Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gomes, X. V.
Right arrow Articles by Wold, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gomes, X. V.
Right arrow Articles by Wold, M. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 9, Issue of March 3, 1995 pp. 4534-4543
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Structural Analysis of Human Replication Protein A
MAPPING FUNCTIONAL DOMAINS OF THE 70-kDa SUBUNIT (*)

(Received for publication, September 28, 1994; and in revised form, December 21, 1994)

Xavier V. Gomes Marc S. Wold (§)

From the Department of Biochemistry, University of Iowa School of Medicine, Iowa City, Iowa 52242-1109

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Replication protein A (RPA) is a heterotrimeric single-stranded DNA-binding protein that is essential for DNA metabolism. Human RPA is composed of subunits of 70, 32, and 14 kDa with intrinsic DNA-binding activity localized to the 616-amino acid, 70-kDa subunit (RPA70). We have made a series of C-terminal deletions to map the functional domains of RPA70. Deletion of the C terminus resulted in polypeptides that were significantly more soluble than RPA70 but were unable to form stable complexes with the other two subunits of RPA. These data suggest that the C-terminal region of RPA70 may be important for complex formation. The DNA-binding domain was localized to a region of RPA70 between residues 1 and 441. A mutant containing residues 1-441 bound oligonucleotides with an intrinsic affinity close to wild-type RPA complex. This mutant also appeared to bind with reduced cooperativity. We conclude that the C terminus of RPA70 and the 32- and 14-kDa subunits are not involved directly with interactions with DNA but may have a role in cooperativity of RPA binding. RPA70 deletion mutants were not able to support DNA replication even in the presence of a complex of the 32- and 14-kDa subunits, suggesting that the heterotrimeric complex is essential for DNA replication. The putative zinc finger in the C terminus of RPA70 is not required for single-stranded DNA-binding activity.


INTRODUCTION

DNA replication in eukaryotic cells is a complex process requiring the coordinated action of multiple proteins to carry out the regulated synthesis of chromosomal DNA. Because of this complexity, viral model systems like the papova virus SV40 have been essential for studying the molecular mechanism of chromosomal DNA replication (for recent reviews, see (1, 2, 3, 4, 5) ). The SV40 genome codes for only a single replication protein, large T antigen; all other replication proteins are supplied by the host cell. Using this model system, a number of cellular proteins required for SV40 DNA replication have been identified and their functions in DNA replication partially elucidated(6, 7, 8, 9, 10) .

One of the proteins essential for DNA replication is the multisubunit single-stranded DNA binding protein, replication protein A (RPA, (^1)also known as human SSB; (11, 12, 13) ). Studies using the in vitro SV40 replication system have demonstrated that RPA has multiple functions during DNA replication(9, 14, 15, 16) . RPA is required for both initiation and elongation phases of DNA replication. Initiation of SV40 replication requires the concerted action of three proteins: RPA, DNA polymerase alphabulletprimase complex, and T antigen(1, 2, 3, 4, 5, 17) . T antigen first binds to the origin of replication and, in the presence of RPA, catalyzes the localized unwinding of the origin. DNA polymerase alphabulletprimase complex interacts with the resulting nucleoprotein complex and synthesizes RNA primers that lead to nascent DNA synthesis. RPA specifically interacts with both T antigen and DNA polymerase alpha(18) . These specific protein-protein interactions have been shown to be essential for priming by DNA polymerase alphabulletprimase complex on physiological templates and are required for specific initiation of DNA replication (9, 15, 16) . RPA is also required for elongation; RPA stimulates the activities of multiple enzymes that function at the replication fork including DNA polymerases and DNA helicases(14, 19, 20, 21, 22, 23) . In addition to being essential for multiple stages of DNA replication, RPA is involved in DNA repair and recombination(24, 25, 26) . RPA from calf thymus has also been shown to unwind single-stranded DNA (ssDNA) under low salt conditions(27) . RPA interacts specifically with several other proteins including the tumor suppressor p53 and several transcriptional activators such as GAL4 and VP16(28, 29, 30) . The functional importance of these interactions is not known; however, it has been suggested that these interactions could be important for coordinating DNA metabolism with other cellular processes.

RPA binds tightly to ssDNA (11, 12, 13) with an apparent binding constant of approximately 10^9(31, 32, 33, 34) . Studies of the human RPA (hRPA) have shown that binding is dependent upon both the sequence and length of the DNA being bound(31, 34) . Human RPA binds to ssDNA with low cooperativity (31, 34, 35) and has a binding site size of 30 nucleotides with between 20 and 30 nucleotides of ssDNA directly interacting with RPA(34) . hRPA may also have other DNA binding modes. A recent chemical cross-linking study suggested that under certain conditions hRPA may bind with a binding site size of 8-10 nucleotides (36) . The binding properties of hRPA are similar to those of Drosophila melanogaster RPA and bovine RPA(33, 37) . In contrast, the RPA homologue from Saccharomyces cerevisiae has been shown to bind to ssDNA with high cooperativity and with a much larger binding site(32) . While DNA binding seems to be essential for RPA function, it is not known how variations in the interaction of RPA with DNA affect DNA synthesis.

Human RPA is a stable complex of three subunits of 70, 32, and 14 kDa (12, 13) and is highly conserved throughout evolution. Homologous heterotrimeric single-stranded DNA-binding proteins have been identified in all eukaryotes examined including S. cerevisiae, Xenopus laevis, D. melanogaster, and Crithidia fasiculata(25, 27, 33, 37, 38, 39, 40, 41) . Amino acid sequence comparison has shown that the homologues of RPA70 from S. cerevisiae, C. fasiculata, and X. laevis are 44, 58, and 90% similar, respectively, to human RPA70 (21, 38, 42) . All known RPA70 homologues contain a conserved putative C(4)-type zinc-finger motif in the C-terminal third of the protein(21, 38, 42) . However, in spite of this high degree of homology, only some RPA homologues can substitute for human RPA in SV40 DNA replication. RPA from mouse and Drosophila support specific SV40 initiation, while RPA from yeast and trypanosomes RPA do not(16, 39, 40, 43) , suggesting that there are species-specific interactions essential for normal RPA function.

All experimental and genetic evidence to date suggests that all three subunits of RPA are needed for function. Individual subunits do not function in DNA replication(14, 21, 44, 45, 46) , and, in S. cerevisiae, the genes encoding all three subunits are essential for viability(25, 47) . Most antibodies to RPA inhibit DNA replication even when they only interact specifically with one subunit(14, 44) . The specific functions of the three subunits of RPA are currently not well understood. The 32- and 14-kDa subunits are capable of forming a soluble complex together(46, 48) . This subcomplex is unable to support DNA replication but may be essential for the proper folding of the 70-kDa subunit and/or assembly of the RPA complex(46) . The 32-kDa subunit of RPA also becomes phosphorylated in a cell cycle-dependent manner(49) . It has been suggested that the phosphorylation could be a regulatory event in either DNA replication or DNA repair(50, 51, 52, 53) ; however, the specific role of phosphorylation of RPA is currently not known(54, 55) . There is currently no specific role attributed to the 14-kDa subunit except for a structural function in RPA complex assembly (46) , although sequence comparisons have been used to suggest that the 14-kDa subunit may be involved in protein-protein interactions (45) .

The 70-kDa subunit of RPA has several distinct functions. The intrinsic DNA-binding activity of RPA has been localized to the 70-kDa subunit (14, 56) . In addition, isolated RPA70 has been shown to interact with DNA polymerase alphabulletprimase complex and to stimulate DNA polymerase alpha activity(18, 21) . RPA70 has also been shown to specifically interact with p53 and several transcriptional activators (28, 29, 30) but not with SV40 T antigen(18) . Biochemical analysis of the functions of RPA70 have been hampered by the very low solubility of the isolated subunit(21, 46) . The development of Escherichia coli plasmids capable of expressing recombinant human RPA (rhRPA) (46) allowed us to generate and express a series of C-terminal deletion mutants of RPA70. Characterization of these mutants has resulted in an initial mapping of the functional domains of RPA70. A small region at the C terminus of the 70-kDa subunit seems to be important for the formation of the heterotrimeric RPA complex. The DNA binding domain of RPA70 has been mapped to the region between residues 1 and 441.


EXPERIMENTAL PROCEDURES

Materials

Restriction endonucleases, T4 DNA polymerase, and Klenow fragment were purchased from New England BioLabs and Life Technologies, Inc. [-P]ATP (4,500 Ci/mmol) and [alpha-P]dATP (3,000 Ci/mmol) were obtained from ICN. Oligonucleotides were synthesized using an Applied Biosystems DNA synthesizer model 380B at the DNA core facility at the University of Iowa. E. coli DH5alpha was from Life Technologies, Inc. E. coli expression strain BL21(DE3) was from W. Studier (57) . Poly(dT) was purchased from Midland certified reagents. rhRPA was purified as described previously(46) . This recombinant complex has properties similar to those of native RPA (46

HI buffer contains 30 mM HEPES, pH 7.8, 1 mM dithiothreitol, 0.25 mM EDTA, 0.5% (w/v) inositol, and 0.01% (v/v) Nonidet P-40. HI was supplemented with different concentrations of salt as indicated in the text. 1 times Tris acetate/EDTA (TAE) gel buffer contained 40 mM Tris acetate and 2 mM EDTA, pH 8.5(58) .

pET expression plasmids used were obtained from W. Studier and co-workers(57) . RPA expression plasmids (p11d-tRPA and p3d-RPA14/32) were described previously(46) .

DNA Manipulation

Restriction endonucleases, T4 DNA polymerase, and Klenow were used according to manufacturer's recommendations. Oligonucleotides were radiolabeled with [-P]ATP using polynucleotide kinase(58) . Polymerase chain reactions (PCR) were performed with AmpliTaq (Perkin-Elmer) polymerase in a DNA thermal cycler (Perkin-Elmer). DNA amplification conditions were 29 cycles of 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 3 min. PCR products and DNA fragments were isolated from 1% TAE agarose gels using a Geneclean II kit (BIO 101, La Jolla, CA) according to manufacture's specifications. Ligation reactions and transformations were as according to Ausubel and co-workers(58) . Recombinant plasmids were transformed into strain E. coli DH5alpha and isolated by the boiling lysis method(58) . DNA sequencing was performed using the dideoxynucleotide method with Sequenase 2.0 (U. S. Biochemical Corp.) as directed by the manufacturer and also using an Applied Biosystems 373A automatic DNA sequencer at the DNA core facility at the University of Iowa.

Construction of RPA70 C-terminal Deletion Mutants

A series of C-terminal deletion mutants were generated using PCR to amplify specific regions of the RPA70 cDNA (Table 1). The N-terminal primer (5`GGAGGATCCCCATGGTCGGCC 3`) contained nucleotide base changes (underlined) to generate a BamHI restriction site just prior to the endogenous NcoI restriction site at the ATG initiation codon. The C-terminal PCR primers used to generate the various C-terminal deletion mutants were as follows: 5` TTGGGATCCTTAGGTGTCGCA 3` (RPA70Delta507-616); 5` CAAGGATCCTCAGTTGGTGTT 3` (RPA70Delta442-616); 5` ACGGGATCCTCAAGAACCATC 3` (RPA70Delta373-616); 5` AGTGGATCCTTAATAGCTCTT 3` (RPA70Delta327-616); 5` CTTGGATCCTTAAATAAGAGG 3` (RPA70Delta250-616); 5` GCTGGATCCTCAAGCTTTTCC 3` (RPA70Delta169-616). The C-terminal PCR primers contained nucleotide base changes (underlined) that generated a BamHI restriction site and a terminator codon. The individual PCR products were digested with BamHI and ligated to pUC19 also digested with BamHI. The resulting plasmids were digested with BamHI and NcoI yielding a series of fragments containing truncated RPA70 coding sequences. Each fragment was isolated and ligated to the expression vector pET-11d digested with NcoI and BamHI resulting in a series of expression vectors containing specific C-terminal deletions of the RPA70 gene (Table 1). Each plasmid contained a T7 promoter, a Shine-Dalgarno ribosome binding site, and the coding sequence of a RPA70 deletion mutant. DNA sequence analysis of each of the resulting vectors confirmed that the initiator codon ATG was maintained.



Construction of Vectors Containing RPA32, RPA14, and Mutant RPA70 Genes

Vectors capable of simultaneously expressing RPA32, RPA14 and individual C-terminal deletion mutants of RPA70 in E. coli were constructed following the same procedure used to generate p11d-tRPA, which co-expresses all three wild-type RPA subunits (46) . Briefly, p3d-RPA14/32 (46) was digested with XbaI and EspI restriction enzymes and treated with T4 DNA polymerase to generate a blunt ended 1.6-kilobase fragment containing the coding sequences of both the 14- and 32-kDa subunits. Individual pET-11d vectors containing a C-terminal deletion mutant of RPA70 gene were digested with BamHI restriction enzyme, treated with T4 DNA polymerase to generate blunt ends, and ligated to the 1.6-kilobase fragment. The resulting expression vectors contain a single T7 RNA polymerase promoter, and the coding sequences of the mutated 70-, 32-, and 14-kDa subunits of RPA. Each coding sequence is preceded by a Shine-Dalgarno ribosome binding site. The series of plasmids constructed is summarized in Table 1.

Induction of the C-terminal Deletion Mutants of RPA70

The various C-terminal deletion mutants were expressed in BL21(DE3) as described previously(46) . A single recombinant colony was used to inoculate 1 liter of TB medium (10 g of Bacto-tryptone, 5 g of NaCl) with 100 µg/ml ampicillin. The culture was grown overnight at 37 °C without shaking and then placed on a shaker at 37 °C until the OD = 0.6. The culture was induced by adding isopropyl-1-thio-beta-D-galactopyranoside to 0.4 mM. After 2 h of induction, the cells were collected by centrifugation at 4,000 rpm for 20 min in a Beckman JS4.2 rotor and resuspended in 5 ml of HI Buffer with 1 mM phenylmethylsulfonyl fluoride. The resuspended cells were frozen at -80 °C, thawed, and lysed by three passages through a French press. The lysate was centrifuged in a Sorvall SS34 rotor at 12,000 rpm for 30 min at 4 °C to generate a supernatant fraction containing soluble proteins and a pellet fraction containing insoluble proteins and cell debris. The pellet, containing cell debris and insoluble protein, was resuspended in 5 ml of HI Buffer with five strokes of a Dounce homogenizer. The resulting fractions were frozen in liquid nitrogen and stored at -80 °C. To determine the proportion of induced protein present in the insoluble fraction, the pellet fraction was solublized with 1% SDS, boiled for 5 min, and spun at 10,000 times g for 5 min to remove residual insoluble material. Equal volumes of pellet and supernatant fractions were then separated on 8-14% SDS-polyacrylamide gels (59) and analyzed by Coomassie staining or by immunoblot analysis.

Whole cell lysates were made by collecting cells by centrifugation at 4,000 rpm for 20 min in a Beckman JS4.2 rotor. Cells were then resuspended in one-tenth original volume with HI buffer with 1% SDS. 500 µl of suspended cells were transferred to a 1.5-ml microcentrifuge tube, boiled for 10 min to lyse cells, and spun at 10,000 times g for 5 min to remove cell debris.

Immunoblotting

Protein samples were separated on 8-14% SDS-polyacrylamide gels (59) and transferred to nitrocellulose (Bio-Rad) using a PolyBlot electrotransfer system from Millipore as per manufacturer's specifications. RPA subunits were detected using monoclonal antibodies alphaSSB70C (14) and RPA9 (B. Stillman, Cold Spring Harbor Laboratory). Secondary antibodies (Sigma) used sheep anti-mouse horseradish peroxidase conjugate. Secondary antibodies were detected using ECL chemiluminescence kit (Amersham Corp.) as recommended by manufacturer.

Southwestern Analysis

Southwestern analysis was performed as described previously (56) using either the pellet fractions or whole cell lysates from induced cultures. Approximately 20 µg of protein samples were separated on 8-14% SDS-polyacrylamide gels (59) and transferred to nitrocellulose (Bio-Rad) using a PolyBlot electrotransfer system from Millipore as per manufacturer's specifications. The nitrocellulose blot was blocked by incubating in phosphate-buffered saline (150 mM sodium chloride, 10 mM sodium phosphate, pH 7.05, 1 mM EDTA, 1 mM sodium azide) containing 4% (w/v) bovine serum albumin and 0.2% (v/v) Triton X-100 for 30 min at 25 °C. The nitrocellulose blot was incubated with 3 pmol (3 times 10^6 cpm) of P-labeled oligo(dT) at 25 °C for 60 min, washed 3 times with phosphate-buffered saline containing 0.2% Triton X-100 and analyzed by autoradiography.

Purification of Delta442 and Delta327

Purification of both mutants was carried out following the general procedure of Henricksen et al.(46) . All steps were carried out at 4 °C. During the purification, the C-terminal deletion mutants were monitored by Western blotting. Soluble lysate from 2 liters of an induced culture was applied to a 20-ml (1.5 times 5.6 cm) Affi-Gel blue (Bio-Rad) column equilibrated with HI buffer containing 50 mM KCl. The column was washed sequentially with 60 ml each of HI buffer containing 50 mM KCl, 0.8 M KCl, 0.5 M NaSCN, or 1.5 M NaSCN. Like wild-type RPA, Delta442 and Delta327 eluted in the 1.5 M NaSCN wash. The peak of protein from the 1.5 M NaSCN wash was applied directly to a 1.6-ml hydroxylapatite column (1 times 10 cm) equilibrated with HI buffer. The column was washed sequentially with 6 ml each of HI buffer containing 0, 80, or 500 mM potassium phosphate; both mutants bound to the column and eluted in HI buffer with 0 mM potassium phosphate. The fractions containing each deletion mutant were applied to a Mono Q (HR5/5) column (Pharmicia Biotech Inc.) equilibrated with HI buffer containing 14 mM KCl. The column was washed with 4 ml of HI buffer containing 50 mM KCl and then developed with a 10-ml linear salt gradient of 50-340 mM KCl; Delta442 and Delta327 eluted from the Mono Q column at 100 mM KCl. The purification of each RPA70 deletion mutant is summarized in Table 2. Protein concentrations were determined by Bradford assay using bovine serum albumin as a standard(60) .



Hydrodynamic Characterization

The Stokes radii of Delta442 and Delta327 were determined by gel permeation chromatography as described previously(34) . The standards and samples were brought to a final volume of 50-200 µl with HI buffer containing 200 mM KCl and loaded onto a 24-ml Superose 6 HR 10/30 column (Pharmacia) equilibrated in HI buffer containing 200 mM KCl. The column was eluted at a flow rate of 0.4 ml/min, and fractions were analyzed by SDS-polyacrylamide gel electrophoresis followed by staining with silver.

Sedimentation constants of Delta442 and Delta327 were determined by glycerol gradient sedimentation as described previously(34) . Samples or standards were brought to a final volume of 50-100 µl with HI buffer containing 200 mM KCl and loaded onto a 5-ml 15-35% glycerol gradient in HI buffer containing 200 mM KCl. The gradients were centrifuged at 48,000 rpm in a Beckman SW55 Ti rotor for 24 h at 4 °C. The gradients were fractionated from the bottom of the tube using a gradient fractionator (Hoefer Scientific Instruments). The fractions were analyzed by SDS-polyacrylamide gel electrophoresis followed by silver staining.

Fluorescence Studies

Fluorescence titrations were carried out as described previously on an SLM 4800C spectrofluorimeter with the following modifications(35) . The binding reactions containing 50-100 nM RPA, 70 nM Delta441, or 100-350 nM Delta327 were incubated with DNA at 20 °C in 1.8 ml of HI buffer containing 15 mM KCl. A slit width of 2 mm was used. The excitation wavelength was 292 nm, and emission was monitored at 346 nm. Under these conditions, we observed less than 2% photobleaching during a titration.

Gel Mobility Shift Assay

Gel mobility shift assays were performed as described previously with slight modifications(31) . 15-µl binding reactions were carried out in HI buffer containing 15 mM KCl. The indicated amounts of protein were incubated with 2 fmol of labeled oligonucleotide for 20 min at 25 °C. Binding reactions were brought to a final concentration of 4% glycerol and 0.004% bromphenol blue and electrophoresed on 1% agarose gel in 0.1% TAE at 100 V/cm for 1.5 h. The gels were then dried on DE81 paper and radioactive bands were localized by autoradiography.


RESULTS

Construction and Expression of RPA70 C-terminal Deletion Mutants

A series of C-terminal deletions were made in order map the functional domains of the 70-kDa subunit of RPA. A set of specific C-terminal primers was designed to replace individual RPA70 codons spaced throughout the coding region with termination codons. PCR amplification of the wild-type RPA70 gene using one internal primer and the N-terminal primer resulted in a series of C-terminal deletion mutants of RPA70 that contained the wild-type RPA70 amino acid sequence up to a single termination codon. After PCR amplification, appropriately sized DNA fragments were cloned into pUC19. The resulting plasmids were characterized by restriction analysis, and the mutant RPA70 genes were excised and individually ligated into the pET-11d expression vector. The set of RPA70 C-terminal deletion mutants generated is summarized in Table 1and shown schematically in Fig. 1. Each mutant was named for the amino acids deleted; for example RPA70Delta442-616 has amino acids 442-616 deleted. In the discussion of these studies, each mutant will be abbreviated using a designation indicating the first amino acid deleted. Thus RPA70Delta442-616 will be referred to as Delta442.


Figure 1: Schematic of individual C-terminal deletion mutants and summary of properties. The leftside of figure shows schematic of wild-type RPA70 and the six deletion mutants (Delta507, Delta442, Delta373, Delta327, Delta250, and Delta169). Thickbars indicate residues contained in each polypeptide. Ticks indicates positions every 100 amino acids, and the position of the putative zinc finger motif is indicated by a solidbox (Zn?). Lines under schematic indicate predicted location of functional domains. Righthand side summarizes the properties of each mutant determined during these studies: solubility (- denotes insoluble; + 25-50% soluble; ++ >50% soluble) and complex formation and DNA binding (-, no activity; +, activity).



The expression plasmids were tested for their ability to express mutant RPA70. E. coli BL21(DE3) cells were transformed with individual expression plasmids, grown and induced with isopropyl-1-thio-beta-D-galactopyranoside. Lysates from induced cell were analyzed by SDS-polyacrylamide gel electrophoresis followed by staining with Coomassie Blue or immunoblot analysis. All six expression plasmids generated polypeptides of the appropriate size after induction (Fig. 2). Immunoblot analysis demonstrated that all six polypeptides cross-reacted with antibodies to RPA70 (data not shown, also see Fig. 4). The level of expression varied consistently between the six mutants. Delta442, Delta373, and Delta327 were present in lysates from induced cells at 2-4-fold higher levels than the other mutants.


Figure 2: Expression of the various deletion mutants of RPA70 in E. coli.E. coli BL21(DE3) cells were transformed with either p11d-RPA70 (RPA70) or pET-11d vectors containing the various mutated RPA70 genes (Delta507, Delta442, Delta373, Delta327, Delta250, and Delta169; see Table 1). 10 µg of whole cell lysates from uninduced (U) or induced (I) cells were separated by electrophoresis on an 8-14% SDS-polyacrylamide gel and visualized by Coomassie Blue staining. Arrows indicate the position of the induced wild-type RPA70 and the various deletion mutants of RPA70. The position of standards in kDa are indicated.




Figure 4: Solubility analysis of C-terminal deletion mutants of RPA70. Equal volumes of the supernatant (S) or pellet (P) fractions of full-length RPA70 and the various deletion mutants (Delta507, Delta442, Delta373, Delta327, Delta250, and Delta169) were separated on an 8-14% SDS-PAGE gel, transferred onto nitrocellulose, and probed with monoclonal antibodies to RPA70. The arrows indicate the position of RPA70 and the deletion mutants of RPA70. The asterisk indicates the position of a proteolytic fragment of RPA70 observed in multiple lanes.



Initial Characterization of RPA70 C-terminal Deletion Mutants

The intrinsic DNA-binding activity of RPA has been localized to RPA70(14, 56) . We investigated which of the deletion mutants of RPA70 were capable of binding ssDNA by carrying out Southwestern analysis. In this technique proteins are separated on an 8-14% SDS-polyacrylamide gel, transferred onto nitrocellulose, and incubated with a radiolabeled ssDNA. DNA binding activity is indicated by the association of the radioactive probe with specific proteins. This technique allows the analysis of complex mixtures of proteins and has the advantage that any protein that can be solublized in SDS can be tested for DNA binding. When pellet fractions from induced cultures containing individual C-terminal mutants were examined, all of the mutants except Delta169 were capable of binding DNA (Fig. 3). Similar results were obtained when whole cell lysates containing the various C-terminal deletion mutants were examined (data not shown). This method requires that a polypeptide that has been denatured in SDS partially refold in order to bind to DNA. Thus, while the intensity of the bands varied significantly, these variations do not necessarily indicate differences in binding affinity; they could also reflect differences in the efficiency of refolding. The complete absence of binding to Delta169 indicates that deletion of amino acids 169-249 removes residues necessary for either DNA binding or protein folding.


Figure 3: Southwestern analysis of the C-terminal deletion mutants of RPA70. Approximately 20 µg of pellet fractions from induced cultures containing p11d-RPA70 (RPA70) or pET-11d containing mutant RPA70 (Delta507, Delta442, Delta373, Delta327, Delta250, and Delta169; see Table 1) were separated on an 8-14% SDS-polyacrylamide gel and subjected to Southwestern analysis as described under ``Experimental Procedures.'' Solidarrows indicate the position of the wild-type RPA70 and the various deletion mutants of RPA70 that bound to DNA; openarrow indicates the position of Delta169. E. coli proteins capable of binding ssDNA are indicated by the asterisks. India ink staining of nitrocellulose indicated that all lanes contained equal amounts of RPA70 or RPA70 deletion proteins (data not shown).



In addition to the full-length C-terminal mutant proteins, other polypeptides able to bind ssDNA were observed that were unique to individual lysates. For example, a polypeptide of approximately 56 kDa was observed in the lane containing wild-type RPA70 (Fig. 3, lane1). We believe that these polypeptides are proteolytic fragments of individual RPA deletion mutants that maintain ssDNA-binding activity. The sensitivity of individual mutants to proteolysis by endogenous proteases varied significantly (also see Fig. 4, below). In Fig. 3, major bands of 72-, 18-, and 14-kDa were present in all lanes. These polypeptides were due to endogenous E. coli ssDNA binding proteins present in the lysates used in these experiments.

We next examined the solubility properties of the C-terminal deletion mutants of RPA70. Plasmids capable of directing the expression of each mutant were transformed individually into E. coli BL21(DE3) cells. Individual transformants were induced with isopropyl-1-thio-beta-D-galactopyranoside, lysed, and separated into soluble (supernatant) and insoluble (pellet) fractions. Equal amounts of pellet and supernatant fractions were separated on 8-14% SDS-polyacrylamide gels and analyzed by immunoblotting (Fig. 4). Full-length RPA70 has been shown previously to be insoluble when expressed in E. coli with >90% of the protein being found in the pellet fraction(21, 46) . In contrast, we found that the solubility of this series of deletion mutants varied significantly and could be divided into three classes based upon solubility. Deletion mutant Delta507 was highly insoluble (Fig. 4, lanes3 and 4), deletions Delta373 and Delta250 were only partially soluble with less than 50% of the expressed protein present in the soluble fraction (Fig. 4, lanes7, 8, 11, and 12), and deletions Delta442, Delta327, and Delta169 were mostly soluble (Fig. 4, lanes5, 6, 9, 10, 13, and 14). Identical results were obtained from gels stained with Coomassie Blue (data not shown). These results suggest that residues between 442 and 616 play a critical role in determining the solubility of RPA70. We also observed that the monoclonal antibodies used in these studies reacted much better with all of the deletion mutants than with full-length 70-kDa subunit; even though equal amounts of proteins were loaded in each lane, the signal from full-length RPA70 was very weak (Fig. 4, lanes1 and 2). This observation indicates that after electrophoresis and transfer to nitrocellulose, full-length RPA70 has a different conformation than the deletion mutants. This is consistent with the C terminus of RPA70 being important in determining the structure of the polypeptide.

In these studies, we observed a number of cross-reactive bands that resulted from proteolytic degradation (Fig. 4). The level of proteolysis and the specific proteolytic fragments varied between individual mutants with the exception of an 18-kDa band that was observed with several different mutants (Fig. 4, lanes6, 8, 13, and 14). This fragment is derived from the from the N-terminal region of RPA70. (^2)

Interactions of the RPA70 Deletions Mutants with the Other Subunits of RPA

When RPA70 is expressed in the presence of RPA32 and RPA14 in E. coli, a functional heterotrimeric complex is formed (46) . A series of expression plasmids were made that contained synthetic operons composed of the coding sequences of an individual deletion mutant of RPA70 and the 32- and 14-kDa subunits of RPA. These plasmids were used to examine whether any of the RPA70 deletion mutants were able to form a stable complex with the other RPA subunits. When cells containing individual expression vectors were induced and lysed, we found that in all cases the RPA70 deletion mutant and the 32- and 14-kDa subunits of RPA were expressed (data not shown). Wild-type RPA70 becomes significantly more soluble when expressed with RPA32 and RPA14 (46) . In contrast, we observed no change in the solubility properties of any of the deletion mutants when expressed with 32- and 14-kDa subunits (data not shown). If a deletion mutant was capable of forming a stable complex with RPA32bullet14, then all three subunits would be expected to co-purify. Therefore, we fractionated lysates from induced cells containing ptRPAbullet70Delta507-616, ptRPAbullet70Delta442-616, and ptRPAbullet70Delta327-616. Each lysate was fractionated over Affi-Gel blue and hydroxylapatite columns following the procedure used to purify recombinant human RPA(46) . Elution profiles of each subunit were determined by Western blotting. In each case, the RPA70 deletion mutant eluted at much higher salt concentration from Affi-Gel blue than the 32- and the 14-kDa subunits (data not shown). This suggested that none of these RPA70 deletion mutants were capable of forming a stable complex with the 32- and 14-kDa subunits. As has been observed previously(46) , the 32- and 14-kDa subunits appeared to be interacting to form a soluble complex in these experiments (data not shown).

Purification of Delta442 and Delta327

Several of the deletion mutations were highly soluble when expressed in E. coli and thus amenable to further characterization. Two of the deletion mutants, Delta442 and Delta327, were selected for further analysis based on their solubility properties and their ability to bind to ssDNA. Both of these deletion mutants were purified following the procedure used to purify rhRPA(46) . This three-column purification takes advantage of the very high affinity of RPA for Affi-gel Blue resin to purify RPA to near homogeneity. Hydroxylapatite and Mono Q columns are then used to concentrate, desalt, and remove trace contaminants. Both Delta442 and Delta327 had similar chromatographic properties on Affi-Gel blue to those of the rhRPA complex. However, both deletion mutants eluted at lower ionic strength from hydroxylapatite and Mono Q column than rhRPA (see ``Experimental Procedures''). After purification over Mono Q, both of the deletion mutants were purified to apparent homogeneity (Fig. 5).


Figure 5: Purified C-terminal deletion mutants. 0.5-1 µg of purified rhRPA, Delta442, and Delta327 were electrophoresed on an 8-14% SDS-polyacrylamide gel and visualized by staining with silver. Arrows indicate the position of the three subunits of RPA (RPA70, RPA32, and RPA14) and the two deletion mutants (Delta442 and Delta327). The positions of molecular weight standards in kDa are indicated.



The deletion mutants Delta442 and Delta327 have 30 and 50% of their amino acid residues deleted, respectively. Such large deletions could have a large effect on the folding of these proteins. We have shown that both proteins were soluble bound DNA and could be purified following a procedure similar to that of rhRPA. This suggested that these deletion mutants had a structure that was related to the structure of RPA70 in the rhRPA complex. However, to define the solution structure of both mutants more precisely, purified Delta327 and Delta442 were subjected to glycerol gradient sedimentation and gel permeation chromatography, and their sedimentation constants and Stokes radii were determined (Table 3). These values were used to calculate the molecular weight of both deletion mutants in solution (Table 3). The calculated molecular weights for both Delta327 and Delta442 were very close to the value predicted by their amino acid sequences. We conclude that both Delta327 and Delta442 exist as a monomers in solution. The frictional coefficient calculated for both mutants were close to 1.6 (Table 3). Assuming that both mutants are shaped like prolate spheroids, the axial ratio for Delta327 and Delta442 would be predicted to be approximately 12:1 and 10:1, respectively. These values are similar to that of the rhRPA complex, which has a frictional coefficient of 1.60 and a predicted axial ratio of 12:1. These hydrodynamic data suggest that while Delta327 and Delta442 are smaller, both have a general shape similar to heterotrimeric RPA complex.



DNA Binding Properties of Delta442 and Delta327

We next characterized the interactions of the purified Delta442 and Delta327 with ssDNA. It has been shown previously that interaction of RPA with ssDNA causes a decrease in the intrinsic fluorescence of RPA(34, 35) . Both Delta442 and Delta327 were found to have intrinsic fluorescence signals that decreased when the mutants were titrated with increasing amounts of ssDNA (data not shown). This decrease in fluorescence in the presence of ssDNA was found to be reversible; addition of high concentrations of NaCl caused the original fluorescence signal of both Delta442 and Delta327 to be restored (data not shown). These properties suggest that the DNA-induced changes in fluorescence are a direct result of proteinbulletDNA interactions and, thus, can be used to examine DNA binding parameters of these mutant proteins.

We have shown previously that binding of RPA to oligodeoxythymidine 30 nucleotides in length (oligo(dT)) is a simple bimolecular reaction(34) , and the RPA concentrations needed to obtain an observable fluorescence signal are high enough (50-100 nM) to cause stoichiometric binding(34, 35) . Delta442 and Delta327 both bind oligo(dT) with stoichiometry of 1:1 (see below). Each mutant was titrated with oligo(dT), and changes in fluorescence were monitored (data not shown). In a stoichiometric titration of a bimolecular binding reaction, the moles of oligo(dT) necessary to reach saturation (i.e. give the maximum decrease in fluorescence signal) should equal the moles of protein capable of binding DNA. Comparing the amount of active protein to the total protein present for titrations of Delta442 and Delta327 with oligo (dT) indicated that the mutants were 35 and 62% active, respectively (Table 3). These values were similar to those obtained previously for both native and recombinant RPA complexes (34, 35) . We also determined the binding site size of Delta442 and Delta327 in a second series of stoichiometric titrations using poly(dT) 3,000 nucleotides in length. Saturation of such a long DNA fragment occurs when the protein coats the DNA and thus, when a protein is titrated with poly(dT), the ratio of moles of nucleotide/active protein at saturation corresponds to the binding site size of the protein. Such titrations indicated that the binding site sizes of Delta442 and Delta327 were 21 and 18 nucleotides, respectively (Table 3). These results indicate that both Delta442 and Delta327 are only partially active and both have smaller binding site sizes than rhRPA (Table 3).

Equilibrium binding of Delta442 and Delta327 to oligonucleotides was examined in gel mobility shift assays. In these assays, short oligonucleotides were incubated with increasing concentrations of protein, and the resulting complexes were analyzed on agarose gels. RPAbulletoligonucleotide complexes are stable to separation by electrophoresis and migrate with altered mobility(31) . Fig. 6shows titrations in which oligo(dT) was titrated with either rhRPA, Delta327, or Delta442. As has been observed in previous studies(31) , two bands of altered mobility were observed when rhRPA binds to oligo(dT). At low concentrations of rhRPA, a single complex with altered mobility was observed (Fig. 6A, lanes4-8) and as the protein concentration was increased, a second complex with lower mobility appeared (Fig. 6A, lanes8-12). These complexes represent singly and doubly liganded complexes, respectively (34) . When oligo(dT) was titrated with Delta442, two complexes with altered mobility were also observed (Fig. 6B, lanes4-11); however, with more than 100 fmol of Delta442, a third complex was observed (Fig. 6B, lane12). We believe this to be a triply liganded complex. This conclusion is consistent with the 21-nucleotide binding site of Delta442. Delta327 also has a smaller binding site size than that of rhRPA, yet only two complexes with altered mobility were observed when oligo(dT) was titrated with Delta327 (Fig. 6C). In addition, much higher concentrations of protein were required for binding of this mutant (Fig. 6C). This indicated that the binding affinity of Delta327 is much lower than that of rhRPA and that saturating concentrations of protein had probably not been added in this assay. In these experiments, we observed that in reactions containing greater than 1,000 fmol of protein, the proteinbulletDNA complexes migrated as smears (e.g.Fig. 6C, lane11). This is probably due to RPA-RPA interactions or aggregation at high protein concentrations. Aggregation of human RPA has been observed previously at high protein concentrations(34) .


Figure 6: Gel mobility shift assay of recombinant proteins using labeled oligo (dT). 2 fmol of radiolabeled oligo(dT) was incubated with indicated amounts of either rhRPA (A), Delta442 (B), or Delta327 (C). After incubating at 25 °C for 20 min, the reaction mixture was separated on a 1% agarose gel in 0.1% TAE as described under ``Experimental Procedures.'' The positions of the free and bound oligo(dT) are as indicated. D, quantitation of titrations shown in A-C. Each band was excised, and the radioactivity was measured by liquid scintillation counting. Fraction-free DNA was plotted versus concentration of active protein, and the resulting binding isotherms for rhRPA (bullet), Delta442 (box), and Delta327 () binding to oligo(dT) are shown. The data were fit to the Langmuir binding equation for bimolecular binding reactions using nonlinear least square fitting software (Kaleidograph, Abelbeck Software) as described previously(34) . Best fit curves are shown for rhRPA (solidline, K = 5.1 times 10^9), Delta442 (dottedline, K = 2.4 times 10^9), and Delta327 (dashedline, K = 1.7 times 10^8).



The titrations shown in Fig. 6were quantitated by excising individual bands and determining the amount of radioactive DNA present. Individual binding isotherms were obtained by plotting the fraction of free DNA versus active protein present (Fig. 6D). Apparent binding constants were then determined by fitting the data to the Langmuir binding equation. We have shown previously that under these conditions RPA binds to DNA with low cooperativity, and that individual binding events can be considered unlinked(34) . Therefore, the multiple binding events of RPA binding to oligo(dT) can be analyzed as a series of independent bimolecular binding reactions to obtain a good estimate of the apparent binding constant ((34) ; see also Fig. 6D). The apparent association constants determined for rhRPA, Delta442, and Delta327 binding to oligo(dT) are shown in Table 4. The affinity for oligo(dT) of Delta442 was only 4-fold lower than that of rhRPA complex, while the affinity of Delta327 was 60-fold lower than of rhRPA complex.



Binding of Delta442 and Delta327 to oligo(dT) and oligo(dT) was also examined. When oligo(dT) was titrated with rhRPA, only a single band with reduced mobility was observed when up to 490 fmol of rhRPA was added (data not shown; see also (31) ). In contrast, two bands with reduced mobility were observed in a similar titration of oligo(dT) with Delta442 (data not shown). Titration of oligo(dT) with Delta327 resulted in a single band of lowered mobility (data not shown). When binding to oligo(dT) was examined, a single complex with lowered mobility was observed with all three proteins (data not shown). The complexes formed by Delta442 were exactly as predicted by its binding site of 21 nucleotides; the maximum number of molecules of Delta442 bound to oligo(dT), oligo(dT), and oligo(dT) were 3, 2, and 1, respectively. The binding site of Delta327 is slightly smaller than Delta442 but no higher order complexes were found with either oligo(dT) or oligo(dT). We believe that the explanation for this observation is that Delta327 has a binding affinity significantly lower than either rhRPA or Delta442 (see below) and that concentrations of Delta327 higher than were used in these assays were needed to saturate the oligonucleotides used.

All of the binding titrations of oligo(dT) and oligo(dT) were quantitated and analyzed as describe above. The resolved binding constants are summarized in Table 4. While the affinity of Delta442 for oligo(dT) was approximately 4-fold less than rhRPA, the affinities for oligo(dT) and oligo(dT) were essentially identical to those of rhRPA complex. These results suggest all of the residues needed to interact with DNA are contained in this mutant and that the 32- and 14-kDa subunits of RPA do not contribute significantly to the binding of RPA to oligonucleotides. In contrast to Delta442, the smaller mutant, Delta327, was found to have a much lower affinity for oligo(dT) (Table 4). Thus, deletion of residues 327-441 resulted in at least a 10-fold decrease in the affinity for DNA. In spite of this decrease, the affinity of Delta327 for ssDNA is still high, indicating that residues 1-326 of RPA70 contain a core DNA binding domain.

SV40 Replication

It has been shown previously that neither isolated RPA70 (21) nor a subcomplex composed of the 32- and 14-kDa subunits (rhRPA32bullet14)(46) were individually able to support SV40 DNA replication. The very low solubility of full-length RPA70 has made it difficult to test whether a combination of RPA70 and the rhRPA32bullet14 subcomplex could support replication. The deletion mutants Delta442 and Delta327 are much more soluble than RPA70 and bind to ssDNA with high affinity; therefore, we tested whether either deletion mutant could substitute for RPA in an SV40 replication assay. A series of SV40 replication reactions were carried out in which all components, except rhRPA, were provided as either the purified proteins or partially purified fractions. DNA synthesis in these reactions was absolutely dependent upon both T-antigen and RPA (Fig. 7). When either Delta442 and Delta327 were added to replication reactions, no DNA synthesis was observed (Fig. 7, lanes3, 4, 9, and 10). Similar results were obtained in the presence of rhRPA32bullet14 subcomplex (Fig. 7, lanes8 and 14). Mixing experiments were also carried out in which rhRPA and either Delta442 or Delta327 were added to the same reaction. Neither deletion mutants inhibited replication even when present at a 5-fold or 10-fold molar excess (Fig. 7, lanes5-7 and 11-13). We conclude that Delta442 and Delta327 were neither able to support nor inhibit SV40 replication. Also, all three subunits of RPA are required for SV40 replication.


Figure 7: Activity of Delta442 and Delta327 in SV40 replication. SV40 replication assays were carried out as described previously, and the products were analyzed by electrophoresis on 1% agarose gels followed by autoradiography(46) . Cellular proteins necessary for SV40 replication were supplied as partially purified protein fractions. Each reconstituted replication reaction contained 20 µg of cellular fraction II (contains DNA polymerases alpha and and replication factor C), 5.6 µg of fraction cellular fraction IBC (contains proliferating nuclear cell antigen and protein phosphatase 2A)(46, 56) , 0.7 µg of purified SV40 T antigen, 1.5 units of topoisomerase I (Promega Corp.), and indicated amounts of rhRPA, rhRPA32bullet14, Delta442, and Delta327. Plasmid pUC.HSO(17) , which contains the SV40 origin of replication, was used as the template for these reactions.




DISCUSSION

RPA70 has multiple functions; it has intrinsic ssDNA binding activity, and it interacts directly with the other two RPA subunits, DNA polymerase alphabulletprimase complex and several transcriptional activators. The goal of these studies was to map the functional domains of the 70-kDa subunit of RPA. A series of C-terminal deletion mutants were constructed and characterized. A schematic showing the deletions constructed is shown in Fig. 1. This figure also summarizes the properties of the individual mutants. Initial characterization indicated that the solubility of individual mutants varied significantly. Full-length RPA70 and Delta507 were both highly insoluble, while all of the smaller mutants were soluble. Deletion of the C terminus also resulted in polypeptides that were unable to form a stable complex with the 32- and 14-kDa subunits, suggesting that the C terminus of RPA70 is important for heterotrimeric complex formation. The low solubility of the full-length subunit suggests interactions between the C terminus and the 32- and 14-kDa subunits are primarily hydrophobic (Fig. 1). This hypothesis is supported by an examination of the amino acid sequence of RPA70; the residues between 440 and 616 have predominantly hydrophobic character on a Kyte-Doolittle hydrophobicity plot (data not shown). Such hydrophobic interactions would also be consistent with the high stability of the heterotrimeric RPA complex (12, 13) and the proposal that RPA has an ordered assembly pathway in which RPA70 must interact with a subcomplex of the 32- and 14-kDa subunits(46) .

All of the deletion mutants were tested for DNA binding activity. These experiments indicated that all of the deletion mutants except for Delta169 were capable of binding to ssDNA (Fig. 3). Two soluble deletion mutants, Delta442 and Delta327, were purified, and their DNA binding properties were examined quantitatively in gel mobility shift assays. The binding constants obtained (Table 4) indicated that both deletion mutants bound ssDNA with high affinity. The apparent association constants determined for Delta442 are nearly identical to those of rhRPA complex. We conclude that the Delta442 contains the entire DNA-binding domain of RPA and that the 32- and 14-kDa subunits of RPA do not affect the binding of RPA to oligonucleotides (see also the discussion of cooperativity below). Delta327 bound DNA with an affinity approximately 10-fold lower than rhRPA. The finding that Delta169 did not interact with ssDNA in Southwestern blots indicated that residues between 169 and 326 are essential for DNA interaction. We conclude that the DNA binding domain of RPA is between residues 1 and 441 and that there is a core DNA-binding domain contained between residues 1 and 326 (Fig. 1). The N-terminal boundary of the DNA binding domain is not well defined, but proteolytic mapping studies of RPA indicate that a 17-kDa polypeptide from the N-terminus is not necessary for DNA binding activity.^2

The binding site size of Delta442 and Delta327 were both approximately 20 nucleotides. This is significantly smaller than the 30-nucleotide binding site size of the RPA complex. The decrease is consistent with their smaller size and monomeric state in solution. The finding that there is little difference in the binding affinity between Delta442 and RPA suggests that part of the 30-nucleotide binding site of RPA is the result of steric occlusion by either the C-terminal residues of RPA70 or the 32- and 14-kDa subunits.

Delta442 bound to oligo(dT) and oligo(dT) with association constants equivalent to those of rhRPA complex, yet it bound to oligo(dT) with an association constant one-quarter of that of rhRPA (Table 4). One possible explanation for this difference is that Delta442 binds to DNA with reduced cooperativity. The stoichiometry of binding for Delta442 to oligo(dT), oligo(dT), and oligo(dT) is 1:1, 2:1, and 3:1, respectively, while the stoichiometry of rhRPA to these oligonucleotides is 1:1, 1:1, and 2:1, respectively. Thus cooperative interactions would be expected for Delta442 binding to oligo(dT) and for both Delta442 and rhRPA binding to oligo(dT). We have shown previously that under the conditions used in these studies, rhRPA binds to ssDNA with a low but measurable level of cooperativity ( = 10-20)(35) . This level of cooperativity causes the association constant of rhRPA for oligo(dT) to be 10-fold higher than that for oligo(dT) (Table 4). If Delta442 had the same cooperativity of binding as rhRPA, then the association constant for oligo(dT) should have been 10 greater than that of oligo (dT), and the association constant for oligo(dT) should have been similar to that of rhRPA. This was not observed. These data are consistent with Delta442 having significantly less cooperativity in binding than rhRPA and would suggest that either the C terminus of RPA70 or the 32- and 14-kDa subunits are responsible for cooperativity of RPA binding to DNA.

Human RPA70 contains a putative C(4)-type zinc-finger motif at positions 481-503(21) . This sequence has been found to be conserved in all RPA70 homologue genes whose sequences are known(38, 42, 47) . Delta442 does not contain this motif, yet it binds oligonucleotides with an affinity similar to that of rhRPA complex. We conclude that the putative zinc-finger is not necessary for DNA binding activity. The single-stranded DNA binding protein from bacteriophage T4, gene 32 protein, has a zinc metal binding site. Inactivation of this metal binding region reduces the binding affinity for long single-stranded DNA due to a reduction in the cooperativity of binding (61) . Our data imply that Delta442 binds with reduced cooperativity. Thus, it remains possible that the C(4)-type zinc-finger motif could have a role in cooperative binding of RPA.

The purified C-terminal deletion mutants of RPA70 were also tested for the ability to support SV40 DNA replication. Neither Delta442 nor Delta327 were able to support SV40 replication when added alone or in combination with a complex of the 32- and 14-kDa subunits of RPA. This suggests that the ability to bind DNA is not sufficient for DNA replication and confirms that a heterotrimeric RPA complex is necessary to support DNA replication. We also found that neither mutant inhibited replication when mixed with rhRPA, even when present at a 10-fold molar excess. Since Delta442 binds DNA with an affinity close to that of rhRPA, 10-fold excess should have been sufficient to preferentially bind to most of the ssDNA in the replication reaction; however, replication still occurred. These results suggest several possible models for the function of RPA in DNA replication. One explanation for the lack of inhibition by Delta442 is that although it binds to oligonucleotides with high affinity, its binding properties of are different enough to prevent it from competing effectively with rhRPA complex. Alternatively, specific protein-protein interactions may be needed to load RPA onto ssDNA during the initiation or elongation stages of replication. If these interactions were absent or weak with Delta442, it would not compete with RPA during replication. Thus, although both RPA-protein and RPA-DNA interactions are essential for DNA replication, it is not known whether both types of interactions are needed simultaneously, sequentially, or independently. The absence of inhibition of Delta442 suggests that ssDNA binding is not a prerequisite for required RPA-protein interactions. Additional characterization of the interactions between RPA and other replication proteins and RPA and DNA will be needed to distinguish between these models of RPA function.


FOOTNOTES

*
This work was supported by Public Health Service Grant GM44721 from the General Medicine Institute. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed. Dept. of Biochemistry, University of Iowa School of Medicine, 51 Newton Rd., Iowa City, IA 52242-1109. Tel.: 319-335-6784; Fax: 319-335-9570; marc-wold{at}uiowa.edu.

(^1)
The abbreviations used are: RPA, replication protein A; hRPA, human RPA; rhRPA, recombinant human RPA; ssDNA, single-stranded DNA; PCR, polymerase chain reaction; RPA70, RPA 70-kDa subunit; rhRPA32bullet14, complex of 32- and 14-kDa subunits of replication protein A.

(^2)
X. V. Gomes, L. A. Henricksen, and M. S. Wold, unpublished observations.


ACKNOWLEDGEMENTS

We thank S. S. Chung for carrying out initial PCR amplification and cloning of deletion mutants. We thank L. A. Henricksen for supplying purified recombinant human RPA and RPA 32bullet14 subcomplex and B. F. Paulus for HeLa cellular fractions. We thank B. Stillman and J. Hurwitz for monoclonal antibodies to RPA. We also thank Drs. C. Swenson and C. Kim for assistance with fluorescence experiments. We thank the members of the Wold laboratory for scientific discussions and critical reading of this manuscript. We thank the University of Iowa DNA Core Facility for oligonucleotide synthesis and DNA sequencing.


REFERENCES

  1. Challberg, M. D. & Kelly, T. J. (1989) Annu. Rev. Biochem. 58, 671-717 [CrossRef][Medline] [Order article via Infotrieve]
  2. Stillman, B. (1989) Annu. Rev. Cell Biol. 5, 197-245 [CrossRef]
  3. Hurwitz, J., Dean, F. B., Kwong, A. D. & Lee, S.-H. (1990) J. Biol. Chem. 265, 18043-18046 [Free Full Text]
  4. Borowiec, J. A., Dean, F. B., Bullock, P. A. & Hurwitz, J. (1990) Cell 60, 181-184 [CrossRef][Medline] [Order article via Infotrieve]
  5. Melendy, T. & Stillman, B. (1992) in Nucleic Acids and Molecular Biology (Echstein, F., and Lilly, D. M. J., eds) pp. 129-158, Springer-Verlag, Berlin
  6. Ishimi, Y., Claude, A., Bullock, P. & Hurwitz, J. (1988) J. Biol. Chem. 263, 19723-19733 [Abstract/Free Full Text]
  7. Weinberg, D. H., Collins, K. L., Simancek, P., Russo, A., Wold, M. S., Virshup, D. M. & Kelly, T. J. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 8692-8696 [Abstract/Free Full Text]
  8. Tsurimoto, T., Melendy, T. & Stillman, B. (1990) Nature 346, 534-539 [CrossRef][Medline] [Order article via Infotrieve]
  9. Murakami, Y., Eki, T. & Hurwitz, J. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 952-956 [Abstract/Free Full Text]
  10. Waga, S. & Stillman, B. (1994) Nature 369, 207-212 [CrossRef][Medline] [Order article via Infotrieve]
  11. Wobbe, C. R., Weissbach, L., Borowiec, J. A., Dean, F. B., Murakami, Y., Bullock, P. & Hurwitz, J. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 1834-1838 [Abstract/Free Full Text]
  12. Wold, M. S. & Kelly, T. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 2523-2527 [Abstract/Free Full Text]
  13. Fairman, M. P. & Stillman, B. (1988) EMBO J. 7, 1211-1218 [Medline] [Order article via Infotrieve]
  14. Kenny, M. K., Schlegel, U., Furneaux, H. & Hurwitz, J. (1990) J. Biol. Chem. 265, 7693-7700 [Abstract/Free Full Text]
  15. Collins, K. L. & Kelly, T. J. (1991) Mol. Cell. Biol. 11, 2108-2115 [Abstract/Free Full Text]
  16. Melendy, T. & Stillman, B. (1993) J. Biol. Chem. 268, 3389-3395 [Abstract/Free Full Text]
  17. Wold, M. S., Li, J. J. & Kelly, T. J. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 3643-3647 [Abstract/Free Full Text]
  18. Dornreiter, I., Erdile, L. F., Gilbert, I. U., von Winkler, D., Kelly, T. J. & Fanning, E. (1992) EMBO J. 11, 769-776 [Medline] [Order article via Infotrieve]
  19. Tsurimoto, T. & Stillman, B. (1989) EMBO J. 8, 3883-3889 [Medline] [Order article via Infotrieve]
  20. Lee, S.-H., Pan, Z.-Q., Kwong, A. D., Burgers, P. M. J. & Hurwitz, J. (1991) J. Biol. Chem. 266, 22707-22717 [Abstract/Free Full Text]
  21. Erdile, L. F., Heyer, W.-D., Kolodner, R. & Kelly, T. J. (1991) J. Biol. Chem. 266, 12090-12098 [Abstract/Free Full Text]
  22. Seo, Y.-S., Lee, S.-H. & Hurwitz, J. (1991) J. Biol. Chem. 266, 13161-13170 [Abstract/Free Full Text]
  23. Thömmes, P., Ferrari, E., Jessberger, R. & Hübscher, U. (1992) J. Biol. Chem. 267, 6063-6073 [Abstract/Free Full Text]
  24. Coverley, D., Kenny, M. K., Lane, D. P. & Wood, R. D. (1992) Nucleic Acids Res. 20, 3873-3880 [Abstract/Free Full Text]
  25. Heyer, W.-D., Rao, M. R. S., Erdile, L. F., Kelly, T. J. & Kolodner, R. D. (1990) EMBO J. 9, 2321-2329 [Medline] [Order article via Infotrieve]
  26. Moore, S. P., Erdile, L., Kelly, T. & Fishel, R. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 9067-9071 [Abstract/Free Full Text]
  27. Georgaki, A., Strack, B., Podust, V. & Hübscher, U. (1992) FEBS Lett. 308, 240-244 [CrossRef][Medline] [Order article via Infotrieve]
  28. He, Z., Brinton, B. T., Greenblatt, J., Hassell, J. A. & Ingles, C. J. (1993) Cell 73, 1223-1232 [CrossRef][Medline] [Order article via Infotrieve]
  29. Li, R. & Botchan, M. R. (1993) Cell 73, 1207-1221 [CrossRef][Medline] [Order article via Infotrieve]
  30. Dutta, A., Ruppert, J. M., Aster, J. C. & Winchester, E. (1993) Nature 365, 79-82 [CrossRef][Medline] [Order article via Infotrieve]
  31. Kim, C., Snyder, R. O. & Wold, M. S. (1992) Mol. Cell. Biol. 12, 3050-3059 [Abstract/Free Full Text]
  32. Alani, E., Thresher, R., Griffith, J. D. & Kolodner, R. D. (1992) J. Mol. Biol. 227, 54-71 [CrossRef][Medline] [Order article via Infotrieve]
  33. Mitsis, P. G., Kowalczykowski, S. C. & Lehman, I. R. (1993) Biochemistry 32, 5257-5266 [CrossRef][Medline] [Order article via Infotrieve]
  34. Kim, C., Paulus, B. F. & Wold, M. S. (1994) Biochemistry 33, 14197-14206 [CrossRef][Medline] [Order article via Infotrieve]
  35. Kim, C. & Wold, M. S. (1995) Biochemistry , in press
  36. Korn, D., Fisher, P. A., Battey, J. & Wang, T. S. (1979) Cold Spring Harbor Symp. Quant. Biol. 43, 613-624
  37. Atrazhev, A., Zhang, S. & Grosse, F. (1992) Eur. J. Biochem. 210, 855-865 [Medline] [Order article via Infotrieve]
  38. Adachi, Y. & Laemmli, U. K. (1992) J. Cell Biol. 119, 1-15 [Abstract/Free Full Text]
  39. Brill, S. J. & Stillman, B. (1989) Nature 342, 92-95 [CrossRef][Medline] [Order article via Infotrieve]
  40. Brown, G. W., Melendy, T. E. & Ray, D. S. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 10227-10231 [Abstract/Free Full Text]
  41. Nakagawa, M., Tsukada, S., Soma, T., Shimuzu, Y., Miyake, S., Iwamatsu, A. & Sugiyama, H. (1991) Nucleic Acids Res. 19, 4292 [Free Full Text]
  42. Brown, G. W., Hines, J. C., Fisher, P. & Ray, D. S. (1994) Mol. Biochem. Parasitol. 63, 135-142 [CrossRef][Medline] [Order article via Infotrieve]
  43. Kamakaka, R. T., Kaufman, P. D., Stillman, B., Mitsis, P. G. & Kadonaga, J. T. (1994) Mol. Cell. Biol. 14, 5114-5122 [Abstract/Free Full Text]
  44. Erdile, L. F., Wold, M. S. & Kelly, T. J. (1990) J. Biol. Chem. 265, 3177-3182 [Abstract/Free Full Text]
  45. Umbricht, C. B., Erdile, L. F., Jabs, E. W. & Kelly, T. J. (1993) J. Biol. Chem. 268, 6131-6138 [Abstract/Free Full Text]
  46. Henricksen, L. A., Umbricht, C. B. & Wold, M. S. (1994) J. Biol. Chem. 269, 11121-11132 [Abstract/Free Full Text]
  47. Brill, S. J. & Stillman, B. (1991) Genes & Dev. 5, 1589-1600
  48. Stigger, E., Dean, F. B., Hurwitz, J. & Lee, S.-H. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 579-583 [Abstract/Free Full Text]
  49. Din, S.-U., Brill, S. J., Fairman, M. P. & Stillman, B. (1990) Genes & Dev. 4, 968-977
  50. Dutta, A. & Stillman, B. (1992) EMBO J. 11, 2189-2199 [Medline] [Order article via Infotrieve]
  51. Fotedar, R. & Roberts, J. M. (1992) EMBO J. 11, 2177-2187 [Medline] [Order article via Infotrieve]
  52. Liu, V. F. & Weaver, D. T. (1993) Mol. Cell. Biol. 13, 7222-7231 [Abstract/Free Full Text]
  53. Carty, M. P., Zernik-Kobak, M., McGrath, S. & Dixon, K. (1994) EMBO J. 13, 2114-2123 [Medline] [Order article via Infotrieve]
  54. Fang, F. & Newport, J. W. (1993) J. Cell Sci. 106, 983-994 [Abstract]
  55. Henricksen, L. A. & Wold, M. S. (1994) J. Biol. Chem. 269, 24203-24208 [Abstract/Free Full Text]
  56. Wold, M. S., Weinberg, D. H., Virshup, D. M., Li, J. J. & Kelly, T. J. (1989) J. Biol. Chem. 264, 2801-2809 [Abstract/Free Full Text]
  57. Studier, F. W., Rosenberg, A. H., Dunn, J. J. & Dubendorff, J. W. (1990) Methods Enzymol. 185, 60-89 [Medline] [Order article via Infotrieve]
  58. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York
  59. Laemmli, U. K. (1970) Nature 227, 680-685 [CrossRef][Medline] [Order article via Infotrieve]
  60. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254 [CrossRef][Medline] [Order article via Infotrieve]
  61. Villemain, J. L. & Giedroc, D. P. (1993) Biochemistry 32, 11235-11246 [CrossRef][Medline] [Order article via Infotrieve]
  62. Siegal, L. M. & Monty, K. J. (1966) Biochim. Biophys. Acta 112, 346-362 [Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
T. R. Salas, I. Petruseva, O. Lavrik, and C. Saintome
Evidence for direct contact between the RPA3 subunit of the human replication protein A and single-stranded DNA
Nucleic Acids Res., January 1, 2009; 37(1): 38 - 46.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. J. Haring, A. C. Mason, S. K. Binz, and M. S. Wold
Cellular Functions of Human RPA1: MULTIPLE ROLES OF DOMAINS IN REPLICATION, REPAIR, AND CHECKPOINTS
J. Biol. Chem., July 4, 2008; 283(27): 19095 - 19111.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
T. Ishibashi, S. Kimura, and K. Sakaguchi
A Higher Plant Has Three Different Types of RPA Heterotrimeric Complex
J. Biochem., January 1, 2006; 139(1): 99 - 104.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
Y. Lin, J. B. Robbins, E. K. D. Nyannor, Y.-H. Chen, and I. K. O. Cann
A CCCH Zinc Finger Conserved in a Replication Protein A Homolog Found in Diverse Euryarchaeotes
J. Bacteriol., December 1, 2005; 187(23): 7881 - 7889.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. M. Doherty, J. A. Sommers, M. D. Gray, J. W. Lee, C. von Kobbe, N. H. Thoma, R. P. Kureekattil, M. K. Kenny, and R. M. Brosh Jr.
Physical and Functional Mapping of the Replication Protein A Interaction Domain of the Werner and Bloom Syndrome Helicases
J. Biol. Chem., August 19, 2005; 280(33): 29494 - 29505.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
P. D. Vise, B. Baral, A. J. Latos, and G. W. Daughdrill
NMR chemical shift and relaxation measurements provide evidence for the coupled folding and binding of the p53 transactivation domain
Nucleic Acids Res., April 11, 2005; 33(7): 2061 - 2077.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y.-M. Loo and T. Melendy
Recruitment of Replication Protein A by the Papillomavirus E1 Protein and Modulation by Single-Stranded DNA
J. Virol., February 15, 2004; 78(4): 1605 - 1615.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. K. Binz, Y. Lao, D. F. Lowry, and M. S. Wold
The Phosphorylation Domain of the 32-kDa Subunit of Replication Protein A (RPA) Modulates RPA-DNA Interactions: EVIDENCE FOR AN INTERSUBUNIT INTERACTION
J. Biol. Chem., September 12, 2003; 278(37): 35584 - 35591.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Kantake, T. Sugiyama, R. D. Kolodner, and S. C. Kowalczykowski
The Recombination-deficient Mutant RPA (rfa1-t11) Is Displaced Slowly from Single-stranded DNA by Rad51 Protein
J. Biol. Chem., June 20, 2003; 278(26): 23410 - 23417.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
S. Dabrowski, M. Olszewski, R. Piatek, A. Brillowska-Dabrowska, G. Konopa, and J. Kur
Identification and characterization of single-stranded-DNA-binding proteins from Thermus thermophilus and Thermus aquaticus - new arrangement of binding domains
Microbiology, October 1, 2002; 148(10): 3307 - 3315.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
D. M. Kolpashchikov, S. N. Khodyreva, D. Yu. Khlimankov, M. S. Wold, A. Favre, and O. I. Lavrik
Polarity of human replication protein A binding to DNA
Nucleic Acids Res., January 15, 2001; 29(2): 373 - 379.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. Wang, J.-S. Park, M. Ishiai, J. Hurwitz, and S.-H. Lee
Species specificity of human RPA in simian virus 40 DNA replication lies in T-antigen-dependent RNA primer synthesis
Nucleic Acids Res., December 1, 2000; 28(23): 4742 - 4749.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-S. Park, M. Wang, S.-J. Park, and S.-H. Lee
Zinc Finger of Replication Protein A, a Non-DNA Binding Element, Regulates Its DNA Binding Activity through Redox
J. Biol. Chem., October 8, 1999; 274(41): 29075 - 29080.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y. Han, Y.-M. Loo, K. T. Militello, and T. Melendy
Interactions of the Papovavirus DNA Replication Initiator Proteins, Bovine Papillomavirus Type 1 E1 and Simian Virus 40 Large T Antigen, with Human Replication Protein A
J. Virol., June 1, 1999; 73(6): 4899 - 4907.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. J. Kelly, P. Simancek, and G. S. Brush
Identification and characterization of a single-stranded DNA-binding protein from the archaeon Methanococcus jannaschii
PNAS, December 8, 1998; 95(25): 14634 - 14639.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. Weisshart, P. Taneja, and E. Fanning
The Replication Protein A Binding Site in Simian Virus 40 (SV40) T Antigen and Its Role in the Initial Steps of SV40 DNA Replication
J. Virol., December 1, 1998; 72(12): 9771 - 9781.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. J. Brill and S. Bastin-Shanower
Identification and Characterization of the Fourth Single-Stranded-DNA Binding Domain of Replication Protein A
Mol. Cell. Biol., December 1, 1998; 18(12): 7225 - 7234.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
G. Mass, T. Nethanel, and G. Kaufmann
The Middle Subunit of Replication Protein A Contacts Growing RNA-DNA Primers in Replicating Simian Virus 40 Chromosomes
Mol. Cell. Biol., November 1, 1998; 18(11): 6399 - 6407.
[Abstract] [Full Text]


Home page
GeneticsHome page
K. Umezu, N. Sugawara, C. Chen, J. E. Haber, and R. D. Kolodner
Genetic Analysis of Yeast RPA1 Reveals Its Multiple Functions in DNA Metabolism
Genetics, March 1, 1998; 148(3): 989 - 1005.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Bochkareva, L. Frappier, A. M. Edwards, and A. Bochkarev
The RPA32 Subunit of Human Replication Protein A Contains a Single-stranded DNA-binding Domain
J. Biol. Chem., February 13, 1998; 273(7): 3932 - 3936.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. van der Knaap, S. Jagoueix, and H. Kende
Expression of an ortholog of replication protein A1 (RPA1) is induced by gibberellin in deepwater rice
PNAS, September 2, 1997; 94(18): 9979 - 9983.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. A. Pfuetzner, A. Bochkarev, L. Frappier, and A. M. Edwards
Replication Protein A. CHARACTERIZATION AND CRYSTALLIZATION OF THE DNA BINDING DOMAIN
J. Biol. Chem., January 3, 1997; 272(1): 430 - 434.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Ishiai, J. P. Sanchez, A. A. Amin, Y. Murakami, and J. Hurwitz
Purification, Gene Cloning, and Reconstitution of the Heterotrimeric Single-stranded DNA-binding Protein from Schizosaccharomyces pombe
J. Biol. Chem., August 23, 1996; 271(34): 20868 - 20878.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-L. Lin, C. Chen, K. F. Keshav, E. Winchester, and A. Dutta
Dissection of Functional Domains of the Human DNA Replication Protein Complex Replication Protein A
J. Biol. Chem., July 19, 1996; 271(29): 17190 - 17198.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D.-K. Kim, E. Stigger, and S.-H. Lee
Role of the 70-kDa Subunit of Human Replication Protein A (I). SINGLE-STRANDED DNA BINDING ACTIVITY, BUT NOT POLYMERASE STIMULATORY ACTIVITY, IS REQUIRED FOR DNA REPLICATION
J. Biol. Chem., June 21, 1996; 271(25): 15124 - 15129.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. L. Burns, S. N. Guzder, P. Sung, S. Prakash, and L. Prakash
An Affinity of Human Replication Protein A for Ultraviolet-damaged DNA
J. Biol. Chem., May 17, 1996; 271(20): 11607 - 11610.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Bochkareva, S. Korolev, and A. Bochkarev
The Role for Zinc in Replication Protein A
J. Biol. Chem., August 25, 2000; 275(35): 27332 - 27338.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Komori and Y. Ishino
Replication Protein A in Pyrococcus furiosus Is Involved in Homologous DNA Recombination
J. Biol. Chem., July 6, 2001; 276(28): 25654 - 25660.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. A. Bastin-Shanower and S. J. Brill
Functional Analysis of the Four DNA Binding Domains of Replication Protein A. THE ROLE OF RPA2 IN ssDNA BINDING
J. Biol. Chem., September 21, 2001; 276(39): 36446 - 36453.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gomes, X. V.
Right arrow Articles by Wold, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gomes, X. V.
Right arrow Articles by Wold, M. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement