprecipitated
with SREHP. Molecular mass standards in kDa are shown at left.
SREHP Is a Chemoattractant for AmebaeBailey et al.(19) described a number of substances that were
capable of attracting amebic migration through an 8-µm filter.
Potent chemoattractants included TYI-S-33 media and bacteria. An
enzymatic digest of casein, a secreted phosphoprotein that contains
multiple phosphorylated serine and threonine residues, appears to be
the chief component of TYI-S-33 media exhibiting chemoattractant
properties(19) . Because the SREHP molecule contains multiple
phosphorylated serine residues, we were interested in determining
whether the purified native SREHP had chemoattractant properties. We
examined the chemoattractant properties of a reference media (negative
control), TYI-33 media, a 1% and 0.2% solution of casein, an amebic
lysate (8) diluted 1:50, a 0.01% solution of purified native
SREHP, a 0.01% solution of purified amebic lipophosphoglycan
molecule(8) , and a 1% solution of BSA. Trophozoites migrated
to the lower chamber in response to SREHP in numbers greater than the
reference media (p < 0.001), amebic lysate (p <
0.04), BSA (p < 0.005), and the amebic lipophosphoglycan (p < 0.002) (Table 1). The concentration of SREHP
utilized was equipotent to a 1% casein solution and TYI-33 media in
attracting amebae and was significantly more potent than the lower
concentration of casein.
DISCUSSION
A number of putative surface molecules of E. histolytica have now been described, but structural information on only a few
of these molecules is available ((8, 21, 22), reviewed in (23) ). Previously, we described the isolation and sequence
analysis of a cDNA clone and the gene encoding the
SREHP(1, 24) . The derived amino acid sequence of the
SREHP cDNA clone possessed a high serine content (52 of 233 amino
acids) and contained a putative signal sequence, multiple hydrophilic
octapeptide and dodecapeptide tandem repeats, and a C-terminal
hydrophobic probable membrane spanning domain giving it a secondary
structure reminiscent of the circumsporozoite proteins of
malaria(1) . We have previously shown that SREHP was
associated with the membrane fraction in amebic lysates(1) .
Furthermore, the observation that antibodies to bacterially expressed
recombinant SREHP inhibited amebic adhesion to Chinese hamster ovary
cells (1) was consistent with a surface location for native
SREHP molecule on trophozoites. In order to examine the distribution of
SREHP, live intact or permeabilized trophozoites were stained with 2D4,
a monoclonal antibody directed against the tandem repeating units, and
were examined by confocal microscopy. These studies indicated that
these repeating units of SREHP were exposed on the extracellular
surface. Examination of permeabilized cells revealed that this epitope
was also present in a focal distribution within the organism. We
have found that the native SREHP molecule is phosphorylated and
contains terminal O-linked GlcNAc residues. Proteins
containing terminal O-linked GlcNAc residues have been
described previously in a number of eukaryotes including the parasites Schistosoma mansoni(25) , and P.
falciparum(26) . Terminal O-GlcNAc residues have
been found in a wide variety of proteins, many of which are also
phosphorylated and specifically associate with other proteins to form
multimeric complex structures. This modification appears to be
restricted largely to the nucleoplasmic and cytoplasmic compartments
(reviewed in (27) ). Although initial studies detected O-GlcNAc on the surfaces of lymphocytes (12) , further
studies with refined methods of lymphocyte isolation have shown that
surface localization is virtually undetectable(27) . It is
possible that this modification may take place in other compartments
since galactose labeling was detected within the lumen as well as on
the cytosolic face of the endoplasmic reticulum(28) . A P.
falciparum 195-kDa merozoite surface antigen (MSA-1) which has
been localized to the surface membrane of free merozoites (29) has been reported to contain terminal O-linked
GlcNac residues(26) . There are multiple potential sites for
phosphorylation and for the addition of terminal O-linked N-acetylglucosamine residues in the dodecapeptide repeats
(S-S-S-D-K-P-D-N-K-P-E-A) and the octapeptide repeats
(S-S-T-A-K-P-E-A). Little is known about which form of kinase is
responsible for phosphorylating the SREHP molecule. Examination of the
derived amino acid sequence of SREHP reveals multiple potential sites
for phosphorylation of serine residues by either casein kinase I or
casein kinase II. Specifically, the dodecapeptide repeats of SREHP
contain both the sequence S-X-X-D (S-S-S-D), which is the
minimum requirement for substrate recognition by casein kinase II, and
E-X-S-S (E-A-S-S), a sequence recognized by casein kinase
I(30) . A possible candidate is a rac family protein
kinase that was recently identified in E. histolytica
(Ehrac1)(31) , which appears to phosphorylate serine and
threonine residues, but not tyrosine residues in
vitro(32) . The observation that rat liver cytosolic O-GlcNAc:peptide glycosyltransferase appears to require nearby
proline residues and is affected by the distance of the hydroxy amino
acid from the proline moiety (reviewed in (27) ) is of interest
since proline residues are also present in the vicinity of the
hydroxyamino acids within the repeating units. It remains a paradox
how the SREHP molecule, which has been localized to the surface
membrane, and does not contain a putative cytosolic domain, contains
modifications that are generally associated with the cytosolic
compartment. One potential explanation is that the modifications are
restricted to SREHP molecules which are present in internal structures.
Another is that this modification may not be restricted to the
cytoplasmic compartment in E. histolytica. Little is known
about how E. histolytica processes membrane-bound and secreted
proteins. Ultrastructural studies of the trophozoite reveal a poorly
developed smooth endoplasmic reticulum and the absence of Golgi
(reviewed in (20) ). They appear to be functionally replaced by
a tubular network or reticulum of anastomosing endoexocytic channels
and vacuoles (reviewed in (20) ). Interestingly, when the SREHP
gene is expressed in baculovirus infected Sf-9 cells, the
recombinant protein is also detected at the surface membrane and
undergoes both phosphorylation and glycosylation (although we have not
yet determined whether baculovirus produced SREHP contains
phosphoserine or O-GlcNAc). The native SREHP is also
acylated via an O-ester linkage. The lipid does not appear to
be linked via a GPI anchor, (a prevalent motif among parasite surface
proteins, including at least one E. histolytica protein(21) ) or via an S-ester linkage. O-ester linkages via a threonine residue have been previously
reported in bovine brain myelin lipophilin(33) . There are
multiple potential sites in the SREHP molecule for direct O-ester acylation. Ser and Ser of
SREHP are located within the otherwise hydrophobic putative
transmembrane domain of the molecule and would appear to be likely
locations for acylation. Of note, we were unable to incorporate
[ H]palmitate into SREHP expressed by baculovirus
infected Sf-9 cells. While the function of SREHP remains to be
defined, the native SREHP molecule promoted migration of amebae in
vitro. Two other phosphoproteins, casein and osteopontin, have
been reported to promote migration for amebae (19) and smooth
muscle cells(34) , respectively, in vitro. We have
observed that amebae tend to aggregate together when placed on a
monolayer of target cells and that trophozoite-trophozoite contact
appears to be associated with increased motility of amebae and
increased destruction of the monolayer(35) . ( )We
can speculate that SREHP might serve as a signal to attract E.
histolytica trophozoites to one another; trophozoite-trophozoite
contact might be a stimulus for increased motility, and increased
production of soluble factors (amebapore, cysteine proteinase) involved
in amebic invasion and tissue destruction(23) .
FOOTNOTES
- *
- This work was supported by Grant AI30084 from the
National Institutes of Health. The costs of publication of this article
were defrayed in part by the payment of page charges. This article must
therefore by hereby marked ``advertisement'' in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
- §
- Recipient of National Institutes of Health
Research Career Development Award AI01231. To whom correspondence
should be addressed. Tel.: 314-362-1080; Fax: 314-362-9230; sstanley{at}visar.wustl.edu.
- ¶
- Recipient of National Institutes of Health
Research Career Development Award DK02072.
- (
) - The
abbreviations used are: SREHP, serine-rich E. histolytica protein; PBS, phosphate-buffered saline; PAGE, polyacrylamide gel
electrophoresis; GNA, Galanthus nivilus agglutinin; ConA, Concanavalin A agglutinin; RCA, Ricinus communis agglutinin; DSA, Datura stramonium agglutinin; BSA,
bovine serum albumin; FITC, fluorescene isothiocyanate; CHAPS,
3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic
acid.
- (
) - E. Li, unpublished observations.
ACKNOWLEDGEMENTS
We thank Drs. Jacques Baenziger and Rosalind Kornfeld
for assistance with the carbohydrate analysis and many helpful
discussions, Drs. Vernon Luckow and Robert Mercer for assistance with
the baculovirus system, Dr. Linda Pike for help in phosphoamino acid
analysis, and Lynne Foster for technical assistance. We also thank Dr.
Michael Davitz for graciously providing phosphatidylinositolspecific
phospholipase D, and Dr. Martin Low for the generous gift of
phosphatidylinositol-specific phospholipase C.
REFERENCES
- Stanley, S. L., Jr., Becker, A., Kunz-Jenkins, C., Foster, L., and Li, E. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 4976-4980
[Abstract/Free Full Text]
- Stanley, S. L., Jr., Jackson, T. F. H. G., Reed, S. L., Calderon, J., Kunz-Jenkins, C., Gathiram, V., and Li, E. (1991) J. Am. Med. Assoc. 266, 1984-1986
[Abstract/Free Full Text]
- Myung, K., Burch, D., Jackson, T. F. H. G., and Stanley, S. L., Jr. (1992) Arch. Med. Res. 23, 285-288
[Medline]
[Order article via Infotrieve]
- Zhang, T., Cieslak, P. R., and Stanley, S. L., Jr. (1994) Infect. Immun. 62, 1166-1170
[Abstract/Free Full Text]
- Zhang, T., Cieslak, P. R., Foster, L., Kunz-Jenkins, C., and Stanley, S. L., Jr. (1994) Parasite Immunol. 16, 225-230
[Medline]
[Order article via Infotrieve]
- Li, E., Becker, A., and Stanley, S. L., Jr. (1988) J. Exp. Med. 167, 1725-1730
[Abstract/Free Full Text]
- DeTomaso, A. W., Xie, Z. J., Liu, G., and Mercer, R. W. (1993) J. Biol. Chem. 268, 1470-1478
[Abstract/Free Full Text]
- Stanley, S. L., Jr., Huizenga, H., and Li, E. (1992) Mol. Biochem. Parasitol. 50, 127-138
[CrossRef][Medline]
[Order article via Infotrieve]
- Li, E., Locke, B., Yang, N. C., Ong, D. E., and Gordon, J. I. (1987) J. Biol. Chem. 262, 13773-13779
- Ames, B. N. (1966) Methods Enzymol. 8, 115-118
- Heisermann, G. J. and Gill, G. N. (1988) J. Biol. Chem. 263, 13152-13158
[Abstract/Free Full Text]
- Torres, C.-R., and Hart, G. W. (1984) J. Biol. Chem. 259, 3308-3317
[Abstract/Free Full Text]
- Holt, G. D., and Hart, G. W. (1986) J. Biol. Chem. 261, 8049-8057
[Abstract/Free Full Text]
- Ferguson, M. A. J. (1988) in Post-translational Modifications of Proteins by Lipids : A Laboratory Manual (Brodbeck, U., and Bordier, C., eds) pp. 1-8, Springer-Verlag, Berlin
- Bizzozero, O. A., Fridal, K., and Pastuszyn, A. (1994) J. Neurochem. 62, 1163-1171
[Medline]
[Order article via Infotrieve]
- Magee, A. I., Koyama, A. H., Malfer, C., Wen, D., and Schlesinger, M. J. (1984) Biochim. Biophys. Acta 798, 156-166
[Medline]
[Order article via Infotrieve]
- Luckow, V. A., Lee, S. C., Barry, G. F., and Olins, P. O. (1993) J. Virol. 67, 4566-4579
[Abstract/Free Full Text]
- Stanley, S. L., Jr., Li, E., and Davie, J. M. (1988) Mol. Immunol. 25, 285-294
[CrossRef][Medline]
[Order article via Infotrieve]
- Bailey, G. B., Leitch, G. J., and Day, D. B. (1985) J. Protozool. 32, 341-346
[Medline]
[Order article via Infotrieve]
- Lushbaugh, W. B., and Miller, J. H. (1988) in Amebiasis : Human Infection by Entamoeba Histolytica (Ravdin, J. I., ed) pp. 41-68, John Wiley & Sons, New York
- McCoy, J. J., Mann, B. J., Vedvick, T. S., Pak, Y., Heimark, D. B., and Petri, W. A., Jr. (1993) J. Biol. Chem. 268, 24223-24231
[Abstract/Free Full Text]
- Petri, W. A., Jr., Chapman, M. D., Snodgrass, T., Mann, B. J., Broman, J., and Ravdin, J. I. (1989) J. Biol. Chem. 264, 3007-3012
[Abstract/Free Full Text]
- Stanley, S. L., Jr. and Li, E. (1993) Sem. Gastroint. Dis. 4, 214-223
- Li, E., Kunz-Jenkins, C., and Stanley, S. L., Jr. (1992) Mol. Biochem. Parasitol. 50, 355-358
[CrossRef][Medline]
[Order article via Infotrieve]
- Nyame, K., Cummings, R. D., and Damian, R. T. (1987) J. Biol. Chem. 262, 7990-7995
[Abstract/Free Full Text]
- Din, N.-U., Drager-Dayal, R., Decrind, C., Hu, B.-H., Del Giudice, G., and Hoessli, D. (1992) Biochem. Int. 27, 55-64
[Medline]
[Order article via Infotrieve]
- Haltiwanger, R. S., Kelly, W. G., Roquemore, E. P., Blomberg, M. A., Dong, L.-Y., D., Kreppel, L., Chou, T.-Y., and Hart, G. W. (1992) Biochem. Soc. Trans. 20, 264-269
[Medline]
[Order article via Infotrieve]
- Abeijon, C., and Hirschberg, C. B. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 1010-1014
[Abstract/Free Full Text]
- Holder, A. A. (1988) Progr. Allergy 41, 148-172
[Medline]
[Order article via Infotrieve]
- Tuazon, T. P., and Traugh, J. A. (1991) Adv. Second Messenger Phosphoprotein Res. 23, 123-164
[Medline]
[Order article via Infotrieve]
- Que, X., Samuelson, J., and Reed, S. (1993) Mol. Biochem. Parasitol. 60, 161-170
[CrossRef][Medline]
[Order article via Infotrieve]
- Que, X., and Reed, S. L. (1994) Mol. Biochem. Parasitol. 66, 111-118
[CrossRef][Medline]
[Order article via Infotrieve]
- Stoffel, W., Hillen, H., Schroder, W., and Deutzman, R. (1983) Hoppes-Seyler's Z. Physiol. Chem. 364, 1455-1466
- Liaw, L., Almeida, M., Hart, C. E., Schwartz, S. M., and Giachelli, C. M. (1994) Circ. Res. 74, 214-224
[Abstract/Free Full Text]
- Li, E., Becker, A., and Stanley, S. L., Jr. (1989) Infect. Immun. 57, 8-12
[Abstract/Free Full Text]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
L. Balan, V. N. Foltyn, M. Zehl, E. Dumin, E. Dikopoltsev, D. Knoh, Y. Ohno, A. Kihara, O. N. Jensen, I. S. Radzishevsky, et al.
Feedback inactivation of D-serine synthesis by NMDA receptor-elicited translocation of serine racemase to the membrane
PNAS,
May 5, 2009;
106(18):
7589 - 7594.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E. Teixeira and C. D. Huston
Participation of the Serine-Rich Entamoeba histolytica Protein in Amebic Phagocytosis of Apoptotic Host Cells
Infect. Immun.,
March 1, 2008;
76(3):
959 - 966.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Bredeston, C. E. Caffaro, J. Samuelson, and C. B. Hirschberg
Golgi and Endoplasmic Reticulum Functions Take Place in Different Subcellular Compartments of Entamoeba histolytica
J. Biol. Chem.,
September 16, 2005;
280(37):
32168 - 32176.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Zhang, Z. Zhang, D. Alexander, R. Bracha, D. Mirelman, and S. L. Stanley Jr.
Expression of Amoebapores Is Required for Full Expression of Entamoeba histolytica Virulence in Amebic Liver Abscess but Is Not Necessary for the Induction of Inflammation or Tissue Damage in Amebic Colitis
Infect. Immun.,
February 1, 2004;
72(2):
678 - 683.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. HANOVER
Glycan-dependent signaling: O-linked N-acetylglucosamine
FASEB J,
September 1, 2001;
15(11):
1865 - 1876.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. F. Stenson, Z. Zhang, T. Riehl, and S. L. Stanley Jr.
Amebic Infection in the Human Colon Induces Cyclooxygenase-2
Infect. Immun.,
May 1, 2001;
69(5):
3382 - 3388.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Guha-Niyogi, D. R. Sullivan, and S. J. Turco
Glycoconjugate structures of parasitic protozoa
Glycobiology,
April 1, 2001;
11(4):
45R - 59R.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Cevallos, N. Bhat, R. Verdon, D. H. Hamer, B. Stein, S. Tzipori, M. E. A. Pereira, G. T. Keusch, and H. D. Ward
Mediation of Cryptosporidium parvum Infection In Vitro by Mucin-Like Glycoproteins Defined by a Neutralizing Monoclonal Antibody
Infect. Immun.,
September 1, 2000;
68(9):
5167 - 5175.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Frisardi, S. K. Ghosh, J. Field, K. Van Dellen, R. Rogers, P. Robbins, and J. Samuelson
The Most Abundant Glycoprotein of Amebic Cyst Walls (Jacob) Is a Lectin with Five Cys-Rich, Chitin-Binding Domains
Infect. Immun.,
July 1, 2000;
68(7):
4217 - 4224.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. K. Ghosh, J. Field, M. Frisardi, B. Rosenthal, Z. Mai, R. Rogers, and J. Samuelson
Chitinase Secretion by Encysting Entamoeba invadens and Transfected Entamoeba histolytica Trophozoites: Localization of Secretory Vesicles, Endoplasmic Reticulum, and Golgi Apparatus
Infect. Immun.,
June 1, 1999;
67(6):
3073 - 3081.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Cao, D. M. Jefferson, and N. Panjwani
Role of Carbohydrate-mediated Adherence in Cytopathogenic Mechanisms of Acanthamoeba
J. Biol. Chem.,
June 19, 1998;
273(25):
15838 - 15845.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Sultan, L.-l. Jin, M. G. Jobling, R. K. Holmes, and S. L. Stanley Jr.
Mucosal Immunogenicity of a Holotoxin-Like Molecule Containing the Serine-Rich Entamoeba histolytica Protein (SREHP) Fused to the A2 Domain of Cholera Toxin
Infect. Immun.,
February 1, 1998;
66(2):
462 - 468.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Mai and J. Samuelson
A New Gene Family (ariel) Encodes Asparagine-Rich Entamoeba histolytica Antigens, Which Resemble the Amebic Vaccine Candidate Serine-Rich E. histolytica Protein
Infect. Immun.,
January 1, 1998;
66(1):
353 - 355.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Marinets, T. Zhang, N. Guillen, P. Gounon, B. Bohle, U. Vollmann, O. Scheiner, G. Wiedermann, S. L. Stanley Jr., and M. Duchene
Protection against Invasive Amebiasis by a Single Monoclonal Antibody Directed against a Lipophosphoglycan Antigen Localized on the Surface of Entamoeba histolytica
J. Exp. Med.,
November 3, 1997;
186(9):
1557 - 1565.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|