Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jannatipour, M.
Right arrow Articles by Rokeach, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jannatipour, M.
Right arrow Articles by Rokeach, L. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 9, Issue of March 3, 1995 pp. 4845-4853
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
The Schizosaccharomyces pombe Homologue of the Chaperone Calnexin Is Essential for Viability (*)

(Received for publication, August 17, 1994; and in revised form, October 18, 1994)

Mehrdad Jannatipour Luis A. Rokeach (§)

From the Département de biochimie, Université de Montréal, Montréal, Québec H3C 3J7, Canada

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

We have cloned a Schizosaccharomyces pombe gene, here designated cnx1, encoding the homologue of the endoplasmic reticulum molecular chaperone calnexin. Disruption of the cnx1 gene was lethal, demonstrating that it has an essential cellular function. Transcription of cnx1 mRNA is initiated at multiple sites, and it can be induced by various stress treatments that lead to the accumulation of unfolded and/or misfolded proteins in the endoplasmic reticulum. The encoded Cnx1p protein more closely resembles its plant and animal calnexin homologues than that of Saccharomyces cerevisiae. Cnx1p is acidic and migrates aberrantly on SDS-polyacrylamide gel electrophoresis, similar to its mammalian counterparts. Cnx1p contains the hallmark KPEDWD motifs that are found in all members of the calnexin/calreticulin family of proteins. Using an in vitro translation-processing system, we have shown that Cnx1p has the characteristic type I topology of calnexin proteins. Unlike its higher eukaryotic homologues, Cnx1p has a site for N-glycosylation that was modified in an in vitro translation-processing assay.


INTRODUCTION

Calreticulin and calnexin are two endoplasmic reticulum (ER) (^1)proteins that have attracted considerable attention in recent years. Calnexin is a type I membrane protein whose lumenal domain shares considerable sequence similarity with calreticulin, including three copies of the characteristic KPEDWD motif (for reviews see Refs. 1, 2). Calnexin is capable of binding Ca and it was proposed to be involved in the retention of soluble ER proteins in a Ca-dependent manner(3) . Initial reports have identified calnexin as a protein involved in the assembly of class I histocompatibility molecules (p88; 4) and the T-cell receptor (IP90; 5, 6) providing an indication of its cellular function. Further studies have demonstrated that calnexin is a major molecular chaperone interacting with numerous newly synthesized glycoproteins transiting through the ER(7, 8, 9) . It has been proposed that calnexin is part of the ER quality control machinery, binding folding intermediates through their oligosaccharide moieties until these substrates achieve proper folding or until misfolded proteins are degraded(1, 2, 10) . The isolation and sequencing of cDNA and genomic clones of mammalian, Xenopus laevis, plant, and helminth species, have revealed that the general structural organization of calnexin has been conserved through evolution(1, 3, 6, 11, 12, 13, 14) . However, Saccharomyces cerevisiae appears to be an exception, as calnexin from this yeast contains a single copy of the KPEDWD repeat and does not posses a cytosolic domain(15) . The cytosolic, C-terminal domain of mammalian calnexin is phosphorylated at serine residues by casein kinase II. It was proposed that phosphorylation of calnexin could be involved in modulation of its function(3, 12) .

Calreticulin is a major calcium-binding, soluble intraluminal protein (reviewed in (16) ). Complementary DNAs encoding calreticulin have been cloned from numerous organisms (16-23, and references therein). The encoded polypeptides show a remarkable degree of conservation, especially in the central portion, or P-domain, which is relatively rich in prolines and contains three KPEDWD repeats(16, 24) . An ever growing body of intriguing observations indicates calreticulin may be involved in several cellular processes(25, 26) . For instance, Dedhar and collaborators (27) presented evidence that calreticulin binds to the highly conserved peptide KXGFFKR present in the cytoplasmic domain alpha-subunit of integrin receptors, and they have further shown that this interaction occurs also in vivo(28) . The observation that the almost identical peptide KXFFKR is found in the DNA-binding domain of all steroid receptors led to the demonstration that calreticulin interacts in vitro with the glucocorticoid receptor and the androgen receptor (29, 30) . Moreover, it was shown that overexpression of calreticulin can inhibit the transcriptional activity of the glucocorticoid, the androgen and the retinoic receptors, as well as retinoic acid-induced neuronal differentiation(29, 30) .

To better understand the cellular functions of the calreticulin/calnexin family of proteins, we set out to clone the genes encoding these proteins in the fission yeast Schizosaccharomyces pombe. As its distant relative the budding yeast S. cerevisiae, S. pombe is suitable for analysis by classical and reverse genetic approaches(31, 32) . However, in several molecular, functional and morphological aspects, S. pombe appears more similar to higher eukaryotes than the budding yeast. For instance, S. pombe genes are more homologous to those of higher eukaryotes(31, 32) , the cell-cycle control and cell division are akin to those of higher eukaryotes, and S. pombe has well defined ER and Golgi structures which are easily identifiable by EM(33, 34) . In addition, glycoproteins of the fission yeast acquire terminal galactose residues like higher eukaryotes do(35, 36) . These features make S. pombe an ideal model organism for the study of gene function and cellular processes of higher eukaryotes.

In this study, we describe the isolation of the gene encoding the S. pombe calnexin homologue. The S. pombe calnexin species possesses the characteristic type I topology, and its amino acid sequence is more closely related to its plant and mammalian counterparts than to the S. cerevisiae homologue. Unlike the species from higher eukaryotes, the fission yeast calnexin contains a site that can be glycosylated in an in vitro translation-processing system. We demonstrate that disruption of the S. pombe calnexin gene is lethal and that its expression is induced by several types of stress.


MATERIALS AND METHODS

Bacterial and S. pombe Strains

Escherichia coli strain XL1-Blue MRF` was used for all cloning procedures and screening of libraries constructed in the ZAP Express vector (Stratagene). E. coli strain XLOLR (Stratagene) was used for plating excised phagemids. Strain NM514 (Hfl) was used in screening procedures involving gt10 (Stratagene). S. pombe strains employed were SP629 (h/hade6-M216/ade6-M210 ura4-D18/ura4-D18 leu1-32/leu1-32) obtained from Dr. David Beach and SP556 (hade6-M216 ura4-D18 leu1-32) obtained from Dr. Paul Nurse.

S. pombe Media and Procedures

YE and minimal medium (MM) were prepared as described(31) . Extremely low nitrogen medium (ELN; same composition as MM, except that NH(4)Cl was at 50 mg/liter) (^2)was used for the sporulation of diploids. Genetical procedures were performed as described previously (31) .

DNA Procedures

Standard DNA manipulations were carried out as described(37) . S. pombe genomic DNA was prepared as described(31) . Two S. pombe genomic libraries were constructed. SP1 was constructed by ligating EcoRI-digested, size-selected (2.5-3.5 kb), genomic DNA into EcoRI-digested gt10 arms (Stratagene). SP2 was constructed by ligating partially Sau3A-digested, size-selected (5-7 kb) genomic DNA into BamHI-digested ZAP Express arms (Stratagene). The S. pombe cDNA library, constructed in ZAPII vector (Stratagene), was a gift from Dr. David Beach. Hybridization conditions were as described before(37) . Where noted, reduced stringency of washing condition were used (2 times SSC, 0.1% SDS, 2 times 15 min at room temperature and 2 times 15 min at 60 °C).

