|
Volume 270,
Number 9,
Issue of March 3, 1995 pp. 4534-4543
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Structural
Analysis of Human Replication Protein A
MAPPING FUNCTIONAL DOMAINS OF THE 70-kDa SUBUNIT (*)
(Received for publication, September 28,
1994; and in revised form, December 21, 1994)
Xavier V.
Gomes,
Marc
S.
Wold (§)
From the Department of Biochemistry, University of Iowa School
of Medicine, Iowa City, Iowa 52242-1109
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
Replication protein A (RPA) is a heterotrimeric single-stranded
DNA-binding protein that is essential for DNA metabolism. Human RPA is
composed of subunits of 70, 32, and 14 kDa with intrinsic DNA-binding
activity localized to the 616-amino acid, 70-kDa subunit (RPA70). We
have made a series of C-terminal deletions to map the functional
domains of RPA70. Deletion of the C terminus resulted in polypeptides
that were significantly more soluble than RPA70 but were unable to form
stable complexes with the other two subunits of RPA. These data suggest
that the C-terminal region of RPA70 may be important for complex
formation. The DNA-binding domain was localized to a region of RPA70
between residues 1 and 441. A mutant containing residues 1-441
bound oligonucleotides with an intrinsic affinity close to wild-type
RPA complex. This mutant also appeared to bind with reduced
cooperativity. We conclude that the C terminus of RPA70 and the 32- and
14-kDa subunits are not involved directly with interactions with DNA
but may have a role in cooperativity of RPA binding. RPA70 deletion
mutants were not able to support DNA replication even in the presence
of a complex of the 32- and 14-kDa subunits, suggesting that the
heterotrimeric complex is essential for DNA replication. The putative
zinc finger in the C terminus of RPA70 is not required for
single-stranded DNA-binding activity.
INTRODUCTION
DNA replication in eukaryotic cells is a complex process
requiring the coordinated action of multiple proteins to carry out the
regulated synthesis of chromosomal DNA. Because of this complexity,
viral model systems like the papova virus SV40 have been essential for
studying the molecular mechanism of chromosomal DNA replication (for
recent reviews, see (1, 2, 3, 4, 5) ). The SV40
genome codes for only a single replication protein, large T antigen;
all other replication proteins are supplied by the host cell. Using
this model system, a number of cellular proteins required for SV40 DNA
replication have been identified and their functions in DNA replication
partially
elucidated(6, 7, 8, 9, 10) . One of the proteins essential for DNA replication is the
multisubunit single-stranded DNA binding protein, replication protein A
(RPA, ( )also known as human SSB; (11, 12, 13) ). Studies using the in
vitro SV40 replication system have demonstrated that RPA has
multiple functions during DNA
replication(9, 14, 15, 16) . RPA is
required for both initiation and elongation phases of DNA replication.
Initiation of SV40 replication requires the concerted action of three
proteins: RPA, DNA polymerase  primase complex, and T
antigen(1, 2, 3, 4, 5, 17) .
T antigen first binds to the origin of replication and, in the presence
of RPA, catalyzes the localized unwinding of the origin. DNA polymerase
 primase complex interacts with the resulting nucleoprotein
complex and synthesizes RNA primers that lead to nascent DNA synthesis.
RPA specifically interacts with both T antigen and DNA polymerase
(18) . These specific protein-protein interactions have
been shown to be essential for priming by DNA polymerase
 primase complex on physiological templates and are required
for specific initiation of DNA replication (9, 15, 16) . RPA is also required for
elongation; RPA stimulates the activities of multiple enzymes that
function at the replication fork including DNA polymerases and DNA
helicases(14, 19, 20, 21, 22, 23) .
In addition to being essential for multiple stages of DNA replication,
RPA is involved in DNA repair and
recombination(24, 25, 26) . RPA from calf
thymus has also been shown to unwind single-stranded DNA (ssDNA) under
low salt conditions(27) . RPA interacts specifically with
several other proteins including the tumor suppressor p53 and several
transcriptional activators such as GAL4 and
VP16(28, 29, 30) . The functional importance
of these interactions is not known; however, it has been suggested that
these interactions could be important for coordinating DNA metabolism
with other cellular processes. RPA binds tightly to ssDNA (11, 12, 13) with an apparent binding
constant of approximately
10 (31, 32, 33, 34) .
Studies of the human RPA (hRPA) have shown that binding is dependent
upon both the sequence and length of the DNA being
bound(31, 34) . Human RPA binds to ssDNA with low
cooperativity (31, 34, 35) and has a binding
site size of 30 nucleotides with between 20 and 30 nucleotides of ssDNA
directly interacting with RPA(34) . hRPA may also have other
DNA binding modes. A recent chemical cross-linking study suggested that
under certain conditions hRPA may bind with a binding site size of
8-10 nucleotides (36) . The binding properties of hRPA
are similar to those of Drosophila melanogaster RPA and bovine
RPA(33, 37) . In contrast, the RPA homologue from Saccharomyces cerevisiae has been shown to bind to ssDNA with
high cooperativity and with a much larger binding site(32) .
While DNA binding seems to be essential for RPA function, it is not
known how variations in the interaction of RPA with DNA affect DNA
synthesis. Human RPA is a stable complex of three subunits of 70,
32, and 14 kDa (12, 13) and is highly conserved
throughout evolution. Homologous heterotrimeric single-stranded
DNA-binding proteins have been identified in all eukaryotes examined
including S. cerevisiae, Xenopus laevis, D.
melanogaster, and Crithidia
fasiculata(25, 27, 33, 37, 38, 39, 40, 41) .
Amino acid sequence comparison has shown that the homologues of RPA70
from S. cerevisiae, C. fasiculata, and X. laevis are 44, 58, and 90% similar, respectively, to human RPA70 (21, 38, 42) . All known RPA70 homologues
contain a conserved putative C -type zinc-finger motif in
the C-terminal third of the
protein(21, 38, 42) . However, in spite of
this high degree of homology, only some RPA homologues can substitute
for human RPA in SV40 DNA replication. RPA from mouse and Drosophila support specific SV40 initiation, while RPA from
yeast and trypanosomes RPA do
not(16, 39, 40, 43) , suggesting
that there are species-specific interactions essential for normal RPA
function. All experimental and genetic evidence to date suggests
that all three subunits of RPA are needed for function. Individual
subunits do not function in DNA
replication(14, 21, 44, 45, 46) ,
and, in S. cerevisiae, the genes encoding all three subunits
are essential for viability(25, 47) . Most antibodies
to RPA inhibit DNA replication even when they only interact
specifically with one subunit(14, 44) . The specific
functions of the three subunits of RPA are currently not well
understood. The 32- and 14-kDa subunits are capable of forming a
soluble complex together(46, 48) . This subcomplex is
unable to support DNA replication but may be essential for the proper
folding of the 70-kDa subunit and/or assembly of the RPA
complex(46) . The 32-kDa subunit of RPA also becomes
phosphorylated in a cell cycle-dependent manner(49) . It has
been suggested that the phosphorylation could be a regulatory event in
either DNA replication or DNA
repair(50, 51, 52, 53) ; however,
the specific role of phosphorylation of RPA is currently not
known(54, 55) . There is currently no specific role
attributed to the 14-kDa subunit except for a structural function in
RPA complex assembly (46) , although sequence comparisons have
been used to suggest that the 14-kDa subunit may be involved in
protein-protein interactions (45) . The 70-kDa subunit of
RPA has several distinct functions. The intrinsic DNA-binding activity
of RPA has been localized to the 70-kDa subunit (14, 56) . In addition, isolated RPA70 has been shown
to interact with DNA polymerase  primase complex and to
stimulate DNA polymerase activity(18, 21) .
RPA70 has also been shown to specifically interact with p53 and several
transcriptional activators (28, 29, 30) but
not with SV40 T antigen(18) . Biochemical analysis of the
functions of RPA70 have been hampered by the very low solubility of the
isolated subunit(21, 46) . The development of Escherichia coli plasmids capable of expressing recombinant
human RPA (rhRPA) (46) allowed us to generate and express a
series of C-terminal deletion mutants of RPA70. Characterization of
these mutants has resulted in an initial mapping of the functional
domains of RPA70. A small region at the C terminus of the 70-kDa
subunit seems to be important for the formation of the heterotrimeric
RPA complex. The DNA binding domain of RPA70 has been mapped to the
region between residues 1 and 441.
EXPERIMENTAL PROCEDURES
MaterialsRestriction endonucleases, T4 DNA
polymerase, and Klenow fragment were purchased from New England BioLabs
and Life Technologies, Inc. [ - P]ATP (4,500
Ci/mmol) and [ - P]dATP (3,000 Ci/mmol) were
obtained from ICN. Oligonucleotides were synthesized using an Applied
Biosystems DNA synthesizer model 380B at the DNA core facility at the
University of Iowa. E. coli DH5 was from Life
Technologies, Inc. E. coli expression strain BL21(DE3) was
from W. Studier (57) . Poly(dT) was purchased from Midland
certified reagents. rhRPA was purified as described
previously(46) . This recombinant complex has properties
similar to those of native RPA (46HI buffer contains 30
mM HEPES, pH 7.8, 1 mM dithiothreitol, 0.25 mM EDTA, 0.5% (w/v) inositol, and 0.01% (v/v) Nonidet P-40. HI was
supplemented with different concentrations of salt as indicated in the
text. 1 Tris acetate/EDTA (TAE) gel buffer contained 40 mM Tris acetate and 2 mM EDTA, pH 8.5(58) . pET
expression plasmids used were obtained from W. Studier and
co-workers(57) . RPA expression plasmids (p11d-tRPA and
p3d-RPA14/32) were described previously(46) .
DNA ManipulationRestriction endonucleases, T4 DNA
polymerase, and Klenow were used according to manufacturer's
recommendations. Oligonucleotides were radiolabeled with
[ - P]ATP using polynucleotide
kinase(58) . Polymerase chain reactions (PCR) were performed
with AmpliTaq (Perkin-Elmer) polymerase in a DNA thermal cycler
(Perkin-Elmer). DNA amplification conditions were 29 cycles of 94
°C for 1 min, 55 °C for 1 min, and 72 °C for 3 min. PCR
products and DNA fragments were isolated from 1% TAE agarose gels using
a Geneclean II kit (BIO 101, La Jolla, CA) according to
manufacture's specifications. Ligation reactions and
transformations were as according to Ausubel and
co-workers(58) . Recombinant plasmids were transformed into
strain E. coli DH5 and isolated by the boiling lysis
method(58) . DNA sequencing was performed using the
dideoxynucleotide method with Sequenase 2.0 (U. S. Biochemical Corp.)
as directed by the manufacturer and also using an Applied Biosystems
373A automatic DNA sequencer at the DNA core facility at the University
of Iowa.
Construction of RPA70 C-terminal Deletion
MutantsA series of C-terminal deletion mutants were generated
using PCR to amplify specific regions of the RPA70 cDNA (Table 1). The N-terminal primer
(5`GGAGGATCCCCATGGTCGGCC 3`) contained nucleotide base changes
(underlined) to generate a BamHI restriction site just prior
to the endogenous NcoI restriction site at the ATG initiation
codon. The C-terminal PCR primers used to generate the various
C-terminal deletion mutants were as follows: 5` TTGGGATCCTTAGGTGTCGCA
3` (RPA70 507-616); 5` CAAGGATCCTCAGTTGGTGTT 3`
(RPA70 442-616); 5` ACGGGATCCTCAAGAACCATC 3`
(RPA70 373-616); 5` AGTGGATCCTTAATAGCTCTT 3`
(RPA70 327-616); 5` CTTGGATCCTTAAATAAGAGG 3`
(RPA70 250-616); 5` GCTGGATCCTCAAGCTTTTCC 3`
(RPA70 169-616). The C-terminal PCR primers contained
nucleotide base changes (underlined) that generated a BamHI
restriction site and a terminator codon. The individual PCR products
were digested with BamHI and ligated to pUC19 also digested
with BamHI. The resulting plasmids were digested with BamHI and NcoI yielding a series of fragments
containing truncated RPA70 coding sequences. Each fragment was isolated
and ligated to the expression vector pET-11d digested with NcoI and BamHI resulting in a series of expression
vectors containing specific C-terminal deletions of the RPA70 gene (Table 1). Each plasmid contained a T7 promoter, a Shine-Dalgarno
ribosome binding site, and the coding sequence of a RPA70 deletion
mutant. DNA sequence analysis of each of the resulting vectors
confirmed that the initiator codon ATG was maintained.
Construction of Vectors Containing RPA32, RPA14, and
Mutant RPA70 GenesVectors capable of simultaneously expressing
RPA32, RPA14 and individual C-terminal deletion mutants of RPA70 in E. coli were constructed following the same procedure used to
generate p11d-tRPA, which co-expresses all three wild-type RPA subunits (46) . Briefly, p3d-RPA14/32 (46) was digested with XbaI and EspI restriction enzymes and treated with T4
DNA polymerase to generate a blunt ended 1.6-kilobase fragment
containing the coding sequences of both the 14- and 32-kDa subunits.
Individual pET-11d vectors containing a C-terminal deletion mutant of
RPA70 gene were digested with BamHI restriction enzyme,
treated with T4 DNA polymerase to generate blunt ends, and ligated to
the 1.6-kilobase fragment. The resulting expression vectors contain a
single T7 RNA polymerase promoter, and the coding sequences of the
mutated 70-, 32-, and 14-kDa subunits of RPA. Each coding sequence is
preceded by a Shine-Dalgarno ribosome binding site. The series of
plasmids constructed is summarized in Table 1.
Induction of the C-terminal Deletion Mutants of
RPA70The various C-terminal deletion mutants were expressed in
BL21(DE3) as described previously(46) . A single recombinant
colony was used to inoculate 1 liter of TB medium (10 g of
Bacto-tryptone, 5 g of NaCl) with 100 µg/ml ampicillin. The culture
was grown overnight at 37 °C without shaking and then placed on a
shaker at 37 °C until the OD = 0.6. The
culture was induced by adding
isopropyl-1-thio- -D-galactopyranoside to 0.4 mM.
After 2 h of induction, the cells were collected by centrifugation at
4,000 rpm for 20 min in a Beckman JS4.2 rotor and resuspended in 5 ml
of HI Buffer with 1 mM phenylmethylsulfonyl fluoride. The
resuspended cells were frozen at -80 °C, thawed, and lysed by
three passages through a French press. The lysate was centrifuged in a
Sorvall SS34 rotor at 12,000 rpm for 30 min at 4 °C to generate a
supernatant fraction containing soluble proteins and a pellet fraction
containing insoluble proteins and cell debris. The pellet, containing
cell debris and insoluble protein, was resuspended in 5 ml of HI Buffer
with five strokes of a Dounce homogenizer. The resulting fractions were
frozen in liquid nitrogen and stored at -80 °C. To determine
the proportion of induced protein present in the insoluble fraction,
the pellet fraction was solublized with 1% SDS, boiled for 5 min, and
spun at 10,000 g for 5 min to remove residual
insoluble material. Equal volumes of pellet and supernatant fractions
were then separated on 8-14% SDS-polyacrylamide gels (59) and analyzed by Coomassie staining or by immunoblot
analysis.Whole cell lysates were made by collecting cells by
centrifugation at 4,000 rpm for 20 min in a Beckman JS4.2 rotor. Cells
were then resuspended in one-tenth original volume with HI buffer with
1% SDS. 500 µl of suspended cells were transferred to a 1.5-ml
microcentrifuge tube, boiled for 10 min to lyse cells, and spun at
10,000 g for 5 min to remove cell debris.
ImmunoblottingProtein samples were separated on
8-14% SDS-polyacrylamide gels (59) and transferred to
nitrocellulose (Bio-Rad) using a PolyBlot electrotransfer system from
Millipore as per manufacturer's specifications. RPA subunits were
detected using monoclonal antibodies SSB70C (14) and RPA9
(B. Stillman, Cold Spring Harbor Laboratory). Secondary antibodies
(Sigma) used sheep anti-mouse horseradish peroxidase conjugate.
Secondary antibodies were detected using ECL chemiluminescence kit
(Amersham Corp.) as recommended by manufacturer.
Southwestern AnalysisSouthwestern analysis was
performed as described previously (56) using either the pellet
fractions or whole cell lysates from induced cultures. Approximately 20
µg of protein samples were separated on 8-14%
SDS-polyacrylamide gels (59) and transferred to nitrocellulose
(Bio-Rad) using a PolyBlot electrotransfer system from Millipore as per
manufacturer's specifications. The nitrocellulose blot was
blocked by incubating in phosphate-buffered saline (150 mM sodium chloride, 10 mM sodium phosphate, pH 7.05, 1
mM EDTA, 1 mM sodium azide) containing 4% (w/v)
bovine serum albumin and 0.2% (v/v) Triton X-100 for 30 min at 25
°C. The nitrocellulose blot was incubated with 3 pmol ( 3
10 cpm) of P-labeled oligo(dT) at 25 °C for 60 min, washed 3 times with phosphate-buffered
saline containing 0.2% Triton X-100 and analyzed by autoradiography.
Purification of 442 and 327Purification
of both mutants was carried out following the general procedure of
Henricksen et al.(46) . All steps were carried out at
4 °C. During the purification, the C-terminal deletion mutants were
monitored by Western blotting. Soluble lysate from 2 liters of an
induced culture was applied to a 20-ml (1.5 5.6 cm) Affi-Gel
blue (Bio-Rad) column equilibrated with HI buffer containing 50 mM KCl. The column was washed sequentially with 60 ml each of HI
buffer containing 50 mM KCl, 0.8 M KCl, 0.5 M NaSCN, or 1.5 M NaSCN. Like wild-type RPA, 442 and
327 eluted in the 1.5 M NaSCN wash. The peak of protein
from the 1.5 M NaSCN wash was applied directly to a 1.6-ml
hydroxylapatite column (1 10 cm) equilibrated with HI buffer.
The column was washed sequentially with 6 ml each of HI buffer
containing 0, 80, or 500 mM potassium phosphate; both mutants
bound to the column and eluted in HI buffer with 0 mM potassium phosphate. The fractions containing each deletion mutant
were applied to a Mono Q (HR5/5) column (Pharmicia Biotech Inc.)
equilibrated with HI buffer containing 14 mM KCl. The column
was washed with 4 ml of HI buffer containing 50 mM KCl and
then developed with a 10-ml linear salt gradient of 50-340 mM KCl; 442 and 327 eluted from the Mono Q column at 100
mM KCl. The purification of each RPA70 deletion mutant is
summarized in Table 2. Protein concentrations were determined by
Bradford assay using bovine serum albumin as a standard(60) .
Hydrodynamic CharacterizationThe Stokes radii of
442 and 327 were determined by gel permeation chromatography
as described previously(34) . The standards and samples were
brought to a final volume of 50-200 µl with HI buffer
containing 200 mM KCl and loaded onto a 24-ml Superose 6 HR
10/30 column (Pharmacia) equilibrated in HI buffer containing 200
mM KCl. The column was eluted at a flow rate of 0.4 ml/min,
and fractions were analyzed by SDS-polyacrylamide gel electrophoresis
followed by staining with silver.Sedimentation constants of
442 and 327 were determined by glycerol gradient
sedimentation as described previously(34) . Samples or
standards were brought to a final volume of 50-100 µl with HI
buffer containing 200 mM KCl and loaded onto a 5-ml
15-35% glycerol gradient in HI buffer containing 200 mM KCl. The gradients were centrifuged at 48,000 rpm in a Beckman
SW55 Ti rotor for 24 h at 4 °C. The gradients were fractionated
from the bottom of the tube using a gradient fractionator (Hoefer
Scientific Instruments). The fractions were analyzed by
SDS-polyacrylamide gel electrophoresis followed by silver staining.
Fluorescence StudiesFluorescence titrations were
carried out as described previously on an SLM 4800C spectrofluorimeter
with the following modifications(35) . The binding reactions
containing 50-100 nM RPA, 70 nM 441, or
100-350 nM 327 were incubated with DNA at 20 °C
in 1.8 ml of HI buffer containing 15 mM KCl. A slit width of 2
mm was used. The excitation wavelength was 292 nm, and emission was
monitored at 346 nm. Under these conditions, we observed less than 2%
photobleaching during a titration.
Gel Mobility Shift AssayGel mobility shift assays
were performed as described previously with slight
modifications(31) . 15-µl binding reactions were carried
out in HI buffer containing 15 mM KCl. The indicated amounts
of protein were incubated with 2 fmol of labeled oligonucleotide for 20
min at 25 °C. Binding reactions were brought to a final
concentration of 4% glycerol and 0.004% bromphenol blue and
electrophoresed on 1% agarose gel in 0.1% TAE at 100 V/cm for 1.5 h.
The gels were then dried on DE81 paper and radioactive bands were
localized by autoradiography.
RESULTS
Construction and Expression of RPA70 C-terminal
Deletion MutantsA series of C-terminal deletions were made in
order map the functional domains of the 70-kDa subunit of RPA. A set of
specific C-terminal primers was designed to replace individual RPA70
codons spaced throughout the coding region with termination codons. PCR
amplification of the wild-type RPA70 gene using one internal primer and
the N-terminal primer resulted in a series of C-terminal deletion
mutants of RPA70 that contained the wild-type RPA70 amino acid sequence
up to a single termination codon. After PCR amplification,
appropriately sized DNA fragments were cloned into pUC19. The resulting
plasmids were characterized by restriction analysis, and the mutant
RPA70 genes were excised and individually ligated into the pET-11d
expression vector. The set of RPA70 C-terminal deletion mutants
generated is summarized in Table 1and shown schematically in Fig. 1. Each mutant was named for the amino acids deleted; for
example RPA70 442-616 has amino acids 442-616 deleted.
In the discussion of these studies, each mutant will be abbreviated
using a designation indicating the first amino acid deleted. Thus
RPA70 442-616 will be referred to as 442.
Figure 1:
Schematic
of individual C-terminal deletion mutants and summary of properties.
The leftside of figure shows schematic of wild-type
RPA70 and the six deletion mutants ( 507, 442, 373,
327, 250, and 169). Thickbars indicate residues contained in each polypeptide. Ticks indicates positions every 100 amino acids, and the position of the
putative zinc finger motif is indicated by a solidbox (Zn?). Lines under schematic indicate predicted
location of functional domains. Righthand side
summarizes the properties of each mutant determined during these
studies: solubility (- denotes insoluble; + 25-50%
soluble; ++ >50% soluble) and complex formation and DNA
binding (-, no activity; +,
activity).
The
expression plasmids were tested for their ability to express mutant
RPA70. E. coli BL21(DE3) cells were transformed with
individual expression plasmids, grown and induced with
isopropyl-1-thio- -D-galactopyranoside. Lysates from
induced cell were analyzed by SDS-polyacrylamide gel electrophoresis
followed by staining with Coomassie Blue or immunoblot analysis. All
six expression plasmids generated polypeptides of the appropriate size
after induction (Fig. 2). Immunoblot analysis demonstrated that
all six polypeptides cross-reacted with antibodies to RPA70 (data not
shown, also see Fig. 4). The level of expression varied
consistently between the six mutants. 442, 373, and 327
were present in lysates from induced cells at 2-4-fold higher
levels than the other mutants.
Figure 2:
Expression of the various deletion mutants
of RPA70 in E. coli.E. coli BL21(DE3) cells were
transformed with either p11d-RPA70 (RPA70) or pET-11d vectors
containing the various mutated RPA70 genes ( 507, 442,
373, 327, 250, and 169; see Table 1). 10
µg of whole cell lysates from uninduced (U) or induced (I) cells were separated by electrophoresis on an 8-14%
SDS-polyacrylamide gel and visualized by Coomassie Blue staining. Arrows indicate the position of the induced wild-type RPA70
and the various deletion mutants of RPA70. The position of standards in
kDa are indicated.
Figure 4:
Solubility analysis of C-terminal deletion
mutants of RPA70. Equal volumes of the supernatant (S) or
pellet (P) fractions of full-length RPA70 and the various
deletion mutants ( 507, 442, 373, 327, 250, and
169) were separated on an 8-14% SDS-PAGE gel, transferred
onto nitrocellulose, and probed with monoclonal antibodies to RPA70.
The arrows indicate the position of RPA70 and the deletion
mutants of RPA70. The asterisk indicates the position of a
proteolytic fragment of RPA70 observed in multiple
lanes.
Initial Characterization of RPA70 C-terminal Deletion
MutantsThe intrinsic DNA-binding activity of RPA has been
localized to RPA70(14, 56) . We investigated which of
the deletion mutants of RPA70 were capable of binding ssDNA by carrying
out Southwestern analysis. In this technique proteins are separated on
an 8-14% SDS-polyacrylamide gel, transferred onto nitrocellulose,
and incubated with a radiolabeled ssDNA. DNA binding activity is
indicated by the association of the radioactive probe with specific
proteins. This technique allows the analysis of complex mixtures of
proteins and has the advantage that any protein that can be solublized
in SDS can be tested for DNA binding. When pellet fractions from
induced cultures containing individual C-terminal mutants were
examined, all of the mutants except 169 were capable of binding
DNA (Fig. 3). Similar results were obtained when whole cell
lysates containing the various C-terminal deletion mutants were
examined (data not shown). This method requires that a polypeptide that
has been denatured in SDS partially refold in order to bind to DNA.
Thus, while the intensity of the bands varied significantly, these
variations do not necessarily indicate differences in binding affinity;
they could also reflect differences in the efficiency of refolding. The
complete absence of binding to 169 indicates that deletion of
amino acids 169-249 removes residues necessary for either DNA
binding or protein folding.
Figure 3:
Southwestern analysis of the C-terminal
deletion mutants of RPA70. Approximately 20 µg of pellet fractions
from induced cultures containing p11d-RPA70 (RPA70) or pET-11d
containing mutant RPA70 ( 507, 442, 373, 327,
250, and 169; see Table 1) were separated on an
8-14% SDS-polyacrylamide gel and subjected to Southwestern
analysis as described under ``Experimental Procedures.'' Solidarrows indicate the position of the wild-type
RPA70 and the various deletion mutants of RPA70 that bound to DNA; openarrow indicates the position of 169. E.
coli proteins capable of binding ssDNA are indicated by the asterisks. India ink staining of nitrocellulose indicated that
all lanes contained equal amounts of RPA70 or RPA70 deletion proteins
(data not shown).
In addition to the full-length
C-terminal mutant proteins, other polypeptides able to bind ssDNA were
observed that were unique to individual lysates. For example, a
polypeptide of approximately 56 kDa was observed in the lane containing
wild-type RPA70 (Fig. 3, lane1). We believe
that these polypeptides are proteolytic fragments of individual RPA
deletion mutants that maintain ssDNA-binding activity. The sensitivity
of individual mutants to proteolysis by endogenous proteases varied
significantly (also see Fig. 4, below). In Fig. 3, major
bands of 72-, 18-, and 14-kDa were present in all lanes.
These polypeptides were due to endogenous E. coli ssDNA
binding proteins present in the lysates used in these experiments. We next examined the solubility properties of the C-terminal
deletion mutants of RPA70. Plasmids capable of directing the expression
of each mutant were transformed individually into E. coli BL21(DE3) cells. Individual transformants were induced with
isopropyl-1-thio- -D-galactopyranoside, lysed, and
separated into soluble (supernatant) and insoluble (pellet) fractions.
Equal amounts of pellet and supernatant fractions were separated on
8-14% SDS-polyacrylamide gels and analyzed by immunoblotting (Fig. 4). Full-length RPA70 has been shown previously to be
insoluble when expressed in E. coli with >90% of the
protein being found in the pellet fraction(21, 46) .
In contrast, we found that the solubility of this series of deletion
mutants varied significantly and could be divided into three classes
based upon solubility. Deletion mutant 507 was highly insoluble (Fig. 4, lanes3 and 4), deletions
373 and 250 were only partially soluble with less than 50% of
the expressed protein present in the soluble fraction (Fig. 4, lanes7, 8, 11, and 12),
and deletions 442, 327, and 169 were mostly soluble (Fig. 4, lanes5, 6, 9, 10, 13, and 14). Identical results were
obtained from gels stained with Coomassie Blue (data not shown). These
results suggest that residues between 442 and 616 play a critical
role in determining the solubility of RPA70. We also observed that the
monoclonal antibodies used in these studies reacted much better with
all of the deletion mutants than with full-length 70-kDa subunit; even
though equal amounts of proteins were loaded in each lane, the signal
from full-length RPA70 was very weak (Fig. 4, lanes1 and 2). This observation indicates that after
electrophoresis and transfer to nitrocellulose, full-length RPA70 has a
different conformation than the deletion mutants. This is consistent
with the C terminus of RPA70 being important in determining the
structure of the polypeptide. In these studies, we observed a number
of cross-reactive bands that resulted from proteolytic degradation (Fig. 4). The level of proteolysis and the specific proteolytic
fragments varied between individual mutants with the exception of an
18-kDa band that was observed with several different mutants (Fig. 4, lanes6, 8, 13, and 14). This fragment is derived from the from the N-terminal
region of RPA70. ( )
Interactions of the RPA70 Deletions Mutants
with the Other Subunits of RPAWhen RPA70 is expressed in the
presence of RPA32 and RPA14 in E. coli, a functional
heterotrimeric complex is formed (46) . A series of expression
plasmids were made that contained synthetic operons composed of the
coding sequences of an individual deletion mutant of RPA70 and the 32-
and 14-kDa subunits of RPA. These plasmids were used to examine whether
any of the RPA70 deletion mutants were able to form a stable complex
with the other RPA subunits. When cells containing individual
expression vectors were induced and lysed, we found that in all cases
the RPA70 deletion mutant and the 32- and 14-kDa subunits of RPA were
expressed (data not shown). Wild-type RPA70 becomes significantly more
soluble when expressed with RPA32 and RPA14 (46) . In contrast,
we observed no change in the solubility properties of any of the
deletion mutants when expressed with 32- and 14-kDa subunits (data not
shown). If a deletion mutant was capable of forming a stable complex
with RPA32 14, then all three subunits would be expected to
co-purify. Therefore, we fractionated lysates from induced cells
containing ptRPA 70 507-616,
ptRPA 70 442-616, and ptRPA 70 327-616.
Each lysate was fractionated over Affi-Gel blue and hydroxylapatite
columns following the procedure used to purify recombinant human
RPA(46) . Elution profiles of each subunit were determined by
Western blotting. In each case, the RPA70 deletion mutant eluted at
much higher salt concentration from Affi-Gel blue than the 32- and the
14-kDa subunits (data not shown). This suggested that none of these
RPA70 deletion mutants were capable of forming a stable complex with
the 32- and 14-kDa subunits. As has been observed
previously(46) , the 32- and 14-kDa subunits appeared to be
interacting to form a soluble complex in these experiments (data not
shown).
Purification of 442 and 327Several of
the deletion mutations were highly soluble when expressed in E.
coli and thus amenable to further characterization. Two of the
deletion mutants, 442 and 327, were selected for further
analysis based on their solubility properties and their ability to bind
to ssDNA. Both of these deletion mutants were purified following the
procedure used to purify rhRPA(46) . This three-column
purification takes advantage of the very high affinity of RPA for
Affi-gel Blue resin to purify RPA to near homogeneity. Hydroxylapatite
and Mono Q columns are then used to concentrate, desalt, and remove
trace contaminants. Both 442 and 327 had similar
chromatographic properties on Affi-Gel blue to those of the rhRPA
complex. However, both deletion mutants eluted at lower ionic strength
from hydroxylapatite and Mono Q column than rhRPA (see
``Experimental Procedures''). After purification over Mono Q,
both of the deletion mutants were purified to apparent homogeneity (Fig. 5).
Figure 5:
Purified C-terminal deletion mutants.
0.5-1 µg of purified rhRPA, 442, and 327 were
electrophoresed on an 8-14% SDS-polyacrylamide gel and visualized
by staining with silver. Arrows indicate the position of the
three subunits of RPA (RPA70, RPA32, and RPA14) and the two deletion mutants ( 442 and 327). The positions of molecular weight standards in kDa
are indicated.
The deletion mutants 442 and 327 have
30 and 50% of their amino acid residues deleted,
respectively. Such large deletions could have a large effect on the
folding of these proteins. We have shown that both proteins were
soluble bound DNA and could be purified following a procedure similar
to that of rhRPA. This suggested that these deletion mutants had a
structure that was related to the structure of RPA70 in the rhRPA
complex. However, to define the solution structure of both mutants more
precisely, purified 327 and 442 were subjected to glycerol
gradient sedimentation and gel permeation chromatography, and their
sedimentation constants and Stokes radii were determined (Table 3). These values were used to calculate the molecular
weight of both deletion mutants in solution (Table 3). The
calculated molecular weights for both 327 and 442 were very
close to the value predicted by their amino acid sequences. We conclude
that both 327 and 442 exist as a monomers in solution. The
frictional coefficient calculated for both mutants were close to 1.6 (Table 3). Assuming that both mutants are shaped like prolate
spheroids, the axial ratio for 327 and 442 would be predicted
to be approximately 12:1 and 10:1, respectively. These values are
similar to that of the rhRPA complex, which has a frictional
coefficient of 1.60 and a predicted axial ratio of 12:1. These
hydrodynamic data suggest that while 327 and 442 are smaller,
both have a general shape similar to heterotrimeric RPA complex.
DNA Binding Properties of 442 and 327We
next characterized the interactions of the purified 442 and
327 with ssDNA. It has been shown previously that interaction of
RPA with ssDNA causes a decrease in the intrinsic fluorescence of
RPA(34, 35) . Both 442 and 327 were found to
have intrinsic fluorescence signals that decreased when the mutants
were titrated with increasing amounts of ssDNA (data not shown). This
decrease in fluorescence in the presence of ssDNA was found to be
reversible; addition of high concentrations of NaCl caused the original
fluorescence signal of both 442 and 327 to be restored (data
not shown). These properties suggest that the DNA-induced changes in
fluorescence are a direct result of protein DNA interactions and,
thus, can be used to examine DNA binding parameters of these mutant
proteins.We have shown previously that binding of RPA to
oligodeoxythymidine 30 nucleotides in length (oligo(dT) )
is a simple bimolecular reaction(34) , and the RPA
concentrations needed to obtain an observable fluorescence signal are
high enough (50-100 nM) to cause stoichiometric
binding(34, 35) . 442 and 327 both bind
oligo(dT) with stoichiometry of 1:1 (see below). Each
mutant was titrated with oligo(dT) , and changes in
fluorescence were monitored (data not shown). In a stoichiometric
titration of a bimolecular binding reaction, the moles of
oligo(dT) necessary to reach saturation (i.e. give the maximum decrease in fluorescence signal) should equal the
moles of protein capable of binding DNA. Comparing the amount of active
protein to the total protein present for titrations of 442 and
327 with oligo (dT) indicated that the mutants were
35 and 62% active, respectively (Table 3). These values were
similar to those obtained previously for both native and recombinant
RPA complexes (34, 35) . We also determined the
binding site size of 442 and 327 in a second series of
stoichiometric titrations using poly(dT) 3,000 nucleotides in length.
Saturation of such a long DNA fragment occurs when the protein coats
the DNA and thus, when a protein is titrated with poly(dT), the ratio
of moles of nucleotide/active protein at saturation corresponds to the
binding site size of the protein. Such titrations indicated that the
binding site sizes of 442 and 327 were 21 and 18
nucleotides, respectively (Table 3). These results indicate that
both 442 and 327 are only partially active and both have
smaller binding site sizes than rhRPA (Table 3). Equilibrium
binding of 442 and 327 to oligonucleotides was examined in
gel mobility shift assays. In these assays, short oligonucleotides were
incubated with increasing concentrations of protein, and the resulting
complexes were analyzed on agarose gels. RPA oligonucleotide
complexes are stable to separation by electrophoresis and migrate with
altered mobility(31) . Fig. 6shows titrations in which
oligo(dT) was titrated with either rhRPA, 327, or
442. As has been observed in previous studies(31) , two
bands of altered mobility were observed when rhRPA binds to
oligo(dT) . At low concentrations of rhRPA, a single
complex with altered mobility was observed (Fig. 6A, lanes4-8) and as the protein concentration was
increased, a second complex with lower mobility appeared (Fig. 6A, lanes8-12). These
complexes represent singly and doubly liganded complexes, respectively (34) . When oligo(dT) was titrated with 442,
two complexes with altered mobility were also observed (Fig. 6B, lanes4-11); however,
with more than 100 fmol of 442, a third complex was observed (Fig. 6B, lane12). We believe this
to be a triply liganded complex. This conclusion is consistent with the
21-nucleotide binding site of 442. 327 also has a smaller
binding site size than that of rhRPA, yet only two complexes with
altered mobility were observed when oligo(dT) was titrated
with 327 (Fig. 6C). In addition, much higher
concentrations of protein were required for binding of this mutant (Fig. 6C). This indicated that the binding affinity of
327 is much lower than that of rhRPA and that saturating
concentrations of protein had probably not been added in this assay. In
these experiments, we observed that in reactions containing greater
than 1,000 fmol of protein, the protein DNA complexes migrated as
smears (e.g.Fig. 6C, lane11). This is probably due to RPA-RPA interactions or
aggregation at high protein concentrations. Aggregation of human RPA
has been observed previously at high protein
concentrations(34) .
Figure 6:
Gel mobility shift assay of recombinant
proteins using labeled oligo (dT) . 2 fmol of radiolabeled
oligo(dT) was incubated with indicated amounts of either
rhRPA (A), 442 (B), or 327 (C).
After incubating at 25 °C for 20 min, the reaction mixture was
separated on a 1% agarose gel in 0.1% TAE as described under
``Experimental Procedures.'' The positions of the free and
bound oligo(dT) are as indicated. D, quantitation
of titrations shown in A-C. Each band was excised, and
the radioactivity was measured by liquid scintillation counting.
Fraction-free DNA was plotted versus concentration of active
protein, and the resulting binding isotherms for rhRPA ( ),
442 ( ), and 327 ( ) binding to oligo(dT) are shown. The data were fit to the Langmuir binding equation for
bimolecular binding reactions using nonlinear least square fitting
software (Kaleidograph, Abelbeck Software) as described
previously(34) . Best fit curves are shown for rhRPA (solidline, K = 5.1
10 ), 442 (dottedline, K = 2.4 10 ),
and 327 (dashedline, K = 1.7
10 ).
The titrations shown in Fig. 6were quantitated by excising individual bands and
determining the amount of radioactive DNA present. Individual binding
isotherms were obtained by plotting the fraction of free DNA versus active protein present (Fig. 6D). Apparent binding
constants were then determined by fitting the data to the Langmuir
binding equation. We have shown previously that under these conditions
RPA binds to DNA with low cooperativity, and that individual binding
events can be considered unlinked(34) . Therefore, the multiple
binding events of RPA binding to oligo(dT) can be analyzed
as a series of independent bimolecular binding reactions to obtain a
good estimate of the apparent binding constant ((34) ; see also Fig. 6D). The apparent association constants determined for
rhRPA, 442, and 327 binding to oligo(dT) are
shown in Table 4. The affinity for oligo(dT) of
442 was only 4-fold lower than that of rhRPA complex, while the
affinity of 327 was 60-fold lower than of rhRPA complex.
Binding of 442 and 327 to oligo(dT) and
oligo(dT) was also examined. When oligo(dT) was titrated with rhRPA, only a single band with reduced mobility
was observed when up to 490 fmol of rhRPA was added (data not shown;
see also (31) ). In contrast, two bands with reduced mobility
were observed in a similar titration of oligo(dT) with
442 (data not shown). Titration of oligo(dT) with
327 resulted in a single band of lowered mobility (data not
shown). When binding to oligo(dT) was examined, a single
complex with lowered mobility was observed with all three proteins
(data not shown). The complexes formed by 442 were exactly as
predicted by its binding site of 21 nucleotides; the maximum number of
molecules of 442 bound to oligo(dT) ,
oligo(dT) , and oligo(dT) were 3, 2, and 1,
respectively. The binding site of 327 is slightly smaller than
442 but no higher order complexes were found with either
oligo(dT) or oligo(dT) . We believe that the
explanation for this observation is that 327 has a binding
affinity significantly lower than either rhRPA or 442 (see below)
and that concentrations of 327 higher than were used in these
assays were needed to saturate the oligonucleotides used. All of the
binding titrations of oligo(dT) and oligo(dT) were quantitated and analyzed as describe above. The resolved
binding constants are summarized in Table 4. While the affinity
of 442 for oligo(dT) was approximately 4-fold less
than rhRPA, the affinities for oligo(dT) and
oligo(dT) were essentially identical to those of rhRPA
complex. These results suggest all of the residues needed to interact
with DNA are contained in this mutant and that the 32- and 14-kDa
subunits of RPA do not contribute significantly to the binding of RPA
to oligonucleotides. In contrast to 442, the smaller mutant,
327, was found to have a much lower affinity for oligo(dT) (Table 4). Thus, deletion of residues 327-441
resulted in at least a 10-fold decrease in the affinity for DNA. In
spite of this decrease, the affinity of 327 for ssDNA is still
high, indicating that residues 1-326 of RPA70 contain a core DNA
binding domain.
SV40 ReplicationIt has been shown previously that
neither isolated RPA70 (21) nor a subcomplex composed of the
32- and 14-kDa subunits (rhRPA32 14)(46) were individually able to
support SV40 DNA replication. The very low solubility of full-length
RPA70 has made it difficult to test whether a combination of RPA70 and
the rhRPA32 14 subcomplex could support replication. The deletion
mutants 442 and 327 are much more soluble than RPA70 and bind
to ssDNA with high affinity; therefore, we tested whether either
deletion mutant could substitute for RPA in an SV40 replication assay.
A series of SV40 replication reactions were carried out in which all
components, except rhRPA, were provided as either the purified proteins
or partially purified fractions. DNA synthesis in these reactions was
absolutely dependent upon both T-antigen and RPA (Fig. 7). When
either 442 and 327 were added to replication reactions, no
DNA synthesis was observed (Fig. 7, lanes3, 4, 9, and 10). Similar results were obtained
in the presence of rhRPA32 14 subcomplex (Fig. 7, lanes8 and 14). Mixing experiments were also carried
out in which rhRPA and either 442 or 327 were added to the
same reaction. Neither deletion mutants inhibited replication even when
present at a 5-fold or 10-fold molar excess (Fig. 7, lanes5-7 and 11-13). We conclude that
442 and 327 were neither able to support nor inhibit SV40
replication. Also, all three subunits of RPA are required for SV40
replication.
Figure 7:
Activity of 442 and 327 in SV40
replication. SV40 replication assays were carried out as described
previously, and the products were analyzed by electrophoresis on 1%
agarose gels followed by autoradiography(46) . Cellular
proteins necessary for SV40 replication were supplied as partially
purified protein fractions. Each reconstituted replication reaction
contained 20 µg of cellular fraction II (contains DNA polymerases
and and replication factor C), 5.6 µg of fraction
cellular fraction IBC (contains proliferating nuclear cell antigen and
protein phosphatase 2A)(46, 56) , 0.7 µg of
purified SV40 T antigen, 1.5 units of topoisomerase I (Promega Corp.),
and indicated amounts of rhRPA, rhRPA32 14, 442, and
327. Plasmid pUC.HSO(17) , which contains the SV40 origin
of replication, was used as the template for these
reactions.
DISCUSSION
RPA70 has multiple functions; it has intrinsic ssDNA binding
activity, and it interacts directly with the other two RPA subunits,
DNA polymerase  primase complex and several transcriptional
activators. The goal of these studies was to map the functional domains
of the 70-kDa subunit of RPA. A series of C-terminal deletion mutants
were constructed and characterized. A schematic showing the deletions
constructed is shown in Fig. 1. This figure also summarizes the
properties of the individual mutants. Initial characterization
indicated that the solubility of individual mutants varied
significantly. Full-length RPA70 and 507 were both highly
insoluble, while all of the smaller mutants were soluble. Deletion of
the C terminus also resulted in polypeptides that were unable to form a
stable complex with the 32- and 14-kDa subunits, suggesting that the C
terminus of RPA70 is important for heterotrimeric complex formation.
The low solubility of the full-length subunit suggests interactions
between the C terminus and the 32- and 14-kDa subunits are primarily
hydrophobic (Fig. 1). This hypothesis is supported by an
examination of the amino acid sequence of RPA70; the residues between
440 and 616 have predominantly hydrophobic character on a
Kyte-Doolittle hydrophobicity plot (data not shown). Such hydrophobic
interactions would also be consistent with the high stability of the
heterotrimeric RPA complex (12, 13) and the proposal
that RPA has an ordered assembly pathway in which RPA70 must interact
with a subcomplex of the 32- and 14-kDa subunits(46) . All
of the deletion mutants were tested for DNA binding activity. These
experiments indicated that all of the deletion mutants except for
169 were capable of binding to ssDNA (Fig. 3). Two soluble
deletion mutants, 442 and 327, were purified, and their DNA
binding properties were examined quantitatively in gel mobility shift
assays. The binding constants obtained (Table 4) indicated that
both deletion mutants bound ssDNA with high affinity. The apparent
association constants determined for 442 are nearly identical to
those of rhRPA complex. We conclude that the 442 contains the
entire DNA-binding domain of RPA and that the 32- and 14-kDa subunits
of RPA do not affect the binding of RPA to oligonucleotides (see also
the discussion of cooperativity below). 327 bound DNA with an
affinity approximately 10-fold lower than rhRPA. The finding that
169 did not interact with ssDNA in Southwestern blots indicated
that residues between 169 and 326 are essential for DNA interaction. We
conclude that the DNA binding domain of RPA is between residues 1 and
441 and that there is a core DNA-binding domain contained between
residues 1 and 326 (Fig. 1). The N-terminal boundary of the DNA
binding domain is not well defined, but proteolytic mapping studies of
RPA indicate that a 17-kDa polypeptide from the N-terminus is not
necessary for DNA binding activity. The binding site
size of 442 and 327 were both approximately 20 nucleotides.
This is significantly smaller than the 30-nucleotide binding site size
of the RPA complex. The decrease is consistent with their smaller size
and monomeric state in solution. The finding that there is little
difference in the binding affinity between 442 and RPA suggests
that part of the 30-nucleotide binding site of RPA is the result of
steric occlusion by either the C-terminal residues of RPA70 or the 32-
and 14-kDa subunits. 442 bound to oligo(dT) and
oligo(dT) with association constants equivalent to those
of rhRPA complex, yet it bound to oligo(dT) with an
association constant one-quarter of that of rhRPA (Table 4). One
possible explanation for this difference is that 442 binds to DNA
with reduced cooperativity. The stoichiometry of binding for 442
to oligo(dT) , oligo(dT) , and oligo(dT) is 1:1, 2:1, and 3:1, respectively, while the stoichiometry of
rhRPA to these oligonucleotides is 1:1, 1:1, and 2:1, respectively.
Thus cooperative interactions would be expected for 442 binding to
oligo(dT) and for both 442 and rhRPA binding to
oligo(dT) . We have shown previously that under the
conditions used in these studies, rhRPA binds to ssDNA with a low but
measurable level of cooperativity ( =
10-20)(35) . This level of cooperativity causes the
association constant of rhRPA for oligo(dT) to be
10-fold higher than that for oligo(dT) (Table 4). If 442 had the same cooperativity of
binding as rhRPA, then the association constant for oligo(dT) should have been 10 greater than that of oligo
(dT) , and the association constant for oligo(dT) should have been similar to that of rhRPA. This was not observed.
These data are consistent with 442 having significantly less
cooperativity in binding than rhRPA and would suggest that either the C
terminus of RPA70 or the 32- and 14-kDa subunits are responsible for
cooperativity of RPA binding to DNA.
Human RPA70 contains a putative
C -type zinc-finger motif at positions
481-503(21) . This sequence has been found to be
conserved in all RPA70 homologue genes whose sequences are
known(38, 42, 47) . 442 does not contain
this motif, yet it binds oligonucleotides with an affinity similar to
that of rhRPA complex. We conclude that the putative zinc-finger is not
necessary for DNA binding activity. The single-stranded DNA binding
protein from bacteriophage T4, gene 32 protein, has a zinc metal
binding site. Inactivation of this metal binding region reduces the
binding affinity for long single-stranded DNA due to a reduction in the
cooperativity of binding (61) . Our data imply that 442
binds with reduced cooperativity. Thus, it remains possible that the
C -type zinc-finger motif could have a role in cooperative
binding of RPA. The purified C-terminal deletion mutants of RPA70
were also tested for the ability to support SV40 DNA replication.
Neither 442 nor 327 were able to support SV40 replication
when added alone or in combination with a complex of the 32- and 14-kDa
subunits of RPA. This suggests that the ability to bind DNA is not
sufficient for DNA replication and confirms that a heterotrimeric RPA
complex is necessary to support DNA replication. We also found that
neither mutant inhibited replication when mixed with rhRPA, even when
present at a 10-fold molar excess. Since 442 binds DNA with an
affinity close to that of rhRPA, 10-fold excess should have been
sufficient to preferentially bind to most of the ssDNA in the
replication reaction; however, replication still occurred. These
results suggest several possible models for the function of RPA in DNA
replication. One explanation for the lack of inhibition by 442 is
that although it binds to oligonucleotides with high affinity, its
binding properties of are different enough to prevent it from competing
effectively with rhRPA complex. Alternatively, specific protein-protein
interactions may be needed to load RPA onto ssDNA during the initiation
or elongation stages of replication. If these interactions were absent
or weak with 442, it would not compete with RPA during
replication. Thus, although both RPA-protein and RPA-DNA interactions
are essential for DNA replication, it is not known whether both types
of interactions are needed simultaneously, sequentially, or
independently. The absence of inhibition of 442 suggests that
ssDNA binding is not a prerequisite for required RPA-protein
interactions. Additional characterization of the interactions between
RPA and other replication proteins and RPA and DNA will be needed to
distinguish between these models of RPA function.
FOOTNOTES
- *
- This work was supported by Public Health Service
Grant GM44721 from the General Medicine Institute. The costs of
publication of this article were defrayed in part by the payment of
page charges. This article must therefore by hereby marked
``advertisement'' in accordance with 18 U.S.C.
Section 1734 solely to indicate this fact.
- §
- To whom correspondence should be addressed.
Dept. of Biochemistry, University of Iowa School of Medicine, 51 Newton
Rd., Iowa City, IA 52242-1109. Tel.: 319-335-6784; Fax: 319-335-9570; marc-wold{at}uiowa.edu.
- (
) - The
abbreviations used are: RPA, replication protein A; hRPA, human RPA;
rhRPA, recombinant human RPA; ssDNA, single-stranded DNA; PCR,
polymerase chain reaction; RPA70, RPA 70-kDa subunit; rhRPA32
14,
complex of 32- and 14-kDa subunits of replication protein A.
- (
) - X. V. Gomes, L. A. Henricksen, and M. S. Wold,
unpublished observations.
ACKNOWLEDGEMENTS
We thank S. S. Chung for carrying out initial PCR
amplification and cloning of deletion mutants. We thank L. A.
Henricksen for supplying purified recombinant human RPA and RPA
32 14 subcomplex and B. F. Paulus for HeLa cellular fractions. We
thank B. Stillman and J. Hurwitz for monoclonal antibodies to RPA. We
also thank Drs. C. Swenson and C. Kim for assistance with fluorescence
experiments. We thank the members of the Wold laboratory for scientific
discussions and critical reading of this manuscript. We thank the
University of Iowa DNA Core Facility for oligonucleotide synthesis and
DNA sequencing.
REFERENCES
- Challberg, M. D. & Kelly, T. J. (1989) Annu. Rev. Biochem. 58, 671-717
[CrossRef][Medline]
[Order article via Infotrieve]
- Stillman, B. (1989) Annu. Rev. Cell Biol. 5, 197-245
[CrossRef]
- Hurwitz, J., Dean, F. B., Kwong, A. D. & Lee, S.-H. (1990) J. Biol. Chem. 265, 18043-18046
[Free Full Text]
- Borowiec, J. A., Dean, F. B., Bullock, P. A. & Hurwitz, J. (1990) Cell 60, 181-184
[CrossRef][Medline]
[Order article via Infotrieve]
- Melendy, T. & Stillman, B. (1992) in Nucleic Acids and Molecular Biology (Echstein, F., and Lilly, D. M. J., eds) pp. 129-158, Springer-Verlag, Berlin
- Ishimi, Y., Claude, A., Bullock, P. & Hurwitz, J. (1988) J. Biol. Chem. 263, 19723-19733
[Abstract/Free Full Text]
- Weinberg, D. H., Collins, K. L., Simancek, P., Russo, A., Wold, M. S., Virshup, D. M. & Kelly, T. J. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 8692-8696
[Abstract/Free Full Text]
- Tsurimoto, T., Melendy, T. & Stillman, B. (1990) Nature 346, 534-539
[CrossRef][Medline]
[Order article via Infotrieve]
- Murakami, Y., Eki, T. & Hurwitz, J. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 952-956
[Abstract/Free Full Text]
- Waga, S. & Stillman, B. (1994) Nature 369, 207-212
[CrossRef][Medline]
[Order article via Infotrieve]
- Wobbe, C. R., Weissbach, L., Borowiec, J. A., Dean, F. B., Murakami, Y., Bullock, P. & Hurwitz, J. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 1834-1838
[Abstract/Free Full Text]
- Wold, M. S. & Kelly, T. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 2523-2527
[Abstract/Free Full Text]
- Fairman, M. P. & Stillman, B. (1988) EMBO J. 7, 1211-1218
[Medline]
[Order article via Infotrieve]
- Kenny, M. K., Schlegel, U., Furneaux, H. & Hurwitz, J. (1990) J. Biol. Chem. 265, 7693-7700
[Abstract/Free Full Text]
- Collins, K. L. & Kelly, T. J. (1991) Mol. Cell. Biol. 11, 2108-2115
[Abstract/Free Full Text]
- Melendy, T. & Stillman, B. (1993) J. Biol. Chem. 268, 3389-3395
[Abstract/Free Full Text]
- Wold, M. S., Li, J. J. & Kelly, T. J. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 3643-3647
[Abstract/Free Full Text]
- Dornreiter, I., Erdile, L. F., Gilbert, I. U., von Winkler, D., Kelly, T. J. & Fanning, E. (1992) EMBO J. 11, 769-776
[Medline]
[Order article via Infotrieve]
- Tsurimoto, T. & Stillman, B. (1989) EMBO J. 8, 3883-3889
[Medline]
[Order article via Infotrieve]
- Lee, S.-H., Pan, Z.-Q., Kwong, A. D., Burgers, P. M. J. & Hurwitz, J. (1991) J. Biol. Chem. 266, 22707-22717
[Abstract/Free Full Text]
- Erdile, L. F., Heyer, W.-D., Kolodner, R. & Kelly, T. J. (1991) J. Biol. Chem. 266, 12090-12098
[Abstract/Free Full Text]
- Seo, Y.-S., Lee, S.-H. & Hurwitz, J. (1991) J. Biol. Chem. 266, 13161-13170
[Abstract/Free Full Text]
- Thömmes, P., Ferrari, E., Jessberger, R. & Hübscher, U. (1992) J. Biol. Chem. 267, 6063-6073
[Abstract/Free Full Text]
- Coverley, D., Kenny, M. K., Lane, D. P. & Wood, R. D. (1992) Nucleic Acids Res. 20, 3873-3880
[Abstract/Free Full Text]
- Heyer, W.-D., Rao, M. R. S., Erdile, L. F., Kelly, T. J. & Kolodner, R. D. (1990) EMBO J. 9, 2321-2329
[Medline]
[Order article via Infotrieve]
- Moore, S. P., Erdile, L., Kelly, T. & Fishel, R. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 9067-9071
[Abstract/Free Full Text]
- Georgaki, A., Strack, B., Podust, V. & Hübscher, U. (1992) FEBS Lett. 308, 240-244
[CrossRef][Medline]
[Order article via Infotrieve]
- He, Z., Brinton, B. T., Greenblatt, J., Hassell, J. A. & Ingles, C. J. (1993) Cell 73, 1223-1232
[CrossRef][Medline]
[Order article via Infotrieve]
- Li, R. & Botchan, M. R. (1993) Cell 73, 1207-1221
[CrossRef][Medline]
[Order article via Infotrieve]
- Dutta, A., Ruppert, J. M., Aster, J. C. & Winchester, E. (1993) Nature 365, 79-82
[CrossRef][Medline]
[Order article via Infotrieve]
- Kim, C., Snyder, R. O. & Wold, M. S. (1992) Mol. Cell. Biol. 12, 3050-3059
[Abstract/Free Full Text]
- Alani, E., Thresher, R., Griffith, J. D. & Kolodner, R. D. (1992) J. Mol. Biol. 227, 54-71
[CrossRef][Medline]
[Order article via Infotrieve]
- Mitsis, P. G., Kowalczykowski, S. C. & Lehman, I. R. (1993) Biochemistry 32, 5257-5266
[CrossRef][Medline]
[Order article via Infotrieve]
- Kim, C., Paulus, B. F. & Wold, M. S. (1994) Biochemistry 33, 14197-14206
[CrossRef][Medline]
[Order article via Infotrieve]
- Kim, C. & Wold, M. S. (1995) Biochemistry , in press
- Korn, D., Fisher, P. A., Battey, J. & Wang, T. S. (1979) Cold Spring Harbor Symp. Quant. Biol. 43, 613-624
- Atrazhev, A., Zhang, S. & Grosse, F. (1992) Eur. J. Biochem. 210, 855-865
[Medline]
[Order article via Infotrieve]
- Adachi, Y. & Laemmli, U. K. (1992) J. Cell Biol. 119, 1-15
[Abstract/Free Full Text]
- Brill, S. J. & Stillman, B. (1989) Nature 342, 92-95
[CrossRef][Medline]
[Order article via Infotrieve]
- Brown, G. W., Melendy, T. E. & Ray, D. S. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 10227-10231
[Abstract/Free Full Text]
- Nakagawa, M., Tsukada, S., Soma, T., Shimuzu, Y., Miyake, S., Iwamatsu, A. & Sugiyama, H. (1991) Nucleic Acids Res. 19, 4292
[Free Full Text]
- Brown, G. W., Hines, J. C., Fisher, P. & Ray, D. S. (1994) Mol. Biochem. Parasitol. 63, 135-142
[CrossRef][Medline]
[Order article via Infotrieve]
- Kamakaka, R. T., Kaufman, P. D., Stillman, B., Mitsis, P. G. & Kadonaga, J. T. (1994) Mol. Cell. Biol. 14, 5114-5122
[Abstract/Free Full Text]
- Erdile, L. F., Wold, M. S. & Kelly, T. J. (1990) J. Biol. Chem. 265, 3177-3182
[Abstract/Free Full Text]
- Umbricht, C. B., Erdile, L. F., Jabs, E. W. & Kelly, T. J. (1993) J. Biol. Chem. 268, 6131-6138
[Abstract/Free Full Text]
- Henricksen, L. A., Umbricht, C. B. & Wold, M. S. (1994) J. Biol. Chem. 269, 11121-11132
[Abstract/Free Full Text]
- Brill, S. J. & Stillman, B. (1991) Genes & Dev. 5, 1589-1600
- Stigger, E., Dean, F. B., Hurwitz, J. & Lee, S.-H. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 579-583
[Abstract/Free Full Text]
- Din, S.-U., Brill, S. J., Fairman, M. P. & Stillman, B. (1990) Genes & Dev. 4, 968-977
- Dutta, A. & Stillman, B. (1992) EMBO J. 11, 2189-2199
[Medline]
[Order article via Infotrieve]
- Fotedar, R. & Roberts, J. M. (1992) EMBO J. 11, 2177-2187
[Medline]
[Order article via Infotrieve]
- Liu, V. F. & Weaver, D. T. (1993) Mol. Cell. Biol. 13, 7222-7231
[Abstract/Free Full Text]
- Carty, M. P., Zernik-Kobak, M., McGrath, S. & Dixon, K. (1994) EMBO J. 13, 2114-2123
[Medline]
[Order article via Infotrieve]
- Fang, F. & Newport, J. W. (1993) J. Cell Sci. 106, 983-994
[Abstract]
- Henricksen, L. A. & Wold, M. S. (1994) J. Biol. Chem. 269, 24203-24208
[Abstract/Free Full Text]
- Wold, M. S., Weinberg, D. H., Virshup, D. M., Li, J. J. & Kelly, T. J. (1989) J. Biol. Chem. 264, 2801-2809
[Abstract/Free Full Text]
- Studier, F. W., Rosenberg, A. H., Dunn, J. J. & Dubendorff, J. W. (1990) Methods Enzymol. 185, 60-89
[Medline]
[Order article via Infotrieve]
- Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York
- Laemmli, U. K. (1970) Nature 227, 680-685
[CrossRef][Medline]
[Order article via Infotrieve]
- Bradford, M. M. (1976) Anal. Biochem. 72, 248-254
[CrossRef][Medline]
[Order article via Infotrieve]
- Villemain, J. L. & Giedroc, D. P. (1993) Biochemistry 32, 11235-11246
[CrossRef][Medline]
[Order article via Infotrieve]
- Siegal, L. M. & Monty, K. J. (1966) Biochim. Biophys. Acta 112, 346-362
[Medline]
[Order article via Infotrieve]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
T. R. Salas, I. Petruseva, O. Lavrik, and C. Saintome
Evidence for direct contact between the RPA3 subunit of the human replication protein A and single-stranded DNA
Nucleic Acids Res.,
January 1, 2009;
37(1):
38 - 46.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Haring, A. C. Mason, S. K. Binz, and M. S. Wold
Cellular Functions of Human RPA1: MULTIPLE ROLES OF DOMAINS IN REPLICATION, REPAIR, AND CHECKPOINTS
J. Biol. Chem.,
July 4, 2008;
283(27):
19095 - 19111.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Ishibashi, S. Kimura, and K. Sakaguchi
A Higher Plant Has Three Different Types of RPA Heterotrimeric Complex
J. Biochem.,
January 1, 2006;
139(1):
99 - 104.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Lin, J. B. Robbins, E. K. D. Nyannor, Y.-H. Chen, and I. K. O. Cann
A CCCH Zinc Finger Conserved in a Replication Protein A Homolog Found in Diverse Euryarchaeotes
J. Bacteriol.,
December 1, 2005;
187(23):
7881 - 7889.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. M. Doherty, J. A. Sommers, M. D. Gray, J. W. Lee, C. von Kobbe, N. H. Thoma, R. P. Kureekattil, M. K. Kenny, and R. M. Brosh Jr.
Physical and Functional Mapping of the Replication Protein A Interaction Domain of the Werner and Bloom Syndrome Helicases
J. Biol. Chem.,
August 19, 2005;
280(33):
29494 - 29505.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. D. Vise, B. Baral, A. J. Latos, and G. W. Daughdrill
NMR chemical shift and relaxation measurements provide evidence for the coupled folding and binding of the p53 transactivation domain
Nucleic Acids Res.,
April 11, 2005;
33(7):
2061 - 2077.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-M. Loo and T. Melendy
Recruitment of Replication Protein A by the Papillomavirus E1 Protein and Modulation by Single-Stranded DNA
J. Virol.,
February 15, 2004;
78(4):
1605 - 1615.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. K. Binz, Y. Lao, D. F. Lowry, and M. S. Wold
The Phosphorylation Domain of the 32-kDa Subunit of Replication Protein A (RPA) Modulates RPA-DNA Interactions: EVIDENCE FOR AN INTERSUBUNIT INTERACTION
J. Biol. Chem.,
September 12, 2003;
278(37):
35584 - 35591.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Kantake, T. Sugiyama, R. D. Kolodner, and S. C. Kowalczykowski
The Recombination-deficient Mutant RPA (rfa1-t11) Is Displaced Slowly from Single-stranded DNA by Rad51 Protein
J. Biol. Chem.,
June 20, 2003;
278(26):
23410 - 23417.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Dabrowski, M. Olszewski, R. Piatek, A. Brillowska-Dabrowska, G. Konopa, and J. Kur
Identification and characterization of single-stranded-DNA-binding proteins from Thermus thermophilus and Thermus aquaticus - new arrangement of binding domains
Microbiology,
October 1, 2002;
148(10):
3307 - 3315.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. M. Kolpashchikov, S. N. Khodyreva, D. Yu. Khlimankov, M. S. Wold, A. Favre, and O. I. Lavrik
Polarity of human replication protein A binding to DNA
Nucleic Acids Res.,
January 15, 2001;
29(2):
373 - 379.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Wang, J.-S. Park, M. Ishiai, J. Hurwitz, and S.-H. Lee
Species specificity of human RPA in simian virus 40 DNA replication lies in T-antigen-dependent RNA primer synthesis
Nucleic Acids Res.,
December 1, 2000;
28(23):
4742 - 4749.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-S. Park, M. Wang, S.-J. Park, and S.-H. Lee
Zinc Finger of Replication Protein A, a Non-DNA Binding Element, Regulates Its DNA Binding Activity through Redox
J. Biol. Chem.,
October 8, 1999;
274(41):
29075 - 29080.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Han, Y.-M. Loo, K. T. Militello, and T. Melendy
Interactions of the Papovavirus DNA Replication Initiator Proteins, Bovine Papillomavirus Type 1 E1 and Simian Virus 40 Large T Antigen, with Human Replication Protein A
J. Virol.,
June 1, 1999;
73(6):
4899 - 4907.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
T. J. Kelly, P. Simancek, and G. S. Brush
Identification and characterization of a single-stranded DNA-binding protein from the archaeon Methanococcus jannaschii
PNAS,
December 8, 1998;
95(25):
14634 - 14639.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Weisshart, P. Taneja, and E. Fanning
The Replication Protein A Binding Site in Simian Virus 40 (SV40) T Antigen and Its Role in the Initial Steps of SV40 DNA Replication
J. Virol.,
December 1, 1998;
72(12):
9771 - 9781.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Brill and S. Bastin-Shanower
Identification and Characterization of the Fourth Single-Stranded-DNA Binding Domain of Replication Protein A
Mol. Cell. Biol.,
December 1, 1998;
18(12):
7225 - 7234.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
G. Mass, T. Nethanel, and G. Kaufmann
The Middle Subunit of Replication Protein A Contacts Growing RNA-DNA Primers in Replicating Simian Virus 40 Chromosomes
Mol. Cell. Biol.,
November 1, 1998;
18(11):
6399 - 6407.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
K. Umezu, N. Sugawara, C. Chen, J. E. Haber, and R. D. Kolodner
Genetic Analysis of Yeast RPA1 Reveals Its Multiple Functions in DNA Metabolism
Genetics,
March 1, 1998;
148(3):
989 - 1005.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Bochkareva, L. Frappier, A. M. Edwards, and A. Bochkarev
The RPA32 Subunit of Human Replication Protein A Contains a Single-stranded DNA-binding Domain
J. Biol. Chem.,
February 13, 1998;
273(7):
3932 - 3936.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. van der Knaap, S. Jagoueix, and H. Kende
Expression of an ortholog of replication protein A1 (RPA1) is induced by gibberellin in deepwater rice
PNAS,
September 2, 1997;
94(18):
9979 - 9983.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. A. Pfuetzner, A. Bochkarev, L. Frappier, and A. M. Edwards
Replication Protein A. CHARACTERIZATION AND CRYSTALLIZATION OF THE DNA BINDING DOMAIN
J. Biol. Chem.,
January 3, 1997;
272(1):
430 - 434.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ishiai, J. P. Sanchez, A. A. Amin, Y. Murakami, and J. Hurwitz
Purification, Gene Cloning, and Reconstitution of the Heterotrimeric Single-stranded DNA-binding Protein from Schizosaccharomyces pombe
J. Biol. Chem.,
August 23, 1996;
271(34):
20868 - 20878.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-L. Lin, C. Chen, K. F. Keshav, E. Winchester, and A. Dutta
Dissection of Functional Domains of the Human DNA Replication Protein Complex Replication Protein A
J. Biol. Chem.,
July 19, 1996;
271(29):
17190 - 17198.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D.-K. Kim, E. Stigger, and S.-H. Lee
Role of the 70-kDa Subunit of Human Replication Protein A (I). SINGLE-STRANDED DNA BINDING ACTIVITY, BUT NOT POLYMERASE STIMULATORY ACTIVITY, IS REQUIRED FOR DNA REPLICATION
J. Biol. Chem.,
June 21, 1996;
271(25):
15124 - 15129.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Burns, S. N. Guzder, P. Sung, S. Prakash, and L. Prakash
An Affinity of Human Replication Protein A for Ultraviolet-damaged DNA
J. Biol. Chem.,
May 17, 1996;
271(20):
11607 - 11610.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Bochkareva, S. Korolev, and A. Bochkarev
The Role for Zinc in Replication Protein A
J. Biol. Chem.,
August 25, 2000;
275(35):
27332 - 27338.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Komori and Y. Ishino
Replication Protein A in Pyrococcus furiosus Is Involved in Homologous DNA Recombination
J. Biol. Chem.,
July 6, 2001;
276(28):
25654 - 25660.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Bastin-Shanower and S. J. Brill
Functional Analysis of the Four DNA Binding Domains of Replication Protein A. THE ROLE OF RPA2 IN ssDNA BINDING
J. Biol. Chem.,
September 21, 2001;
276(39):
36446 - 36453.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|