|
Volume 271,
Number 1,
Issue of January 5, 1996 pp. 120-123
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
Characterization
of a CO-responsive Transcriptional Activator from Rhodospirillum
rubrum(*)
(Received for publication, October 10, 1995; and in revised form, October 30, 1995)
Yiping
He
(1),
Daniel
Shelver
(1),
Robert
L.
Kerby
(1), (2),
Gary
P.
Roberts
(1)(§)From the
(1)Departments of Bacteriology and
(2)Biochemistry, University of Wisconsin, Madison,
Wisconsin 53706
 ABSTRACT
- INTRODUCTION
- EXPERIMENTAL PROCEDURES
- RESULTS
- DISCUSSION
- FOOTNOTES
- ACKNOWLEDGEMENTS
- REFERENCES
ABSTRACT 
In Rhodospirillum rubrum, CO induces the expression of
at least two transcripts that encode an enzyme system for CO oxidation.
This regulon is positively regulated by CooA, which is a member of the
cAMP receptor protein family of transcriptional regulators. The
transcriptional start site of one of the transcripts (cooFSCTJ) has been identified by primer extension. The
ability of CooA to bind to this promoter in vitro was
characterized with DNase I footprinting experiments using extracts of a
CooA-overproducing strain. CooA- and CO-dependent protection was
observed for a region with 2-fold symmetry
(5`-TGTCA-N -CGACA) that is highly similar to the consensus
core motifs recognized by cAMP receptor protein/FNR family. In vivo analysis in a heterologous background indicates that CooA is
sufficient for CO-dependent expression, implicating it as the likely CO
sensor.
INTRODUCTION
Exposure of the purple nonsulfur bacterium Rhodospirillum
rubrum to CO stimulates the expression of the coo regulon, which consists of at least two transcriptional units.
Among the products of this regulon are a carbon monoxide dehydrogenase
(CooS), an Fe-S protein (CooF), and a hydrogenase (CooH), where the two
former proteins have been purified and
characterized(1, 2, 3, 4, 5, 6) .
This CO-oxidizing system functions under anaerobic conditions to
oxidize CO to CO , allowing growth on CO as sole energy
source(7) . The cooFSCTJ region has been cloned,
sequenced, and mutationally characterized, verifying the requirement
for the encoded products for oxidation of CO(7, 8) . ( ) The mutational analysis has also indicated that cooFSCTJ is organized in a single transcriptional unit.cooH lies at the 3` terminus of the other known
CO-regulated transcript, but this transcript has not yet been fully
sequenced at the 5` end. cooH is located 5` of cooF and is separated from it by 450 nucleotides of noncoding DNA (Fig. 1B).
Figure 1:
Identification of the transcriptional
start site for cooF. Panel A shows the result of
primer extension of the region upstream of cooF. A 22-mer
oligonucleotide (Primer 2), which is complementary to the coding strand
in region -154 to -133 relative to the translational start
site of cooF was 5`-end-labeled and used to prime the reverse
transcriptase reaction. The sequencing ladder (G, A, T, C) used the
same primer but was not end-labeled. +CO refers to RNA
extracted from R. rubrum cells induced with CO, while the
-CO lane refers to RNA from uninduced cells. Asterisks indicate the 5`-end of the major and minor RNA
species detected. The fact that the primer for the reverse
transcription was end-labeled and the one for sequencing was not caused
a one-base shift in reading the transcriptional start site. Panel B provides a schematic of the region upstream of cooF. The
space between the cooH and cooF genes is 450 bp. The
transcriptional start site predicted by the major RNA species from panel A is indicated, as is the region protected in the
footprinting experiments shown in Fig. 2A. Boldface letters in the CooA target region represent a 2-fold symmetric
sequence that is highly similar to the consensus sequence motif
recognized by CRP/FNR (Fig. 2B). The underlined CG and GG residues at -13, -14, -25, and
-26 are characteristic of   -dependent
promoters.
Figure 2:
Identification of the CooA binding site. Panel A shows the result of a DNase I footprinting experiment.
A 294-bp EcoRV-EagI fragment containing the promoter
region of cooF was used in this assay. CooA refers to extracts of UR407 (cooA::aacC1) and CooA refers
to extracts of UR459 (the CooA-overproducer with cooA under
PnifH control). The numbers reflect micrograms of protein in
each assay, and the + and - on the line labeled CO reflect the presence or absence of CO in the binding reaction; all
experiments were performed anoxically. The G+A lane
represents the Maxam-Gilbert sequencing marker. The box on the
right side indicates the region protected in this experiment. Panel
B shows a comparison of the CRP and FNR consensus binding sites
with the detected CooA-binding site.
Our previous mutational studies revealed
that CooA, ()which is apparently encoded on it own
transcript on the 3` side of cooFSCTJ, is essential for the
expression of the coo regulon of R. rubrum in
response to CO(9) . The sequence of CooA predicts that it is a
member of the CRP/FNR family of transcriptional regulators(9) ,
with a putative DNA-binding domain that is highly similar to that found
in CRP and FNR. Modeling the sequence of CooA on the known CRP crystal
structure (10) predicts the presence of four Cys and one His
residues adjacent to the region known to bind cAMP in CRP(9) .
These residues suggest the possibility that CooA contains a metal
center at this position, which might be expected if CooA binds CO. A
particularly interesting question in this area is how the binding of a
molecule as small as CO might induce a similar conformation change in
CooA as that caused by cAMP binding in CRP. To test the model of
CooA as a CO-binding transcriptional activator, we have sought evidence
for CO- and CooA-dependent DNA binding. The results described herein
support the above model, and the assay of DNA-binding activity of CooA
will aid in the purification of CooA for more direct analysis.
EXPERIMENTAL PROCEDURES
Growth of Bacterial StrainsR. rubrum strains were grown photoheterotrophically in SMN (supplemented
malate-ammonium) medium supplemented with 10 µM NiCl in stoppered serum vials with an argon head space(8) . For RNA isolation, cultures to be CO-induced were grown
photoheterotrophically to an optical density of 1 at 680 nm, whereupon
CO was added to a final concentration of 30%; uninduced culture
received no additions. The cultures were agitated under illumination (8) for 6 h. The CooA-overexpressing strain (UR459) was
grown under nif-derepression conditions in malate-glutamate
medium (11) to an OD of 2.0, and the expression
of nifH promoter was monitored by nitrogenase activity (12) .
RNA ExtractionTotal cellular RNA was isolated by
repeated phenol extraction as described previously (13) with
the following modifications. After addition of 1.5 ml of lysis solution
to 6 ml of culture, the mixture was boiled for 90 s and extracted with
phenol 3 times. Purified RNA was dissolved in 100 µl of 10 mM Tris-Cl (pH 8.0).
Primer Extension of mRNATwo synthetic
oligonucleotide primers (Operon Technologies Inc.) were used: Primer 1
(5`-GATCGGGATTGGCGTAGATG) is complementary to the coding strand in
region +27 to +46 (numbering relative to the translational
start codon of cooF) and Primer 2 (5`-GAATTAACGCCACCCCTGTTCG)
is complementary to the coding strand in region -154 to
-133. Primers were labeled at their 5`-ends with
[ - P]ATP using T4 polynucleotide
kinase(14) . The primer extension was performed as described (15) except that 25 µg of total RNA was mixed with 0.25
pmol of -P-labeled primer. The extended products were
analyzed by electrophoresis on a 6% polyacrylamide-urea gel.
Construction of Plasmids for Heterologous
ExpressionPlasmid pCO6R (9) was processed through a
number of steps to delete coo DNA outside the region of
interest (data not shown), creating two derivatives. In both, the
5`-end of the coo DNA was at a newly created BamHI
site at position -72 relative to the transcriptional start of cooF. The clone carrying cooFSCTJ had a 3`-end 113 bp
downstream of the translational stop of cooJ, while the clone
carrying cooFSCTJA had a 3`-end 272 bp downstream of the
translational stop of cooA. The gentamycin-resistance 
cassette of pGM1 (16) was then inserted at the BamHI site, and the inserts were excised by PvuII,
isolated, ligated into BamHI-cut (Klenow polymerase-blunted)
pRK404E1 ( )to generate plasmids pCO46R (cooFSCTJ)
and pCO47R (cooFSCTJA). These plasmids were subsequently
transformed into UQ324 (17) and mated to Rhodobacter
sphaeroides 2.4.1 (UR363) by the usual method, ( )with
selection for resistance to tetracycline (1 µg/ml) and tellurite
(KTeO, 10 µg/ml)(18) , generating
strains UR453 (pCO46R) and UR454 (pCO47R).
CO Dehydrogenase AssayCooS activity with the
CO-dependent reduction of methyl viologen was measured by the plate
overlay assay (9) or by a spectrophotometric
method(8) . Briefly, R. sphaeroides strains UR363,
-453, and -454 were cultivated aerobically in SMN medium containing 2
µg/ml tetracycline then transferred to anaerobic SMN medium
supplemented with 10 µM nickel for overnight
photosynthetic growth. Cultures were then diluted to an OD = 1.0 and cultivated in the presence or absence of CO for
4 h prior to lysis and CO dehydrogenase assays. 50% of the UR453 and
UR454 clones remained tetracycline-resistant under these assay
conditions.
Overexpression of CooA in R. rubrumTo overexpress
CooA in R. rubrum, a plasmid fusing P to cooA was constructed and introduced to R. rubrum in the following manner. pDWS119(9) , a pUX19-derived
plasmid that carries cooA, was digested with BamHI
and XmnI. The resulting 6348-bp fragment, which carries cooA, a portion of the putative cooA promoter, and
the vector portion of pDWS119, was ligated to the 412-bp BamHI-HincII fragment from pUX111 (19) that
carries the R. rubrum nifH promoter region (20) and
the 5`-portion of the nifH coding region of R.
rubrum, creating pDWS126.The P and nifH coding material remaining in pDWS126 (77 bp total) was deleted to
create a junction between the ribosome binding site of nifH and the initiation codon of cooA in the following way. A
primer,
5`-CGATGTTGAAACGAGGCGGCATGGAATCAATCCTTTTCTTCGGTGATCCGGTCTTAAGGCGGG,
(double underline indicates a base change (C to T) from the wild-type
P region to create a new AflII site (single
underline)) was synthesized (Genosys Biotechnologies) and used for
site-directed mutagenesis by a modification of the unique site
elimination procedure(21) , utilizing a single primer
incorporating the desired deletion as well as a selectable restriction
site (Bsu36I) loss. The desired plasmid (pDWS131) was
identified by the presence of an new site in the plasmid (AflII) derived from the primer. The P region
and cooA on pDWS131 were verified by sequencing in one
direction. pDWS131, which is a mobilizeable plasmid that does not
replicate in R. rubrum, was used to transform Escherichia coli strain S17-1(17) , and the
resulting strain was mated with R. rubrum strain UR2 (coo ). Strains with pDWS131
integrated into the UR2 chromosome by homologous recombination were
selected for kanamycin (15 µg/ml). A single transconjugant, R.
rubrum strain UR459, was used for further study.
Crude Extract PreparationCultures were harvested
by centrifugation at 4,800  g for 15 min, and all
handling of extracts utilized anoxic technique due to concern over the
possible O-lability of CooA. The cell pellets were
resuspended in buffer A (25 mM MOPS (pH 7.4), 1 mM phenylmethanesulfonyl fluoride, 1 mg/ml leupeptin, 1.7 mM sodium dithionite, 1 mM dithiothreitol) and passed
through a French press at 16,000 p.s.i. The mixture was centrifuged at
13,200 g for 1 h to remove the debris. The
supernatant, to which glycerol was added to 5% (w/v) for storage, was
used for the DNA-binding assay. The total protein concentration was
determined by the Bradford dye binding procedure (22) using the
protein assay dye reagent concentrate (Bio-Rad).
DNase I FootprintingA 294-bp EcoRV-EagI fragment (Fig. 1B), which
contains the P region, was used for both DNase I
footprinting and gel retardation assays. This fragment was isolated
from a pBSKS(-)-derivative (Stratagene), pCO17, which contains a
portion of the coo region from pLJC24(23) . The
fragment was uniquely 3`-end-labeled in the coding strand by filling
the EagI end with [ -P]dGTP and
Sequenase, followed by purification via polyacrylamide gel
electrophoresis (14) and an Elutip Minicolumn (Schleicher &
Schuell). DNase I footprinting analysis of the P region
was performed as described previously (24) with the following
modifications. The sealed tubes used for the protein-DNA binding
reaction were degassed, and the head space was filled with argon. The
DNA binding reactions were done under stringently anoxic conditions in
the buffer B (20 mM Tris-HCl (pH 7.6), 7 mM
MgCl, 50 mM KCl, 7 mM dithiothreitol, 50
µg/ml bovine serum albumin, 5% (w/v) glycerol) supplemented with
1.7 mM sodium dithionite in the presence or absence of CO.
After 5-10 pmol of DNA was incubated with various amount of
extracts in a 20-µl volume at room temperature for 20 min, the
mixtures were treated with 2 units/ml RQ RNase-free DNase I (Promega)
for 30 s. DNase I cleavage products were separated on a 6% (w/v)
polyacrylamide-urea gel.
Gel Retardation AssayRadiolabeled DNA fragments
were prepared similar to those in the footprinting experiment. The
DNA-binding reactions were performed anoxically in the same buffer and
at the same temperature used in the footprinting assays. The samples
were applied to an anoxic 5% polyacrylamide gel (37.5:1 acrylamide/bis
ratio) in standard 1 Tris borate/EDTA buffer (14) with
1.7 mM sodium dithionite. After prerunning at 180 V for 1.5 h,
the upper running buffer was changed once in order to maintain strictly
anoxic conditions. The electrophoresis was performed at 180 V for 3 h
in 4 °C.
RESULTS
Location of a CO-induced 5`-End mRNA of cooFIn
order to identify the coo promoter upstream of cooF and to determine the effect of CO on its expression, we performed
primer extension analysis on coo mRNA from both CO-induced and
uninduced wild-type R. rubrum (strain UR2). Initially, we used
a primer (Primer 1) that hybridized near the beginning of cooF coding region. The extension product suggested that the 5`-end of
the cooF mRNA was approximately 250 nucleotides upstream from
the translational start site of cooF. This signal was present
only in the CO-induced sample, and no other primer extension products
were observed (data not shown).In order to more precisely identify
the 5`-end of the cooF mRNA, a second primer (Primer 2) was
designed that hybridized about 150 nucleotides upstream of cooF coding region. Results with this primer showed that the major
transcript from the cooF promoter initiates with the A
nucleotide positioned 257 bp upstream from the start codon of cooF. A minor product starting six nucleotides upstream of
that site was also observed. These primer extension products were only
detectable in the CO-induced culture (Fig. 1A),
indicating that the effect of CO is on the accumulation of coo mRNA. Fig. 1B shows a schematic of the
transcription start site relative to other features in the region,
including the putative CooA-binding site (see below).
CooA Is Sufficient for CO-dependent Expression in a
Heterologous SystemAs noted above, mutant analysis has shown
that CooA is necessary for CO-dependent expression(9) . To test
the possibility that CooA was sufficient for the response, consistent
with the hypothesis that it was actually the CO sensor, two derivatives
of plasmid pRK were created. The first carried cooFSCTJ (pCO46R), and the second contained cooFSCTJA (pCO47R).
These two constructs were introduced into E. coli and R.
sphaeroides and were tested for their ability to produce CO
dehydrogenase in response to CO. The E. coli strains showed no
detectable CO dehydrogenase activity by the plate overlay assay (data
not shown). Likewise, the R. sphaeroides strain (UR453) with
pCO46R and the parent strain (UR363) accumulated no CO dehydrogenase
activity detectable by either the plate overlay assay or the in
vitro spectrophotometric assay. In contrast, the R.
sphaeroides strain with pCO47R, upon CO induction, produced
detectable CO dehydrogenase (0.23 µmol of CO
oxidized/min/OD) in the spectrophotometric assay. Because R. sphaeroides lacks an endogenous coo system, it is
likely that CooA is the CO sensor in this heterologous system.
Overexpression of CooA in R. rubrumWe expected
that CooA, as a regulatory protein, would be nonabundant and thus
anticipated that its activity would be difficult to detect in crude
extracts. Consequently, we overexpressed CooA in R. rubrum from the R. rubrum nifH promoter and ribosome binding
site. This promoter, which is active when R. rubrum is grown
under nitrogen-fixing conditions, has been successfully used in our lab
to overproduce nonabundant regulatory proteins (19) and has the
potential to produce 1% of total cell protein. Construction of the
P::cooA fusion and its integration into R.
rubrum, creating strain UR459, are described under
``Experimental Procedures.''Extracts of UR459
(P::cooA) were examined by SDS-polyacrylamide
gel for the presence of a protein band corresponding to CooA. The
extracts of UR2 and UR407 (cooA::aacC1)(9) ,
grown under the same conditions as UR459, were used as controls, as
CooA was deficient in UR407 and is not expected to be detectable in
UR2. A band migrating at about 25 kDa, the predicted molecular mass of
CooA, was significantly more intense in extracts of UR459 than in those
of UR2 or UR407 (data not shown).
CooA- and CO-dependent DNA BindingTo test the
hypothesis that CooA is a CO-sensing transcriptional activator, in
vitro interactions between CooA and the promoter region of cooF were investigated with or without CO. A 294-bp EcoRV-EagI fragment, which contains the cooF promoter region from position -248 to +46 (Fig. 1B), was used as a probe in both DNase I
footprinting and gel retardation assays. Crude extracts of strains that
overproduce CooA (UR459), lack CooA (UR407), and have the normal low
level (UR2) were prepared anoxically, due to concern that CooA might be
O-labile. All protein-DNA binding reactions were also kept
under stringently anoxic and reduced conditions.In DNase I
protection experiments (Fig. 2A), a specific pattern of
protection was detected only with extracts from the CooA-overproducing
strain in the presence of CO. No protection was observed in the same
extract in the absence of CO, nor in the extract of the cooA mutant (UR407) regardless of the presence of CO in the binding
reaction. This protection was not detectable with extracts of wild-type
in presence of CO (data not shown), presumably due to low levels of
CooA. The site protected by CooA covers 28 bases (position -27
to -54) and contains a sequence of 2-fold symmetry (Fig. 1B) that is highly similar to the consensus
sequence motif recognized by CRP/FNR in E. coli (Fig. 2B). Gel retardation analysis with the
same DNA fragment and extracts also revealed a DNA-protein complex
whose presence requires both CooA and CO (data not shown). This CooA-
and CO-dependent complex is very large; it remained in the wells of a
5% polyacrylamide (19:1 acrylamide/bis ratio) gel but entered a 5%
polyacrylamide (37.5:1 acrylamide/bis ratio) gel, suggesting the
presence of additional proteins in this complex.
DISCUSSION
Our previous mutational studies and sequence analysis of cooA led us to predict that CooA is a CO-sensing
transcriptional activator similar to CRP and FNR. The work presented in
this paper and elsewhere strongly supports the hypothesis that CooA is
a CO-sensing protein responsible for controlled expression of the coo region in a fashion reminiscent of the action of CRP: (i)
Northern blot analysis and primer extension experiments
demonstrate that CO affects mRNA accumulation; (ii) CooA is sufficient
for CO-dependent expression in R. sphaeroides; (iii) DNA
binding appears to be CooA- and CO-dependent in vitro; (iv)
the detected CooA target site is very similar to the CRP/FNR consensus
binding site; and (v) CooA is very similar to CPR and FNR in the
helix-turn-helix DNA binding domain(9) . We initially looked
for the CooA-binding site by both footprinting and gel retardation
assays in the 250-bp EagI-BsmI region immediately
upstream of cooF (Fig. 1B), in part because a
strain (UR284) with an insertion at the EagI site (Fig. 1B) displayed CooS activity in a CO-dependent
manner(8) . We now believe that the observed expression in
UR284 reflects transcription from P through the
Kan insertion; the Kan gene is derived from
pUC4K and apparently lacks transcriptional terminators. No CooA- or
CO-dependent DNA binding could be found between the EagI site
and cooF (data not shown), however, and the transcriptional
start site identified in this paper is clearly the physiologically
significant one in vivo. While the detected transcription
start lacks the -10 and -35 sequences expected at a typical E. coli  promoter, a typical E. coli recognition sequence is present, with GC and
GG at -13 and -25, respectively (25) (Fig. 1B). An interaction of CooA with
would be interesting as no CRP- or FNR-controlled
promoters are known to be recognized by . The
center of the two-fold symmetry of the CooA binding site is at
-43.5 with respect to the transcriptional start point of cooF. This distance is similar to the location of the CRP
sites in class II CRP-dependent promoters (e.g. galP 1) and
FNR sites in the FNR-dependent promoters(26, 27) . In
CRP, the specific interaction between the side chains of the protein
and a given base within the core motif 5`-TGTGA-3` have been
reviewed(28, 29) : Arg-180 and Glu-181 directly
contact the 5`-G and the nucleotide of complementary to the 3`-G,
respectively. It is possible that Arg-177 of CooA, which is in the
homologous position of Arg-180 of CRP, contacts the 5`-G of the CooA
target site 5`-TGTCA-3`. The absence of a Glu in CooA corresponding to
Glu-181 in CRP is consistent with the fact that there is a 3`-C instead
of a 3`-G in the CooA target site (Fig. 2B). We are
currently employing the described gel shift as a functional assay for
the purification of CooA. Analysis of the purified protein, together
with the eventual determination of the CooA-regulated promoter upstream
of cooH, will significantly increase our understanding of this
regulatory response.
FOOTNOTES
- *
- This work was supported by
the College of Agricultural and Life Sciences, University of Wisconsin,
Madison; by Department of Energy Grant 94ER13691; and by National
Institutes of Health Grant GM53228. The costs of publication of this
article were defrayed in part by the payment of page charges. This
article must therefore by hereby marked
``advertisement'' in accordance with 18 U.S.C.
Section 1734 solely to indicate this fact.
- §
- To whom correspondence should be addressed.
Tel.: 608-262-3567; Fax: 608-262-9865; groberts@bact.wisc.edu.
- ()
- R. L. Kerby and G. P. Roberts, unpublished data.
- ()
- The abbreviations used are: CooA, CO oxidation
activator; CRP, cAMP receptor protein; bp, base pair(s); MOPS,
5-morpholinepropanesulfonic acid.
- ()
- L. Leman and
G. P. Roberts, unpublished data.
- ()
- D. P. Lies,
personal communication.
ACKNOWLEDGEMENTS
We thank Marcin Filutowicz for valuable discussions
and Holly Simon, Jon Roll, Mary Homer, Yaoping Zhang, and Marjeta Urh
for technical assistance and helpful discussions.
REFERENCES
- Bonam, D., Lehman, L.,
Roberts, G. P., and Ludden, P. W. (1989) J. Bacteriol. 171, 3102-3107
[Abstract/Free Full Text]
- Bonam, D., and Ludden, P.
W. (1987) J. Biol. Chem. 262, 2980-2987
[Abstract/Free Full Text]
- Bonam, D., McKenna, M.,
Stephens, P., and Ludden, P. W. (1988) Proc. Natl.
Acad. Sci. U. S. A. 85, 31-35
[Abstract/Free Full Text]
- Ensign, S. A., Bonam, D.,
and Ludden, P. W. (1989) Biochemistry 28, 4968-4973
[CrossRef][Medline]
[Order article via Infotrieve]
- Ensign, S. A., Hyman, M.
R., and Ludden, P. W. (1989) Biochemistry 28, 4973-4979
[CrossRef][Medline]
[Order article via Infotrieve]
- Ensign, S. A., and
Ludden, P. W. (1991) J. Biol. Chem. 266, 18395-18403
[Abstract/Free Full Text]
- Kerby, R. L., Ludden, P.
W., and Roberts, G. P. (1995) J. Bacteriol. 177, 2241-2244
[Abstract/Free Full Text]
- Kerby, R. L., Hong, S.
S., Ensign, S. A., Coppoc, L. J., Ludden, P. W., and Roberts, G. P. (1992) J. Bacteriol. 174, 5284-5294
[Abstract/Free Full Text]
- Shelver, D., Kerby, R.
L., He, Y.-P., and Roberts, G. P. (1995) J. Bacteriol. 177, 2157-2163
[Abstract/Free Full Text]
- Weber, I. T., and
Steitz, T. A. (1987) J. Mol. Biol. 198, 311-326
[CrossRef][Medline]
[Order article via Infotrieve]
- Lehman, L., and Roberts,
G. P. (1991) J. Bacteriol. 173, 5705-5711
[Abstract/Free Full Text]
- Kanemoto, R. H., and
Ludden, P. W. (1984) J. Bacteriol. 158, 713-720
[Abstract/Free Full Text]
- Sarmientos, P.,
Sylvester, J. E., Contente, S., and Cashel, M. (1983) Cell 32, 1337-1346
[CrossRef][Medline]
[Order article via Infotrieve]
- Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , Cold Spring Harbor
Laboratory, Cold Spring Harbor, NY
- Josaitis, C. A., Gall,
T., and Gourse, R. L. (1995) Proc. Natl. Acad. Sci. U.
S. A. 92, 1117-1121
[Abstract/Free Full Text]
- Schwiezer, H. P. (1993) BioTechniques 15, 831-833
[Medline]
[Order article via Infotrieve]
- Simon, R., Priefer, U.,
and Pühler, A. (1983) Bio/Technology 1, 784-791
[CrossRef]
- Mackenzie, C.,
Chidambaram, M., Sodergren, E. J., Kaplan, S., and Weinstock, G. M. (1995) J. Bacteriol. 177, 3027-3035
[Abstract/Free Full Text]
- Grunwald, S. K., Lies,
D. P., Roberts, G. P., and Ludden, P. W. (1995) J.
Bacteriol. 177, 628-635
[Abstract/Free Full Text]
- Lehman, L., Fitzmaurice,
W. P., and Roberts, G. P. (1990) Gene (Amst.) 95, 143-147
- Win, P. D., and
Nickoloff, J. A. (1992) Anal. Biochem. 200, 81-88
[CrossRef][Medline]
[Order article via Infotrieve]
- Bradford, M. M. (1976) Anal. Biochem. 72, 248-254
[CrossRef][Medline]
[Order article via Infotrieve]
- Coppoc, L. J. (1991) Studies Concerning the Carbon Monoxide Dehydrogenase of
Rhodospirillum rubrum. M.Sc. thesis, University of Wisconsin,
Madison, WI
- Filutowicz,
M., Uhlenhopp, E., and Helinski, D. R. (1985) J. Mol.
Biol. 187, 225-239
- Morett, E., and Buck, M. (1989) J. Mol. Biol. 210, 65-77
[CrossRef][Medline]
[Order article via Infotrieve]
- Ebright, R. H. (1993) Mol. Microbiol. 8, 797-802
[Medline]
[Order article via Infotrieve]
 CiteULike  Complore  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
R. L. Kerby, H. Youn, and G. P. Roberts
RcoM: A New Single-Component Transcriptional Regulator of CO Metabolism in Bacteria
J. Bacteriol.,
May 1, 2008;
190(9):
3336 - 3343.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
O. V. Moskvin, S. Kaplan, M.-A. Gilles-Gonzalez, and M. Gomelsky
Novel Heme-based Oxygen Sensor with a Revealing Evolutionary History
J. Biol. Chem.,
September 28, 2007;
282(39):
28740 - 28748.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Youn, M. V. Thorsteinsson, M. Conrad, R. L. Kerby, and G. P. Roberts
Dual Roles of an E-Helix Residue, Glu167, in the Transcriptional Activator Function of CooA
J. Bacteriol.,
April 15, 2005;
187(8):
2573 - 2581.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Yamashita, Y. Hoashi, Y. Tomisugi, Y. Ishikawa, and T. Uno
The C-helix in CooA Rolls upon CO Binding to Ferrous Heme
J. Biol. Chem.,
November 5, 2004;
279(45):
47320 - 47325.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Youn, R. L. Kerby, and G. P. Roberts
Changing the Ligand Specificity of CooA, a Highly Specific Heme-based CO Sensor
J. Biol. Chem.,
October 29, 2004;
279(44):
45744 - 45752.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. P. Roberts, H. Youn, and R. L. Kerby
CO-Sensing Mechanisms
Microbiol. Mol. Biol. Rev.,
September 1, 2004;
68(3):
453 - 473.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Puranik, S. B. Nielsen, H. Youn, A. N. Hvitved, J. L. Bourassa, M. A. Case, C. Tengroth, G. Balakrishnan, M. V. Thorsteinsson, J. T. Groves, et al.
Dynamics of Carbon Monoxide Binding to CooA
J. Biol. Chem.,
May 14, 2004;
279(20):
21096 - 21108.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Youn, R. L. Kerby, M. Conrad, and G. P. Roberts
Functionally Critical Elements of CooA-Related CO Sensors
J. Bacteriol.,
March 1, 2004;
186(5):
1320 - 1329.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Youn, R. L. Kerby, and G. P. Roberts
The Role of the Hydrophobic Distal Heme Pocket of CooA in Ligand Sensing and Response
J. Biol. Chem.,
January 17, 2003;
278(4):
2333 - 2340.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Voordouw
Carbon Monoxide Cycling by Desulfovibrio vulgaris Hildenborough
J. Bacteriol.,
November 1, 2002;
184(21):
5903 - 5911.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Youn, R. L. Kerby, M. V. Thorsteinsson, R. W. Clark, J. N. Burstyn, and G. P. Roberts
Analysis of the L116K Variant of CooA, the Heme-containing CO Sensor, Suggests the Presence of an Unusual Heme Ligand Resulting in Novel Activity
J. Biol. Chem.,
September 6, 2002;
277(37):
33616 - 33623.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Leduc, M. V. Thorsteinsson, T. Gaal, and G. P. Roberts
Mapping CooA{middle dot}RNA Polymerase Interactions. IDENTIFICATION OF ACTIVATING REGIONS 2 AND 3 IN CooA, THE CO-SENSING TRANSCRIPTIONAL ACTIVATOR
J. Biol. Chem.,
October 19, 2001;
276(43):
39968 - 39973.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. He, T. Gaal, R. Karls, T. J. Donohue, R. L. Gourse, and G. P. Roberts
Transcription Activation by CooA, the CO-sensing Factor from Rhodospirillum rubrum. THE INTERACTION BETWEEN CooA AND THE C-TERMINAL DOMAIN OF THE alpha SUBUNIT OF RNA POLYMERASE
J. Biol. Chem.,
April 16, 1999;
274(16):
10840 - 10845.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Aono, K. Ohkubo, T. Matsuo, and H. Nakajima
Redox-controlled Ligand Exchange of the Heme in the CO-sensing Transcriptional Activator CooA
J. Biol. Chem.,
October 2, 1998;
273(40):
25757 - 25764.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Uchida, H. Ishikawa, S. Takahashi, K. Ishimori, I. Morishima, K. Ohkubo, H. Nakajima, and S. Aono
Heme Environmental Structure of CooA Is Modulated by the Target DNA Binding. EVIDENCE FROM RESONANCE RAMAN SPECTROSCOPY AND CO REBINDING KINETICS
J. Biol. Chem.,
August 7, 1998;
273(32):
19988 - 19992.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. K. Watt and P. W. Ludden
The Identification, Purification, and Characterization of CooJ. A NICKEL-BINDING PROTEIN THAT IS CO-REGULATED WITH THE Ni-CONTAINING CO DEHYDROGENASE FROM RHODOSPIRILLUM RUBRUM
J. Biol. Chem.,
April 17, 1998;
273(16):
10019 - 10025.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Shelver, R. L. Kerby, Y. He, and G. P. Roberts
CooA, a CO-sensing transcription factor from Rhodospirillum rubrum, is a CO-binding heme protein
PNAS,
October 14, 1997;
94(21):
11216 - 11220.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. V. Kwiatkowski and J. P. Shapleigh
Requirement of Nitric Oxide for Induction of Genes Whose Products Are Involved in Nitric Oxide Metabolism in Rhodobacter sphaeroides 2.4.3
J. Biol. Chem.,
October 4, 1996;
271(40):
24382 - 24388.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Yamamoto, H. Ishikawa, S. Takahashi, K. Ishimori, I. Morishima, H. Nakajima, and S. Aono
Binding of CO at the Pro2 Side Is Crucial for the Activation of CO-sensing Transcriptional Activator CooA. 1H NMR SPECTROSCOPIC STUDIES
J. Biol. Chem.,
April 6, 2001;
276(15):
11473 - 11476.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Nakajima, Y. Honma, T. Tawara, T. Kato, S.-Y. Park, H. Miyatake, Y. Shiro, and S. Aono
Redox Properties and Coordination Structure of the Heme in the CO-sensing Transcriptional Activator CooA
J. Biol. Chem.,
March 2, 2001;
276(10):
7055 - 7061.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Kumazaki, H. Nakajima, T. Sakaguchi, E. Nakagawa, H. Shinohara, K. Yoshihara, and S. Aono
Dissociation and Recombination between Ligands and Heme in a CO-sensing Transcriptional Activator CooA. A FLASH PHOTOLYSIS STUDY
J. Biol. Chem.,
December 1, 2000;
275(49):
38378 - 38383.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. V. Thorsteinsson, R. L. Kerby, H. Youn, M. Conrad, J. Serate, C. R. Staples, and G. P. Roberts
Redox-mediated Transcriptional Activation in a CooA Variant
J. Biol. Chem.,
July 13, 2001;
276(29):
26807 - 26813.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Nakajima, E. Nakagawa, K. Kobayashi, S.-i. Tagawa, and S. Aono
Ligand-switching Intermediates for the CO-sensing Transcriptional Activator CooA Measured by Pulse Radiolysis
J. Biol. Chem.,
October 5, 2001;
276(41):
37895 - 37899.
[Abstract]
[Full Text]
[PDF]
|
|
|
Copyright © 1996 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|