RNA Procedures

Logarithmically growing cells of SP556 (50 ml, minimal medium) were subjected to different treatments. Control cells were incubated at 30 °C for 2 h. For heat shock, cell cultures were shifted from 30 to 39 °C for 5, 10, 30, or 60 min. Alternatively, cells were grown at 30 °C in the presence of either 10 µg/ml tunicamycin, 10 µM A23187, or 15 mM beta-mercaptoethanol (Sigma). For other treatments, cells were centrifuged, washed, and resuspended in minimal medium minus glucose, supplemented with 3% glycerol and 2% lactic acid, in the presence or absence of 2-deoxyglucose (10 mM), and incubation continued for a further 2 h. At the end of incubation, cells were placed on ice, pelleted, and total RNA was prepared as described (31) . RNA samples (2.5 µg) were analyzed by Northern blot as described previously(38) . The gel was stained with ethidium bromide to verify that equivalent amounts of RNA were loaded. Primer extensions were performed using a P end-radiolabeled oligonucleotide (P1CARC2: 5`-CGAACATATAAAGAGCAC-3`) and 50 µg of total RNA using ``S1 hybridization solution'' (39) at 30 °C overnight.

In Vitro Transcription and Translation

Plasmid pSPCA3080, containing a cDNA encoding the complete S. pombe calnexin, was linearized with BamHI and transcribed in vitro using T7 RNA polymerase (United States Biochemical Corp.). Shorter transcripts were transcribed using pSPCA3080 linearized at unique internal sites (Fig. 4). The resulting RNAs (1 µg) were translated in vitro using [S]methionine in a rabbit reticulocyte lysate, in the presence or absence of rough microsomes from dog pancreas (Promega), following manufacturer's recommendations. Pepstatin, 10 µM, was added during translation to minimize proteolysis. The translation products were analyzed on 10% SDS-PAGE (40) followed by fluorography (Amplify, Amersham).


Figure 4: N-glycosylation and topology of Cnx1p. Synthetic mRNAs of different lengths were used in an in vitro translation-processing system to elucidate the topology of Cnx1p. Unique internal restriction sites used to synthesize RNA are as follows: CI, ClaI; EI, EcoRI; NI, NcoI; BI, BamHI. Panels corresponding to the four versions of Cnx1p are labeled a-d. The predicted signal peptide region of Cnx1p is indicated as SP. The N-glycosylation site is shown as a diamond. Conditions used in each assay 1-7 were as described under ``Materials and Methods'' and are indicated under each lane.



Topology and Post-translational Assays

To assess translocation of in vitro synthesized proteins across, or their insertion into, the canine rough microsomes, protease protection assays were performed. In vitro translation samples (1.25 µl) were incubated in 15 µl (final volume) of 25 mM HEPES, pH 8.0, containing 250 mM sucrose, for 30 min, at 0 °C. Where indicated, trypsin and Triton X-100 were added to 0.1 mg/ml and 0.2%, respectively. Reactions were terminated by the addition of SDS sample buffer (40) followed by immediate boiling for 5 min. For treatment with endoglycosidase H (Boehringer Mannheim), the translation reactions (5 µl) were adjusted to 1% SDS and 50 mM sodium citrate, pH 6.0, in a final volume of 10 µl, boiled for 3 min, and incubated for 5 h at 37 °C in the presence of 2 milliunits of endoglycosidase H. Carbonate treatments were performed essentially as described previously(41) .

Gene Disruption

To facilitate the construction of S. pombe disrupted genes, the 1.7-kb HindIII fragment encoding ura4 from pURA4 (^3)was first cloned into pBluescript (Startagene), resulting in plasmid pSPUR3075. Using available restriction sites on pSPUR3075 (HincII and EcoRI), the ura4 gene was subcloned into the EcoRV-EcoRI sites (coordinates 739-1072, see Fig. 2) of the plasmid pSPCA3059 which contains the 1.8-kb ClaI-BglII genomic fragment of cnx1 (coordinates 455-1780, see Fig. 2and Fig. 6) yielding plasmid pSPCA3094. This step resulted in the deletion of 333 bp of the cnx1 coding sequence. A linear fragment from plasmid pSPCA3094, carrying the ura4-interrupted cnx1 sequences, was isolated and transformed into a sporulation-deficient isolate of the diploid strain SP629. Genomic DNA from parental SP629 and Ura transformants was analyzed by digestion with EcoRI/XbaI and EcoRI/BgllI followed by Southern blot using as probe a ClaI-EcoRI fragment (617 bp, coordinates 455-1072; see Fig. 2) which encompasses both the deleted region (333 bp) and 285 bp just 5` to the deleted region (Fig. 6). A sporulation-proficient colony of the resulting heterozygous calnexin-disrupted strain (SP5) was identified by the iodine vapor method (31) and sporulated on ELN. The mixture of asci and vegetative cells was treated in 1 ml of 100 mM sodium acetate, pH 5.5, containing 10 µl of beta-glucuronidase (Sigma) at room temperature, overnight. Digestion was examined microscopically and approximately 200 spores were washed and germinated onto media with or without uracil to determine the genotype of the progeny.


Figure 2: The nucleotide and deduced amino acid sequence of the S. pombe cnx1 gene. TATA box sequences are shown as solid boxes. The putative heat-shock element and unfolded protein response element are shown as open boxes at positions -132 to -119 and -444 to -427, respectively. The predicted site for signal sequence cleavage is indicated as solid, downward triangle. The putative N-linked glycosylation site is shown as open box at amino acid positions 418-420. The potential membrane spanning region of Cnx1p is underlined. Putative sites for phosphorylation by protein kinase C are shown in bold letters. Putative polyadenylation sites are underlined with solid lines. Beginning and end of the cDNA sequences are shown by arrows. Transcription initiation sites are shown in circles. Solid circles denote sites that are preferentially utilized as compared to sites indicated with open circles.




Figure 6: Gene disruption of S. pombe cnx1. A 333 bp stretch was deleted form the cnx1 gene and replaced with the ura4 marker gene. A linear fragment containing the ura4 interrupted cnx1 sequences was transformed into the diploid SP629 in order to disrupt, by homologous recombination, one of the copies of the cnx1 gene. Ura transformant strains were analyzed by Southern blotting; clone SP5 had the expected genotype. A, Southern blot of genomic DNA digested with EcoRI-XbaI and EcoRI-BglII and probed with an EcoRI-ClaI fragment (cnx1 coordinates 455-1072). DNA from wild type strain SP629 contains two hybridizing fragments of 0.5 and 2.6 kb upon digestion with EcoRI-XbaI (lane 1) and one hybridizing fragment of 1.3 kb upon digestion with EcoRI-BglII (lane 3). Strain SP5 contains an additional hybridizing band of 1.9 kb upon digestion with EcoRI-XbaI (lane 2) and an additional hybridizing band of 2.7 kb upon digestion with EcoRI-BglII (lane 4), indicating homologous integration and disruption of one copy of the cnx1 gene. B, random spore analysis of the diploid strain SP5 containing one copy of cnx1 disrupted by ura4. Approximately 200 spores were counted, washed, and plated on non selective media. Colonies were picked and examined for growth in the presence (B1) and absence (B2) of uracil. None of the spores examined grew in the absence of uracil indicating that cnx1 is an essential gene. Only one of the plates examined is shown here. The diploid SP5 strain was used in the lower right of the plate as control. C, physical map of the wild type and disrupted copies of cnx1 in SP5. The hatched boxed denotes the cnx1 coding sequence. The black box and arrow indicate, respectively, the ura4 gene and its direction of transcription. Only relevant restriction sites are indicated: B, BglII; EI, EcoRI; EV, EcoV; C, ClaI; X, XhoI.




RESULTS

Cloning of the S. pombe cnx1 Gene

Initial attempts to clone the genes of the calnexin/calreticulin family of proteins in S. pombe involved the PCR amplification of genomic DNA using degenerate oligonucleotides with sequence composition based on hyperconserved regions present in these proteins from different species. These efforts were unfruitful, and therefore a different approach was taken. We reasoned that due to the previously observed sequence similarity between S. pombe and mammalian genes (31, 32) it would be possible to use human calreticulin cDNA fragments to probe S. pombe genomic DNA by hybridization. Accordingly, PCR was used to generate three probes using a cDNA encoding human calreticulin as template(17) . Two DNA probes, designated 126 and 2-18, were created to match highly conserved regions common to both calreticulin and calnexin (see Fig. 3). Whereas a third probe, designated 2-20, corresponded to the acidic, C-terminal domain of calreticulin (last 74 residues; see Fig. 3). These probes were used in Southern blot analysis of S. pombe genomic DNA, under reduced stringency conditions (see ``Materials and Methods'' and Fig. 3). Two of the probes, 126 and 2-18, consistently yielded a single common band with each restriction digest (3.2 kb EcoRI, 8.5 kb XbaI, and 5.3 kb HindIII; see Fig. 1A, panels 1 and 2), whereas probe 2-20 yielded a rather complex hybridization pattern (see Fig. 1A, panel 3). Therefore, we chose to clone the 3.2-kb EcoRI fragment (P1, Fig. 1B) recognized by probes 126 and 2-18. In order to meet this aim, a size-selected library was constructed (designated SP1) and screened with the 126 probe. Sequencing of several positive clones, revealed that the P1 insert encoded an open reading frame incomplete at its 3` end and with the potential of encoding a protein with extensive similarity to both calnexin and calreticulin. Moreover, a 503-bp, EcoRI-XbaI derived from P1 was used in Southern analysis to confirm the authenticity of the clone. This fragment yielded the same pattern as with probes 126 and 2-18 except that an additional band was present when genomic DNA was digested with HindIII or XbaI (see Fig. 1, panels 4 and 5). The P1 fragment was used to screen genomic and cDNA libraries constructed in ZAP Express (SP2) and ZAPII, respectively. One group of positive clones, represented by insert P6 (see Fig. 1B), contained an uninterrupted ORF of 1.68 kb in length (see cDNA sequence indicated in Fig. 2). The sequences contained in the P6 clone extended 1066 nucleotides upstream from the predicted initiation codon and therefore were likely to contain the entire promoter and regulatory elements of this gene (see below and Fig. 2). Furthermore, the P6 clone contained, following two termination codons, 550 nucleotides of the 3`-untranslated sequences comprising three putative polyadenylation signals (42; see Fig. 2). The ORF in clone P6 contains 560 triplets capable of encoding a 63.4-kDa polypeptide with a predicted pI of 4.25. At its N terminus, the encoded polypeptide displays a putative signal sequence with a probable cleavage site between residues 22 and 23(43) . The predicted polypeptide shares significant identity with the published sequences of calnexin from human (39.4%; (7) ), dog (39.9%; Refs. 3, 12), Arabidopsis thaliana (40.1%; (13) ), Schistosoma mansoni (37.3%; (11) ), and S. cerevisiae (35.2%, (15) ), (see Fig. 2and Fig. 3). Although, the encoded polypeptide also shows 38.4% identity with human calreticulin(17) , it does not contain the ADEL C-terminal sequence, which is the S. pombe variant of the ER retention signal(33, 44) , a hallmark of soluble, ER lumenal proteins. In contrast, the predicted polypeptide displays, close to its C-terminal end, a relatively hydrophobic stretch of 23 residues with the potential to span a membrane, a diagnostic feature of calnexin, a type I protein. Therefore, we conclude that this ORF encodes the S. pombe calnexin homologue. Consistent with the nomenclature used for the A. thaliana species, we designated this S. pombe gene cnx1 and its product Cnx1p. Another set of positive clones contained an ORF with similar sequence at the nucleotide level (approximately 45%; see Fig. 1) with that of cnx1, however, encoding a protein unrelated to either calreticulin or calnexin (data not shown).


Figure 3: Alignment of amino acid sequences of calnexins from human (H), A. thaliana (A), S. pombe (P), S. cerevisiae (Y), and human calreticulin (C). Identical residues are denoted by colons (:), and spaces introduced for sequence alignment are designated by dashes (-). The KPEDWD repeats are shown in solid boxes, whereas less conserved versions of this motif (five matches of a total of 7 residues) are denoted with open circles. Open boxes A-D represent conserved regions among calnexins from different species and human calreticulin, according to the nomenclature in (3) . Amino acids corresponding to predicted transmembrane domains are underlined. The calreticulin amino acid sequences corresponding to probes 126, 2-18, and 2-20 are shown by single-lined, doubled-lined, and dashed arrows, respectively. Computer analyses were done with the GCG package(62) .




Figure 1: Cloning of S. pombe cnx1.A, S. pombe genomic DNA was digested with EcoRI, XbaI, and HindIII (lanes E, X, and H, respectively) and subject to Southern analysis under conditions of reduced stringency of hybridization as described under ``Materials and Methods.'' Probes used were as follows: panel 1, 126 bp; panel 2, 2-18; panel 3, 2-20; panels 4 and 5, 503-bp EcoRI-XbaI fragment from P1 clone (see below). Panel 5 represents a shorter exposure time of panel 4. An EcoRI-XbaI restriction fragment from clone P1 (503 bp; coordinates 569-1072; Fig. 2) was used in panels 4 and 5. Lane M represents molecular mass markers in kb. B, schematic representation of the clones P1 and P6. Relevant restriction enzyme sites are abbreviated as follows: EI, EcoRI; X, XbaI; H, HindIII; B, BglII.



A feature common to both calreticulins and calnexins is the presence of KPEDWD sequence repeats which are generally followed by Glu or Asp residues and sometimes Lys or Arg. The S. pombe calnexin contains three copies of these repeats as well as one less conserved copy, whereas the S. cerevisiae species contains only one copy of the KPEDWD repeat (see Fig. 3). Unlike its animal and plant counterparts, Cnx1p does not contain 2 basic residues at position 3 and 4 (or 5) form its C terminus, which constitutes a motif found in membrane proteins retained in the ER; however, it contains a lysine at position 4(45, 46) . A computer search for putative modifications revealed several potential sites for phosphorylation by casein kinase II (19-SLAD-23, 26-SEQE-29, 77-TVEE-80, 144-THGE-147, 409-SIED-412, 433-SKQE-436, and 481-TIIE-484) and protein kinase C (51-SER-53, 184-SEK-186, 540-TEK-542, and 555-TAK-557). Another feature of the amino acid sequence is the presence of a site for potential N-linked glycosylation at position 418-NETF-421 (see below and Fig. 2).

The S. pombe Calnexin Can Be Glycosylated

In order to assess whether this potential site for N-glycosylation at position 418 is actually functional, a rabbit reticulocyte lysate in vitro translation-processing system was used. To generate full-length and truncated versions of Cnx1p, synthetic cnx1 mRNAs of different lengths were translated in this system in the presence of [S]methionine. Although the predicted molecular mass of 63.4 kDa, translation of the full-length synthetic cnx1 mRNA, in the absence of microsomes, yielded a product that moved on SDS-PAGE with apparent molecular mass of approximately 90 kDa. This anomalous electrophoretic behavior has been previously reported for calnexins and calreticulins, as well as other acidic proteins(17, 47) . Upon in vitro translation in the presence of dog microsomal membranes, an increase in molecular mass of the translation product was observed (compare lanes 1 and 2 in Fig. 4a), which could be reversed when the translation reaction was treated with endoglycosidase-H (Fig. 4a, lane 3). The same phenomenon was observed when a shorter polypeptide (436 amino acid) was synthesized (Fig. 4b, lanes 1-3). In this case we observed a diffused pattern for the translated-translocated product (Fig. 4b, lane 2) which could have resulted from partial glycosylation due to incorrect secondary or tertiary structure of the translation product. It remains possible, however, that this construct is not glycosylated because the glycosylation site, which in this case is close to the C terminus of the polypetide, is embedded either in the microsomal membrane or in the the ribosomal channel. No glycosylation was observed when a shorter protein was synthesized (357 amino acid; see Fig. 4c, lanes 1-3). These results demonstrate that Cnx1p can be glycosylated at a site lying between amino acid 357 and 436 and that most likely no other glycosylation sites are present in this protein.

Cnx1p Is a Type I Membrane Protein

The above described experiments established that Cnx1p is translocated into the lumen of microsomes; however, no cleavage of the putative signal peptide could be detected even with the 357 aa product (see Fig. 4, lanes 1 and 2). We reasoned that this could be due to the relatively small difference in molecular mass between the cleaved and precursor polypeptides. Another possible explanation for the apparent absence of signal peptide cleavage in the 436 and 357 aa constructs is that the efficiency of translocation of these polypeptides into microsomes is low. To resolve this point, we synthesized an even shorter polypeptide, with a length of 151 aa (see Fig. 4d), expecting that the cleavage of the signal peptide from a shorter precursor would be detectable. As shown in lanes 1 and 2 of Fig. 4d, this was the case.

Calnexins from other species were reported to have a type I topology. As mentioned earlier, Cnx1p contains a stretch of 23 relatively hydrophobic amino acids (residues 490-512) with potential to be a membrane-spanning domain, and therefore it was expected that the S. pombe species could also be a type I protein. As a first step to establish the topology of Cnx1p, we investigated whether it was a membrane-integral protein by performing carbonate treatment (41) on the four translation products described above. In this procedure, peripheral proteins are found in the supernatant of carbonate-treated membranes, whereas integral proteins remain in the pellet. When lanes 4 in Fig. 4are examined, it is possible to observe that approximately 50% of the full-length polypeptide (560 aa; Fig. 4a) is found in the membrane pellet, while the shorter polypeptides, which lack the putative transmembrane domain, are found in the supernatant (Fig. 4, lanes 5). The fact that the full-length (560 aa) protein was found distributed between both pellet and supernatant could be due to incomplete precipitation during centrifugation and/or because inefficient integration of the protein in a heterologous in vitro system. These results validate that Cnx1p is an integral membrane protein. To determine the membrane orientation of Cnx1p, trypsin protection assays were performed on in vitro translated-processed products (Fig. 4, lanes 6). As control, this experiment was also carried out in the presence of Triton X-100 to dissolve the microsomes (Fig. 4, lanes 7). Based on the amino acid sequence of Cnx1p, it can be predicted that with a type I orientation, the 48 C-terminal amino acids would be exposed to the cytosolic side of the ER membranes. When the full-length translation product (560 aa) is subjected to trypsin digestion we observed an increase in the polypeptide mobility consistent with the removal of the 48 amino acids at the C-terminal end of Cnx1p. In the presence of detergent, the polypeptides were completely digested with the exception of the processed product of the 151 aa precursor (Fig. 4, lanes 7). The resistance of the latter to trypsin digestion could be due to its folding into a compact structure. We conclude from these experiments that the cnx1 gene product is a type I membrane protein.

cnx1 Expression Is Regulated

Several treatments causing the accumulation of underglycosylated and/or misfolded proteins in the ER, of different organisms, result in the induction of ER chaperone genes (33, 48, 49, 50, 51, 52, 53) . To investigate the regulation of the cnx1 gene, haploid S. pombe cells were subjected to various treatments and subsequently RNA was isolated and analyzed by Northern blotting. The relative intensity of each cnx1 mRNA band was determined and normalized with respect to the values obtained when the same filter was hybridized with an actin probe. A single message of approximately 2 kb was detected in untreated, control cells (Fig. 5A, lane 1). After 5 min of a shift from 30 to 39 °C, the level of cnx1 mRNA increased approximately by 10%. The level of mRNA continued to increase as the heat-shock treatment proceeded, reaching at 60 min a 3.2-fold induction of expression (Fig. 5A, lanes 2-5). Treatment with the antibiotic tunicamycin, an inhibitor of N-linked glycosylation, was not seen to induce cnx1, even at a concentration of 10 µg/ml (Fig. 5A, lane 6). Similarly, human calnexin is also not induced by tunicamycin(1) . Expression of cnx1 was increased as a result of other stresses leading to the accumulation of misfolded proteins. These stresses included treatment with the calcium ionophore A23187 (at 10 µM; 1.9-fold induction; Fig. 5A, lane 7), and beta-mercaptoethanol (at 15 mM; 1.4-fold induction; Fig. 5A, lanes 7 and 8). Likewise, treatment with 2-deoxyglucose at 10 mM results in the increased expression of the cnx1 mRNA (2-fold; compare lanes 9 and 10 in Fig. 5A).


Figure 5: Expression of cnx1 mRNA. A, Northern blot analysis of cnx1 mRNA. Total RNA from S. pombe cultures under different stress conditions was analyzed by Northern blotting as described under ``Materials and Methods.'' A 618-bp EcoRI-ClaI fragment from cnx1 gene (coordinates 455-1072) was used as probe (indicated as cnx1). Lane 1, control cells grown at 30 °C for 2 h; lane 2, 5 min shift from 30 to 39 °C; lanes 3-5, shift from 30 to 39 °C for 10, 30, or 60 min, respectively; lane 6, 2 h in 10 µg/ml tunicamycin at 30 °C; lane 7, 2 h in 10 µM A23187 at 30 °C; lane 8, 2 h in 15 mM beta-mercaptoethanol at 30 °C; lanes 9 and 10, 2 h in presence or absence of 10 mM 2-deoxyglucose at 30 °C, respectively. For quantitation purposes, the relative intensity of each cnx1 mRNA band was determined by soft-LASER densitometric scanning and compared to the values obtained when samples were hybridized with an actin probe (indicated as act1; (63) ). Note that while ethidium bromide staining of the gel showed equivalent loading of total RNA samples (not shown), the three bands corresponding to the 1240, 1650, and 1850 nucleotide long S. pombe actin mRNAs varied with the treatments. B, mapping of transcription initiation sites. Primer extension was performed as described under ``Materials and Methods'' on the same RNA samples as in A.



To identify the cnx1 promoter, we analyzed the sequences upstream of the cnx1 coding region searching for known regulatory sequences. At positions 212 to 207 and 584 to 579, we identified two stretches perfectly matching the consensus for TATA boxes (see Fig. 2; 54). The stretch GTTCCGGAACCTTC (positions 132 to 119; see Fig. 2) closely resembles the consensus for the so-called heat-shock regulatory element found in the promoters of heat-induced genes of different organisms, including S. cerevisiae and S. pombe(33, 48, 49, 50, 53) . The unfolded protein response element is another regulatory sequence, which is distinct from the heat-shock regulatory element, and it also found in the promoter of several ER-protein genes (such as GRP78, KAR2, and EUG1), whose expression is induced upon accumulation of unfolded proteins in this compartment(33, 48, 49, 50, 53, 55, 56) . In the cnx1-promoter region we found the stretch TTCAAAGACTACGAGTATAGC (positions 444 to 427; see Fig. 2), that shows similarity with the consensus unfolded protein response element, and that resembles more closely to the sequence TTCAAAGGCACGCGTGTCC which comprises the unfolded protein response element of the S. cerevisiae EUG1 gene (56; identities are in underlines).

To further define the cnx1 promoter as well as to gain further insight into the regulation of the cnx1 mRNA expression, we performed primer extension experiments with RNA extracted from cells that were exposed to different stress conditions. In these experiments, samples of RNA, isolated as for Northern blot, were subjected to primer extension using an end-labeled oligonucleotide (P1CARC2: 5`-CGAACATATAAAGAGCAC-3`) which anneals to mRNA at position +53 to +36. As shown in Fig. 5B, transcription of the cnx1 mRNA starts at multiple sites. Consistent with the results obtained by Northern blotting we noted that several different treatments induce the expression of cnx1. Moreover, these primer-extension experiments revealed that specific sites are preferentially utilized under different stress conditions. For example, the intensity of the bands corresponding to the 28 and 54 sites increased with the length of the heat shock treatment, whereas the utilization of other sites, under the same conditions, followed a more complex pattern (invariant, increase, and decrease; see Fig. 5B, lanes 1-5). In addition, transcription from start site at 76 becomes apparent upon heat shock and treatment with calcium ionophore A23187 (see Fig. 5B, lanes 4, 5, and 7).

Disruption of the cnx1 Gene

To investigate whether the cnx1 gene is essential for viability in S. pombe, a gene disruption approach was taken (see ``Materials and Methods''). A 333 bp stretch of the cnx1 coding region was deleted and replaced with the S. pombe marker gene ura4 (see ``Materials and Methods'' and Fig. 6C). A DNA fragment carrying the ura4 interrupted cnx1 sequences was transformed into the Ura diploid strain SP629 to achieve the disruption of one the copies of the cnx1 gene by homologous recombination. Ura transformants and the parental strain were analyzed by Southern blotting of genomic DNA, digested with BglII-EcoRI and XbaI-EcoRI, using a probe (618 bp ClaI-EcoRI) encompassing both the deleted region and 285 bp 5` to the deleted region (Fig. 6C). One of the eight Ura transformants analyzed, designated SP5, produced the predicted band of 1.9 kb in addition to the wild type bands of 2.6 kb and 500 bp upon digestion with XbaI-EcoRI (see Fig. 6A, lanes 1 and 2), as well as the predicted band of 2.7 kb in addition to the wild type band of 1.3 kb upon digestion with BglII-EcoRI (Fig. 6A, lanes 3 and 4). A ura4 probe also hybridized to both 1.9 and 2.7 kb bands (data not shown). The heterozygous cnx1-disrupted diploid SP5 was induced to sporulate and subjected to random spore analysis. None of the haploid progeny tested were Ura, indicating that disruption of the cnx1 gene is lethal (see Fig. 6B). To further verify these results, we constructed a haploid strain in which the genomic copy of cnx1 was deleted and complemented by an episomal copy of the gene borne by a plasmid with a ura4 marker. This strain was unable to grow on 5-fluorootic acid plates confirming that calnexin is essential for vegetative growth of S. pombe (data not shown).


DISCUSSION

We report here the isolation of genomic and cDNA clones encoding the S. pombe homologue of the ER chaperone calnexin. As observed previously for other fission yeast gene products(31, 32) , the amino acid sequence of S. pombe calnexin, here designated Cnx1p, is more closely related to plant and animal homologues (identities between 37.3-40.1%) than to the CNE1 protein, the S. cerevisiae counterpart (35.2% identity). Furthermore, Cnx1p shares additional features with its higher eukaryotic homologues. Cnx1p contains three KPEDWD repeats (found also in calreticulins), whereas the S. cerevisiae protein contains a single copy of this motif. Akin to mammalian calnexin but unlike to the arabidopsis protein, Cnx1p moves on SDS-PAGE as a 90 kDa band although its predicted molecular mass is 63.4 kDa, the aberrant migration probably due to its acidic composition (calculated pI = 4.25). As we have shown, Cnx1p has a type I topology, with a 48 amino acid cytoplasmic domain which is similar in length to the arabidopsis protein; however, both are shorter than in the mammalian species. In contrast, according to structural predictions, the cytosolic domain would be absent in the S. cerevisiae protein. The cytosolic domain of mammalian calnexin has been shown to be phosphorylated by casein kinase II, and this phosphorylation was proposed to be involved in the regulation of calnexin function(3, 12) . In this respect, two potential sites for phosphorylation by protein kinase C are found in the cytosolic region of Cnx1p. It was of interest to find that unlike its higher homologues, the Cnx1p protein contains a site for N-glycosylation that was functional in a heterologous, in vitro translation-processing system. The S. cerevisiae protein contains several potential sites for glycosylation; however, no evidence is available if these sites are exposed.

Our studies have shown that disruption of the cnx1 gene has a lethal phenotype in S. pombe, thereby demonstrating that calnexin has an essential function in the vegetative growth of this yeast, probably playing a key role as a component of the machinery controlling correct protein folding in the ER. Moreover, these results strongly indicate that no other functional homologues of calnexin are present in this fission yeast. In addition, Southern blot analysis using as probe the cnx1 gene also indicated that no other genes, with similar sequence, can be detected in this organism. As mentioned above, calreticulin has been found in numerous animal species and recently also in barley, and these proteins show a remarkable degree of conservation. Since in evolutionary terms, yeasts are more closely related to animals than to plants, we expected to find a calreticulin homologue in S. pombe(57) . Therefore, it was rather surprising that we were not able to isolate a gene encoding the S. pombe calreticulin, especially considering that our cloning approach consisted in the screening of libraries by low stringency hybridization, using fragments of a cDNA encoding human calreticulin as probes. The simplest explanation of this result is that the gene encoding the S. pombe calreticulin has a sequence with limited similarity to its homologues from other species. This seems improbable, however, considering the striking sequence conservation among the calreticulins. Thus, it is possible to envision that the Cnx1p protein performs the function of both calreticulin and calnexin in S. pombe.

As other chaperones of the ER, the expression of cnx1 was induced when cells were subjected to a variety of stresses causing the accumulation of misfolded and aggregated proteins in the ER, such as heat shock as well as treatments with calcium ionophore A23187, beta-mercaptoethanol, and 2-deoxyglucose. In the promoter region of cnx1, we noted sequences resembling regulatory boxes, such as the heat-shock regulatory element and the unfolded protein response element, that were previously identified in the promoters of other stress-induced genes (33, 49, 50, 53) and are likely to be involved in the control of cnx1 expression. Additionally, the stress treatments used in this study differentially affected the utilization of certain among the multiple cnx1 transcription-initiation sites, probably reflecting the binding of the stress-related transcription factors to different sites. A fascinating question is how the signal indicating accumulation of unfolded proteins in the ER is transmitted to the nucleus to induce there the expression of ER chaperone genes. In S. cerevisiae, the gene ERN1/IRE1 has been identified as being required for this signal transduction pathway(51, 52) . ERN1/IRE1 encodes a type I integral protein of the ER, whose luminal N-terminal portion is glycosylated and whose C-terminal region contains a cdc2/CDC28-related kinase activity. It was proposed (51, 52) that accumulation of misfolded proteins causes a ligand-mediated dimerization of Ern1p/Ire1p, which in turn activates its cytosolic kinase domain and that initiates the signal transduction cascade. A similar mechanism would also be expected to occur in S. pombe and other organisms. However, additional signaling pathways/factors should be present, since cnx1 is induced by 2-deoxyglucose but not by tunicamycin, whereas the expression of S. pombe and S. cerevisiae BiP is induced by both inhibitors(33, 49, 50) . In this context, it should be noted that these inhibitors differ in their mode of action, tunicamycin inhibits the synthesis of the dolichyl-PP-GlcNAc(2)Man(9)Glc(3) precursor, and, consequently, no oligosaccharide is transferred onto the asparagine side chain of the target proteins(58) . On the other hand, 2-deoxyglucose could be incorporated into glycoproteins and probably inhibit the deglucosylation-reglucosylation (trimming) of newly synthesized glycoproteins(58, 59, 60) . Therefore, the signaling pathway inducing cnx1 expression responds to the accumulation of misfolded-partially folded glycosylated proteins, as those resulting from treatments such as heat-shock, beta-mercaptoethanol, and 2-deoxyglucose. In contrast, no signal for the induction of cnx1 expression is produced when non-glycosylated, malfolded proteins are accumulated in the ER, as in the case of treatment with tunicamycin. Mammalian calnexin has been shown to be a chaperone with selectivity for glycosylated proteins, as this molecular chaperone does not bind nascent proteins when cells are treated with tunicamycin nor non-glycosylated proteins such as serum albumin(1, 2, 8, 9, 10) . Based on the observation that glucosidase inhibitors also obliterate the interaction of nascent proteins with calnexin(8, 55) , Helenius and collaborators have proposed a model in which newly synthesized glycoproteins must be mono-glucosylated in order to bind to calnexin(2, 9, 10) . As observed by Parodi et al.(61) , these mono-glucosylated glycoproteins are produced during the deglucosylation-reglucosylation trimming cycle, carried out on partially folded glycoproteins by the glucosydases I and II, and UDP-glucose:glycoprotein glucosyltransferase. Thereby, mono-glucosylation would be an indication of incomplete folding (61) and thus according to Helenius' model, partially trimmed glycoproteins could be recognized and bound by calnexin(2, 9, 10) . Although it remains to be proven, Cnx1p probably has the same substrate selectivity as its mammalian counterparts. Thus the protein involved in the first step of the transducing pathway that signals accumulation of unfolded proteins and that induces the expression of the cnx1 gene would have the same specificity as Cnx1p. It is therefore tempting to speculate that this sensor protein could be Cnx1p itself and that it would communicate the first signal via its cytosolic domain. Furthermore, the state of phosphorylation of the Cnx1p cytosolic domain could modulate the recruitment of factor(s) involved in this transduction pathway.

The availability of a genetic system for the S. pombe calnexin homologue Cnx1p opens new avenues of research to perform structure-function studies on calnexin and to elucidate its functional relationship with calreticulin, as well as to delineate the mechanisms controlling the unfolded protein response in the fission yeast.


FOOTNOTES

*
This work was supported by research grants from the Medical Research Council of Canada and Faculté de Médecine, Université de Montréal (to L. A. R.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank(TM)/EMBL Data Bank with accession number(s) U13389[GenBank].

§
To whom correspondence should be addressed: Département de biochimie, Université de Montréal, C. P. 6128, Succursale Centre-ville, Montréal, Québec H3C 3J7, Canada. Tel.: 514-343-6324; Fax: 514-343-6069; rokeach{at}bch.umontreal.ca.

(^1)
The abbreviations used are: ER, endoplasmic reticulum; PAGE, polyacrylamide gel electrophoresis; kb, kilobase(s); bp, base pair(s); ORF, open reading frame; aa, amino acid(s).

(^2)
A. M. Carr, personal communication.

(^3)
F. Lacroute, unpublished results.


ACKNOWLEDGEMENTS

We express our gratitude to Drs. David Beach, Antony Carr, and Paul Nurse for providing plasmids, strains, and advice, as well as to Dr. Dan McCollum for the gift of the actin probe. We also thank Drs. Guy Boileau and Tim Littlejohn for critical reading of the manuscript.


REFERENCES

  1. Bergeron, J. J. M., Brenner, M. B., Thomas, D. Y., and Williams, D. B. (1994) Trends Biochem. Sci. 19, 124-128 [CrossRef][Medline] [Order article via Infotrieve]
  2. Hammond, C. and Helenius, A. (1993) Curr. Biol. 3, 884-886
  3. Wada, I., Rindress, D., Cameron, P. H., Ou, W. J., Doherty II, J. J., Louvard, D., Bell, A. W., Dignard, D., Thomas, D. Y., and Bergeron, J. J. M. (1991) J. Biol. Chem. 266, 19599-19610 [Abstract/Free Full Text]
  4. Degen, E., and Williams, D. B. (1991) J. Cell Biol. 112, 1099-1115 [Abstract/Free Full Text]
  5. Hochstenbach, F., David, V., Watkins, S., and Brenner, M. B. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 4734-4738 [Abstract/Free Full Text]
  6. Galvin, K., Krishna, S., Ponchell, F., Frohlich, M., Cummings, D. E., Carlson, R., Wands, J. R., Isselbacher, K. J., Pillai, S., and Ozturk, M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 8452-8456 [Abstract/Free Full Text]
  7. Ahluwalia, N., Bergeron, J. J. M., Wada, I., Degen, E., and Williams, D. B. (1992) J. Biol. Chem. 267, 10914-10918 [Abstract/Free Full Text]
  8. Ou, W. J., Cameron, P. H., Thomas, D. Y., and Bergeron, J. J. M. (1993) Nature 364, 771-776 [CrossRef][Medline] [Order article via Infotrieve]
  9. Hammond, C., Braakman, I., and Helenius, A. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 913-917 [Abstract/Free Full Text]
  10. Helenius, A. (1994) Mol. Biol. Cell 5, 253-265 [Medline] [Order article via Infotrieve]
  11. Hawn, T. R., Tom, T. D., and Strand, M. (1993) J. Biol. Chem. 268, 7692-7698 [Abstract/Free Full Text]
  12. Cala, S. E., Ulbright, C., Kelley, J. S., and Jones, L. R. (1993) J. Biol. Chem. 268, 2969-2975 [Abstract/Free Full Text]
  13. Huang, L., Franklin, A. E., and Hoffman, N. E. (1993) J. Biol. Chem. 268, 6560-6566 [Abstract/Free Full Text]
  14. David, V., Hochstenbach, F., Rajagopalan, S., and Brenner, M. B. (1993) J. Biol. Chem. 268, 9585-9592 [Abstract/Free Full Text]
  15. De Virgilio, C., Burckert, N., Neuhaus, J. M., Boller, T., and Wiemken, A. (1993) Yeast 9, 185-188 [CrossRef][Medline] [Order article via Infotrieve]
  16. Michalak, M., Milner, R. E., Burns, K., and Opas, M. (1992) Biochem. J. 285, 681-692
  17. Rokeach, L. A., Haselby, J. A., Meilof, J. F., Smeenk, R. J. T., Unnasch, T. R., Greene, B. M., and Hoch, S. O. (1991) J. Immunol. 147, 3031-3039 [Abstract]
  18. Kennedy, T. E., Kuhl, D., Barzilai, A., Sweat, J. D., and Kandel, E. E. R. (1992) Neuron 9, 1013-1024 [CrossRef][Medline] [Order article via Infotrieve]
  19. Smith, M. J. (1992) DNA Sequence 2, 235-240 [Medline] [Order article via Infotrieve]
  20. Khalife, J., Trottein, F., Schacht, A. M., Godin, C., Pierce, R. J., and Capron, A. (1993) Mol. Biochem. Parasitol. 57, 193-202 [CrossRef][Medline] [Order article via Infotrieve]
  21. Chen, F., Hayes, P. M., Mulrooney, D. M., and Pan, A. (1994) Plant Cell 6, 835-843 [Abstract]
  22. Unnasch, T. R., Gallin, M. Y., Soboslay, P. T., Erttmann, K. D., and Greene, B. M. (1988) J. Clin. Invest. 82, 262-269
  23. Rokeach, L. A., Zimmerman, P. A., and Unnasch, T. R. (1994) Infect. Imunn. 62, 3696-3704 [Abstract/Free Full Text]
  24. Smith, M. J., and Koch, G. L. E. (1989) EMBO J. 8, 3581-3586 [Medline] [Order article via Infotrieve]
  25. Burns, K., Atkinson, E. A., Bleackley, R. C., and Michalak, M. (1994) Trends Cell Biol. 4, 152-154 [CrossRef][Medline] [Order article via Infotrieve]
  26. Dedhar, S. (1994) Trends Biochem. Sci. 19, 269-271 [CrossRef][Medline] [Order article via Infotrieve]
  27. Rojiani, M. V., Finlay, B. B., Gray, V., and Dedhar, S. (1991) Biochemistry 30, 9859-9865 [CrossRef][Medline] [Order article via Infotrieve]
  28. Leung-Hagesteijn, C. Y., Milankov, K., Michalak, M., Wilins, J., and Dedhar, S. (1994) J. Cell Sci. 107, 589-600 [Abstract]
  29. Burns, K., Duggan, B., Atkinson, E. A., Famulski, K. S., Nemer, M., Bleackley, R. C., and Michalak, M. (1994) Nature 367, 476-480 [CrossRef][Medline] [Order article via Infotrieve]
  30. Dedhar, S., Rennie, P. S., Shago, M., Leung Hagesteijn, C.-Y., Yang, H., Filmus, J., Hawley, R. G., Bruchovsky, N., Cheng, H., Matusik, R. J., and Giguère, V. (1994) Nature 367, 480-483 [CrossRef][Medline] [Order article via Infotrieve]
  31. Moreno, S., Klar, A., and Nurse, P. (1991) Methods Enzymol. 194, 795-823 [Medline] [Order article via Infotrieve]
  32. Russel, P. (1989) in Molecular Biology of the fission yeast (Nasim, A., Young, P., and Johnson, B. F., eds) pp. 243-271, Academic Press, Inc., San Diego, CA
  33. Pidoux, A. L., and Armstrong, J. (1992) EMBO J. 11, 1583-1591 [Medline] [Order article via Infotrieve]
  34. Armstrong, J., Craighead, M. W., Watson, R., Ponnambalam, S., and Bowden, S. (1993) Mol. Biol. Cell 4, 583-592 [Abstract]
  35. Chappell, T. G., and Warren, G. (1989) J. Cell Biol. 109, 2693-2702 [Abstract/Free Full Text]
  36. Moreno, S., Ruiz, T., Sanchez, Y., Villanueva, J. R., and Rodriguez, L. (1985) Arch. Microbiol. 14, 370-374 [CrossRef]
  37. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  38. Rokeach, L. A., Jannatipour, M., Haselby, J. A., and Hoch, S. O. (1989) J. Biol. Chem. 264, 5024-5030 [Abstract/Free Full Text]
  39. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1988) Current Protocols in Molecular Biology , Greene Associates and Wiley-Interscience, New York
  40. Laemmli, U. K. (1970) Nature 227, 680-685 [CrossRef][Medline] [Order article via Infotrieve]
  41. Brown, D. J., Hogue, B. G., and Nayak, D. P. (1988) J. Virol. 62, 3824-3831 [Abstract/Free Full Text]
  42. Birnstiel, M. L., Busslinger, M., and Strub, K. (1985) Cell 41, 349-359 [CrossRef][Medline] [Order article via Infotrieve]
  43. Watson, M. E. E. (1984) Nucleic Acids Res. 12, 5145-5161 [Free Full Text]
  44. Munro, S., and Pelham, H. R. B. (1987) Cell 48, 899-907 [CrossRef][Medline] [Order article via Infotrieve]
  45. Jackson, M. R., Nilsson, T., and Peterson, P. A. (1990) EMBO J. 9, 3153-3162 [Medline] [Order article via Infotrieve]
  46. Shin, J., Dunbrack, R. L., Lee, S., and Strominger, J. L. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 1918-1922 [Abstract/Free Full Text]
  47. Rokeach, L. A., Haselby, J. A., and Hoch, S. O. (1991) Protein Eng. 4, 981-987 [Abstract/Free Full Text]
  48. Kohno, K., Normington, K., Sambrook, J., Gething, M. J., and Mori, K. (1993) Mol. Cell. Biol. 13, 877-890 [Abstract/Free Full Text]
  49. Normington, K., Kohno, K., Kozutsumi, Y., Gething, M. M., and Sambrook, J. (1989) Cell 57, 1223-1236 [CrossRef][Medline] [Order article via Infotrieve]
  50. Rose, M. D., Misra, L. M., and Vogel, J. P. (1989) Cell 57, 1211-1221 [CrossRef][Medline] [Order article via Infotrieve]
  51. Cox, J. S., Shamu, C. E., and Walter, P. (1993) Cell 73, 1197-1206 [CrossRef][Medline] [Order article via Infotrieve]
  52. Mori, K., Ma, W., Gething, M.-J., and Sambrook, J. (1993) Cell 74, 743-756 [CrossRef][Medline] [Order article via Infotrieve]
  53. Partaledis, J. A., and Berlin, V. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 5450-5454 [Abstract/Free Full Text]
  54. Faisst, S., and Meyer, S. (1992) Nucleic Acids Res. 20, 3-26 [Free Full Text]
  55. Resendez, E., Wooden, S. K., and Lee, A. S. (1988) Mol. Cell. Biol. 8, 4579-4584 [Abstract/Free Full Text]
  56. Tachibana, C., and Stevens, T. H. (1992) Mol. Cell. Biol. 12, 4601-4611 [Abstract/Free Full Text]
  57. Wainright, P. O., Hinkle, G., Sogin, M. L., and Stickel, S. K. (1993) Science 260, 340-342 [Abstract/Free Full Text]
  58. Elbein, A. D. (1987) Annu. Rev. Biochem. 56, 497-534 [CrossRef][Medline] [Order article via Infotrieve]
  59. Steiner, S., Courtney, R. J., and Melnick, J. L. (1973) Cancer Res. 33, 2402-2407 [Abstract/Free Full Text]
  60. Scharz, R. T., Schmidt, M. F. G., Anwer, U., and Klenk, H.-D. (1977) J. Virol. 23, 217-226 [Abstract/Free Full Text]
  61. Sousa, M. C., Ferrero-Garcia, M. A., and Parodi, A. J. (1992) Biochemistry 31, 97-105 [CrossRef][Medline] [Order article via Infotrieve]
  62. Devereux, J., Haeberli, P., and Smithies, O. (1984) Nucleic Acids Res. 12, 387-395
  63. Mertins, P., and Gallwitz, D. (1987) Nucleic Acids Res. 15, 7369-7379 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Cell Sci.Home page
P. B. Beauregard, R. Guerin, C. Turcotte, S. Lindquist, and L. A. Rokeach
A nucleolar protein allows viability in the absence of the essential ER-residing molecular chaperone calnexin
J. Cell Sci., May 1, 2009; 122(9): 1342 - 1351.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
R. Guerin, G. Arseneault, S. Dumont, and L. A. Rokeach
Calnexin Is Involved in Apoptosis Induced by Endoplasmic Reticulum Stress in the Fission Yeast
Mol. Biol. Cell, October 1, 2008; 19(10): 4404 - 4420.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
D. B. Williams
Beyond lectins: the calnexin/calreticulin chaperone system of the endoplasmic reticulum
J. Cell Sci., February 15, 2006; 119(4): 615 - 623.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
X. Xu, K. Kanbara, H. Azakami, and A. Kato
Expression and Characterization of Saccharomyces cerevisiae Cne1p, a Calnexin Homologue
J. Biochem., May 1, 2004; 135(5): 615 - 618.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
P. Collin, P. B. Beauregard, A. Elagoz, and L. A. Rokeach
A non-chromosomal factor allows viability of Schizosaccharomyces pombe lacking the essential chaperone calnexin
J. Cell Sci., February 22, 2004; 117(6): 907 - 918.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
I. Conte, C. Labriola, J. J. Cazzulo, R. Docampo, and A. J. Parodi
The Interplay between Folding-facilitating Mechanisms in Trypanosoma cruzi Endoplasmic Reticulum
Mol. Biol. Cell, September 1, 2003; 14(9): 3529 - 3540.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. D'Alessio, E. S. Trombetta, and A. J. Parodi
Nucleoside Diphosphatase and Glycosyltransferase Activities Can Localize to Different Subcellular Compartments in Schizosaccharomyces pombe
J. Biol. Chem., June 13, 2003; 278(25): 22379 - 22387.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. Boisrame, M. Chasles, A. Babour, J.-M. Beckerich, and C. Gaillardin
Sbh1p, a subunit of the Sec61 translocon, interacts with the chaperone calnexin in the yeast Yarrowia lipolytica
J. Cell Sci., March 14, 2003; 115(24): 4947 - 4956.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Denzel, M. Molinari, C. Trigueros, J. E. Martin, S. Velmurgan, S. Brown, G. Stamp, and M. J. Owen
Early Postnatal Death and Motor Disorders in Mice Congenitally Deficient in Calnexin Expression
Mol. Cell. Biol., November 1, 2002; 22(21): 7398 - 7404.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
H. L. Roderick, J. D. Lechleiter, and P. Camacho
Cytosolic Phosphorylation of Calnexin Controls Intracellular Ca2+ Oscillations via an Interaction with SERCA2b
J. Cell Biol., June 12, 2000; 149(6): 1235 - 1248.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
W. T. Doerrler and M. A. Lehrman
Regulation of the dolichol pathway in human fibroblasts by the endoplasmic reticulum unfolded protein response
PNAS, November 9, 1999; 96(23): 13050 - 13055.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. D'Alessio, F. Fernandez, E. S. Trombetta, and A. J. Parodi
Genetic Evidence for the Heterodimeric Structure of Glucosidase II. THE EFFECT OF DISRUPTING THE SUBUNIT-ENCODING GENES ON GLYCOPROTEIN FOLDING
J. Biol. Chem., September 3, 1999; 274(36): 25899 - 25905.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
C. Labriola, J. J. Cazzulo, and A. J. Parodi
Trypanosoma cruzi Calreticulin Is a Lectin That Binds Monoglucosylated Oligosaccharides but Not Protein Moieties of Glycoproteins
Mol. Biol. Cell, May 1, 1999; 10(5): 1381 - 1394.
[Abstract] [Full Text]


Home page
J. Cell Sci.Home page
A Elagoz, M Callejo, J Armstrong, and L. Rokeach
Although calnexin is essential in S. pombe, its highly conserved central domain is dispensable for viability
J. Cell Sci., January 12, 1999; 112(23): 4449 - 4460.
[Abstract] [PDF]


Home page
JCBHome page
S. Fanchiotti, F. Fernandez, C. D'Alessio, and A. J. Parodi
The UDP-Glc:Glycoprotein Glucosyltransferase Is Essential for Schizosaccharomyces pombe Viability under Conditions of Extreme Endoplasmic Reticulum Stress
J. Cell Biol., November 2, 1998; 143(3): 625 - 635.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
P. S. Kim and P. Arvan
Endocrinopathies in the Family of Endoplasmic Reticulum (ER) Storage Diseases: Disorders of Protein Trafficking and the Role of ER Molecular Chaperones
Endocr. Rev., April 1, 1998; 19(2): 173 - 202.
[Abstract] [Full Text]


Home page
Plant CellHome page
X. Li, R. T. C. Su, H.-t. Hsu, and H. Sze
The Molecular Chaperone Calnexin Associates with the Vacuolar H+-ATPase from Oat Seedlings
PLANT CELL, January 1, 1998; 10(1): 119 - 130.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jannatipour, M.
Right arrow Articles by Rokeach, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jannatipour, M.
Right arrow Articles by Rokeach, L. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement