| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
(Received for publication, September 1,
1995; and in revised form, November 27, 1995) From the
Mitogen-activated protein/ERK kinase kinases (MEKKs)
phosphorylate and activate protein kinases which in turn phosphorylate
and activate the p42/44 mitogen-activated protein kinase (MAPK),
c-Jun/stress-activated protein kinases (JNKs), and p38/Hog1 kinase. We
have isolated the cDNAs for two novel mammalian MEKKs (MEKK 2 and 3).
MEKK 2 and 3 encode proteins of 69.7 and 71 kDa, respectively. The
kinase domains encoded in the COOH-terminal moiety are 94% conserved;
the NH A variety of extracellular signals including growth factors,
hormones, cytokines, antigens, and stresses such as heat shock and
osmotic imbalance activate members of the mitogen-activated protein
kinase (MAPK) ( Raf-1
and B-Raf are serine/threonine-protein kinases that selectively
phosphorylate and activate MEK 1 and MEK
2(14, 15, 16, 17) . Recently, we
isolated the cDNA for a novel serine/threonine-protein kinase referred
to as MEK kinase (MEKK 1) that phosphorylates and activates MEK 1 and 2
and JNKKs(13, 18, 19, 20) . The
catalytic domain of MEKK 1 is homologous to the kinase domains of the
Ste11 and Byr2 serine/threonine-protein kinases, involved in the
control of mating in Saccharomyces cerevisiae and Schizosaccharomyces pombe,
respectively(21, 22, 23) . In this report, we
have isolated and expressed the cDNAs for two new MEKK proteins. MEKK 2
and 3, when expressed in cells, are similar to MEKK 1 in that they are
capable of regulating MEK and JNKK activities. Thus, there exists a
family of MEKKs controlling sequential protein kinase systems involving
MAPK members in addition to the Raf family of protein kinases.
Figure 5:
Selective regulation of p42/44
To demonstrate MEKK activation of JNKK activity, the in vitro kinase reactions were performed with different combinations of
recombinant wild type or kinase-inactive JNKK (lysine 116 mutated to
methionine) and wild type or kinase-inactive JNK. Kinase-inactive JNK
was made by mutating the active site lysine 55 to methionine (provided
by Dr. Matt Jarpe). Incubations were for 30 min at 30 °C in the
presence of 50 µM ATP.
GST-c-Jun
Figure 1:
DNA and deduced amino acid
sequences for MEKK 2 and 3. A, MEKK 2; B, MEKK 3.
In-frame stop codons 5` to the predicted start methionine are underlined.
The 5` ends of both MEKK 2 and 3 are
highly G/C-rich making DNA sequencing difficult. To verify the presence
of stop codons in all three possible reading frames 5` to the predicted
start site methionine, the MEKK 2 and 3 cDNAs were inserted in pRSET A,
B, and C (Invitrogen) and expressed in Escherichia coli (not
shown). Each construct gave a truncated RSET fragment confirming that
the MEKK 2 and 3 cDNAs encoded 5` stop sites and that the isolated
cDNAs encode full-length proteins. Alignment of the deduced amino
acid sequences demonstrated significant homology between the two
proteins (Fig. 2A). Overall, the two proteins are
approximately 77% homologous. The catalytic domain is encoded in the
COOH-terminal moiety of both MEKK 2 and 3. The first consensus kinase
domain (32) comprising the catalytic site of MEKK 2 and 3
begins at residues 361 and 367, respectively. The COOH-terminal
catalytic domains of MEKK 2 and 3 are approximately 94% conserved,
whereas the NH
Figure 2:
Comparison of amino acid sequences for
MEKK 2 and 3. A, amino acids not having homology are boxed in the alignment of MEKK 2 and 3. B, alignment of the
catalytic domains for MEKK 1, 2, and 3. Roman numerals indicate the 11 conserved regions within the protein kinase
catalytic domain, with the most highly conserved residues underlined(32) . Lowercase letters represent
nonconserved amino acids in one or more of the MEKK
sequences.
Fig. 2B shows the alignment of MEKK 1, 2,
and 3 catalytic domains. The 11 conserved subdomains comprising the
protein kinase catalytic domain are designated by Roman numerals. The
COOH terminus of MEKK 1 encoding the catalytic domain is only 50%
homologous to the corresponding regions of MEKK 2 and 3. Thus, the
catalytic domains of MEKK 2 and 3 are very similar to each other but
significantly divergent from MEKK 1. As shown below, MEKK 1, 2, and 3
can all stimulate JNK and p42/44
Figure 3:
Stimulation of JNK activity in MEKK 2 and
3 transfected HEK293 cells. Cells were harvested 48 h post-transfection
and assayed for GST-c-Jun phosphorylating activity by mixing of lysates
with a slurry of GST-c-Jun-Sepharose (A). Alternatively,
lysates were fractionated using a 0-0.5 M NaCl linear
gradient on a Mono Q ion exchange column before assay with
GST-c-Jun-Sepharose as substrate (B).
Transient expression of MEKK 2 and 3
also stimulated p42/44
Figure 4:
MAPK activity in HEK293 cells transfected
with MEKK 2 and 3. Cells were harvested 48 h post-transfection, and
lysates were fractionated using a linear 0-0.5 M NaCl
gradient on a Mono Q ion exchange column. p42/44
Figure 6:
Phosphorylation of recombinant MEK 1 and
JNKK by immunoprecipitated MEKK 2. A, HEK293 cells were
transfected with pCMV5 alone(-) or encoding HA epitope-tagged
MEKK 2 or 3. Forty-eight h post-transfection, cells were lysed, and
MEKK 2 and 3 were immunoprecipitated using the 12CA5 monoclonal
antibody. Immunoprecipitates were then assayed for kinase activity
using recombinant kinase-inactive MEK 1 or JNKK as substrate. The JNKK
only lane shows the low level of autophosphorylation of recombinant
JNKK. Results are representative of 5-6 experiments for both MEKK
2 and 3. B, MEKK 2 phosphorylation of JNKK stimulates JNK
kinase activity. MEKK 2 immunoprecipitates were incubated with the
indicated combinations of wild-type or kinase-inactive JNKK and JNK as
described under ''Materials and Methods.
Gst-c-Jun
Figure 7:
Measurement of p38 kinase activation in
MEKK 2 and 3 transfected cells. A, stimulation of p38 kinase
activity in response to sorbitol. HEK293 cells were incubated for 20
min with 0.4 M sorbitol. Cells were then lysed, and p38 was
immunoprecipitated using a rabbit antisera raised against a
COOH-terminal peptide sequence of p38. Recombinant ATF 2 was used in an in vitro kinase assay as a substrate for p38 as described
under ``Materials and Methods.'' The results are
representative of two independent experiments. B, HEK293 cells
were transfected with pCMV5 plasmids encoding no cDNA or MEKK 2 or 3.
Lysates were prepared 48 h post-transfection and fractionated using a
0-0.5 M NaCl gradient on a Mono Q ion exchange column.
Fractions were assayed for kinase activity using recombinant ATF 2 as
substrate. JNK and p38 were identified in the column fractions by
immunoblotting using specific antibodies for JNK and p38 (not
shown).
The cloning and characterization of MEKK 2 and 3 define a
family of MEKK proteins. MEKK 1, 2, and 3 are all capable of regulating
both p42/44 Based on the biochemical characterization of MEKK proteins,
it is evident that their activities are quite distinct from those of
Raf-1 and B-Raf kinases. The Raf kinases selectively regulate MEK 1 and
2 and do not recognize the JNKK
proteins(1, 14, 20, 33, 34, 35) .
Thus, Raf proteins which evolved in metazoan organisms appear to be
highly selective for the regulation of p42/44 The ability of MEKKs to
regulate multiple sequential protein kinase pathways in the cell
suggests that a different mechanism exists for their regulation
compared to the Raf kinases. The simplest prediction would be that MEKK
proteins are selectively organized in ``signalsome''
complexes much like that for the mating pathway in S.
cerevisiae. In this pathway, the protein kinases Ste11
(MEKK-like), Ste7 (MEK-like), and Fus3 (MAPK-like) are held together in
a high affinity complex by Ste5(36, 37, 38) .
Ste5 functions as a scaffold to keep these proteins in an organized
complex. Expression of gain-of-function Ste11 mutants can result in
overcoming a threshold where Ste11 crosses over to activate another
sequential protein kinase pathway such as that involved in
morphogenesis(21, 22, 23) . No Ste5
equivalent has yet been reported for mammalian cells and MEKKs. If such
scaffold-like proteins do exist in mammalian cells and their expression
is limiting, it would explain the ability of transiently expressed
MEKKs to regulate both JNK and p42/44 Finally, the MEKK/JNK pathways can be activated by a
diverse set of stimuli. These include cytokines such as TNF and
IL-1(39) , low molecular weight GTP-binding regulatory proteins
including Ras, Rac, and Cdc42(40, 41) , high
intracellular calcium(42) , and stresses such as ultraviolet
light, heat shock, osmotic imbalance, sphingomyelinase activity,
protein synthesis inhibitors,
etc.(1, 8, 13, 14, 20) .
Based on this array of stimuli capable of activating JNK, it is likely
that several independent pathways converge to regulate the JNK
sequential protein kinase pathway. It is possible that MEKK 1, 2, and 3
may all regulate the JNK pathway and each functions to respond to
different upstream inputs. Alternatively, it is possible that MEKK 1, 2
and 3 are not only capable of regulating the JNK pathway but also other
sequential protein kinase pathways as well. Such a mechanism would
allow co-ordinate regulation of both the JNK pathway and additional
parallel sequential protein kinase pathways in the cell. In support of
this hypothesis, we have found that MEKK 1 also selectively regulates a
protein kinase pathway leading to the phosphorylation and
transactivation of c-Myc that is independent of JNK and
c-Jun(35) . The magnitude of a specific MEKK activation in
response to a stimulus could selectively regulate different pathways
such as those for JNK and c-Myc kinase activity by requiring different
thresholds of MEKK activity to be obtained for stimulation of each
pathway. The thresholds for MEKK regulation of these pathways might be
regulated in part by the relative abundance or cellular localization of
specific signalsome complexes. The cloning of MEKK 2 and 3 allows us to
now address these potential regulatory mechanisms for the three MEKK
proteins using both genetic and biochemical approaches. The nucleotide
sequence(s) reported in this paper has been submitted to the
GenBank(TM)/EMBL Data Bank with accession number(s) U43186 [GenBank](MEKK 2) and U43187 [GenBank](MEKK 3).
Volume 271,
Number 10,
Issue of March 8, 1996 pp. 5361-5368
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
REGULATION OF SEQUENTIAL PHOSPHORYLATION PATHWAYS INVOLVING
MITOGEN-ACTIVATED PROTEIN KINASE AND c-Jun KINASE (*)
-terminal moieties are approximately 65% homologous,
suggesting this region may encode sequences conferring differential
regulation of the two kinases. Expression of MEKK 2 or 3 in HEK293
cells results in activation of p42/44 and JNK but not of
p38/Hog1 kinase. Immunoprecipitated MEKK 2 phosphorylated the MAP
kinase kinases, MEK 1, and JNK kinase. Titration of MEKK 2 and 3
expression in transfection assays indicated that MEKK 2 preferentially
activated JNK while MEKK 3 preferentially activated
p42/44
. These findings define a family of MEKK proteins
capable of regulating sequential protein kinase pathways involving MAPK
members.
)family(1, 2, 3, 4, 5) .
MAPKs are characterized as serine/threonine-protein kinases activated
by dual phosphorylation on both a tyrosine and a threonine(6) .
The MAPK family includes p42/44 (also referred to as
ERK2 and -1)(7) , the c-Jun kinases (JNKs which are also
referred to as stress-activated protein kinases)(8) , and p38,
the osmotic imbalance responsive kinase similar to the yeast Hog1
enzyme(5) . The regulation of different MAPKs including
p42/44
, JNKs, and p38 involves sequential protein kinase
pathways whose upstream activators include the MEKs (MAPK/ERK kinases)
and the JNK kinases (also referred to as SEKs or stress/ERK
kinases)(9, 10, 11, 12, 13) .
MEKs and JNK kinases (JNKKs) phosphorylate specific MAPK family members
on both a tyrosine and threonine resulting in MAPK activation.
Isolation of MEKK 2 and 3 cDNAs
The degenerate
primers GA(A/G)(C/T)TIATGGCIGTIAA(A/G)CA (sense) and
TTIGCICC(T/C)TTIAT(A/G)TCIC(G/T)(A/G)TG (antisense) were used in a
polymerase chain reaction (PCR) using first strand cDNA generated from
polyadenylated RNA prepared from NIH 3T3 cells. The PCR reaction
involved 30 cycles (1 min, 94 °C; 2 min, 52 °C; 3 min, 72
°C) followed by a 10-min cycle at 72 °C. A band of
approximately 300 base pairs was recovered from the PCR mixture, and
the products were cloned into pGEM-T (Promega). The PCR cDNA products
were sequenced and compared to the MEKK 1 sequence(19) . A
unique cDNA sequence of 322 base pairs having significant homology to
MEKK 1 cDNA was identified and used to screen an oligo(dT)-primed mouse
brain cDNA library (Stratagene). The phage library was plated,
and DNA from plaques were transferred to Hybond N filters (Amersham)
followed by UV-cross-linking of DNA to the filters. Filters were
prehybridized for 2 h and then hybridized overnight in 0.5 M Na
HPO
(pH 7.2), 10% bovine
serum albumin, 1 mM EDTA, 7% SDS at 68 °C. Filters were
washed twice at 42 °C with 2 
SSC, once with 1 SSC,
and once with 0.5 SSC containing 0.1% SDS (1 SSC is
0.15 M NaCl, 0.015 M sodium citrate, pH 7.0).
Positive hybridizing clones were purified and sequenced. To resolve
GC-rich regions, cDNAs were subcloned into M13 vectors (New England
Biolabs), and single strand DNA was sequenced. In all cases, both
strands of DNA were sequenced.Plasmid Expression of MEKK 2 and 3
The proteins
for MEKK 2 and 3 were epitope-tagged at their NH terminus
with the hemagglutinin (HA)-tag sequence GYPYDVPDYAS (24) using
a PCR strategy as described previously(25) . For inserting the
NH-terminal epitope tag in MEKK 2 and 3, sense
oligonucleotides were synthesized having a methionine codon (ATG), 33
bases coding for the GYPYDVPDYAS epitope-tag sequences, and 20 bases of
MEKK 2 or 3 sequence starting at codon 2. For MEKK 2, the sense
oligonucleotide was
ATGGGGTACCCGTACGACGTGCCGGACTACGCTTCCGATGATCAGCAAGCTTTGAA. The sense
oligonucleotide for MEKK 3 was
ATGGGGTACCCGTACGACGTGCCGGACTACGCTTCCGATGAACAAGAGGCATTAGA. The antisense
oligonucleotides for MEKK 2 and 3 were AGACTTAGATCTCAGGTCTTC encoding a BglII site for MEKK 2 and GATTCTGACGTCACTCTGCCT encoding an AatII site for MEKK 3. The PCR reactions were performed for 30
cycles using MEKK 2 or MEKK 3 cDNAs as template. The PCR products were
purified, and a second PCR reaction was performed using the first PCR
product as template, the MEKK 2 or 3 antisense oligonucleotide
described above and the common sense oligonucleotide encoding a XbaI restriction site, a consensus Kozak initiation site and
17 bases overlapping with the initiation methionine, and HA-tag
sequence (TGACGTTCTAGAGCCACCATGGGGTACCCGTACGA). The resulting PCR
products were digested with XbaI and BglII for MEKK 2
and XbaI and AatII for MEKK 3 and ligated in-frame
into the appropriate MEKK 2 or 3 cDNA. The sequences were confirmed by
DNA sequencing, and the cDNAs were inserted into the expression plasmid
pCMV5. HEK293 cells were transfected with pCMV5 expression plasmids
using LipofectAMINE (Life Technologies, Inc.) and assayed 48 h later.
The 12CA5 monoclonal antibody (Berkeley Antibody Co.) was used for
recognition of the HA epitope tag encoded in expressed MEKK 2 and 3.Antibody Production
Peptides corresponding to
COOH-terminal sequences of MEKK 3 (CEARQRPSAEELLTHHFAQ) and p38
(CFVPPPLDQEEMES) were conjugated to keyhole limpet hemocyanin and used
to immunize rabbits. Antisera were characterized for specificity by
immunoblotting of lysates prepared from appropriately transfected
HEK293 cells.Assay of JNK Activity
JNK activity was measured
using GST (glutathione S-transferase)-c-Jun coupled to glutathione-Sepharose 4B(26) . Cells
transfected with MEKK 2 or 3 and control transfected cells were lysed
in 0.5% Nonidet P-40, 20 mM Tris
HCl, pH 7.6, 0.25 M NaCl, 3 mM EDTA, 3 mM EGTA, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 2
mM sodium vanadate, 20 µg/ml aprotinin, and 5 µg/ml
leupeptin. Nuclei were removed by centrifugation at 15,000 g for 10 min, and the supernatants (25 µg of protein) were
mixed with 10 µl of a slurry of
GST-c-Jun-Sepharose (3-5 µg of
GST-c-Jun
). The mixture was rotated at 4 °C
for 1 h, washed twice in lysis buffer and once in kinase buffer (20
mM Hepes, pH 7.5, 10 mM MgCl
, 20 mM 
-glycerophosphate, 10 mMp-nitrophenyl
phosphate, 1 mM dithiothreitol, 50 µM sodium
vanadate). Beads were suspended in 40 µl of kinase assay buffer
containing 10 µCi of [-
P]ATP and
incubated at 30 °C for 20 min. Reaction mixtures were added to
Laemmli sample buffer, boiled, and phosphorylated proteins were
resolved on SDS-10% polyacrylamide gels. When JNK activity was assayed
following fractionation by Mono Q ion exchange chromatography, 50
µl of each fraction was incubated with the
GST-c-Jun
beads.
p42/44
MAPK activity
following Mono Q FPLC fractionation was measured as described
previously (28) using the epidermal growth factor receptor
662-681 peptide as a selective p42/44 Assay
substrate(29) . Alternatively, for cells transfected with
varying amounts of MEKK plasmids (Fig. 5), MAPK activity was
assayed after elution from DEAE-Sephacel columns(30) .
and JNK by MEKK 2 and 3. HEK293 cells were transfected with 5, 1,
0.25, 0.05, and 0.01 µg of plasmid DNA encoding either MEKK 2 or 3.
Cells were harvested 48 h post-transfection and assayed for both JNK
and p42/44
activity. The results are representative of
two independent experiments for both MEKK 2 and 3. B, MEKK 2
phosphorylation of JNKK stimulates JNK kinase activity. MEKK 2
immunoprecipitates were incubated with the indicated combinations of
wild-type or kinase-inactive JNKK and JNK as described under
``Materials and Methods. Gst-c-Jun
phosphorylation by JNK was used as a measure for activation of
the JNKK/JNK pathway.
Assay of MEKK 2 and 3 Kinase Activity in Vitro
To
assay MEKK activity in vitro, immune complexes were incubated
with recombinant wild type or kinase-inactive MEK 1 (Lys
Met) or JNKK (Lys
Arg) as a
substrate(13, 19, 29) . Transfected HEK293
cells were lysed in 1% Triton X-100, 0.5% Nonidet P-40, 20 mM Tris
HCl, pH 7.5, 150 mM NaCl, 20 mM NaF,
0.2 mM sodium vanadate, 1 mM EDTA, 1 mM EGTA, 5 mM phenylmethylsulfonyl fluoride. Nuclei were
removed by centrifugation at 15,000 g for 5 min. HA
epitope-tagged MEKK 2 and 3 were immunoprecipitated with the 12CA5
antibody and protein A-Sepharose(24, 25) .
Immunoprecipitates were washed twice in lysis buffer, twice in PAN (10
mM Pipes, pH 7.0, 100 mM NaCl, 20 µg/ml
aprotinin), suspended in 20 mM Pipes, 10 mM MnCl, 20 µg/ml aprotinin, and used in an in
vitro kinase assay with 20-50 ng of recombinant MEK 1 or
JNKK as substrates and 20 µCi of
[-
P]ATP(29) . Reactions were
terminated by the addition of Laemmli sample buffer, boiled, and
proteins were resolved by SDS-10% polyacrylamide gel electrophoresis.
-Sepharose beads were then added, and
the mixture was rotated at 4 °C for 30 min. The beads were washed,
suspended in 40 µl of c-Jun kinase assay buffer containing 20
µCi of [
-
P]ATP, and incubated for 15
min at 30 °C. Reaction mixtures were added to Laemmli sample
buffer, boiled, and phosphorylated proteins were resolved on SDS-10%
polyacrylamide gels.
Assay of p38 Kinase Activity
Sorbitol-treated (0.4 M, 20 min) or control HEK293 cells were lysed in the same
buffer as that used for assay of MEKK 2 and 3. Supernatants (200 µg
of protein) were used for immunoprecipitation of p38 using rabbit
antiserum raised against the COOH-terminal peptide sequence of
p38(5) . Immunoprecipitates were washed once in lysis buffer,
once in assay buffer (25 mM Hepes, pH 7.4, 25 mM -glycerophosphate, 25 mM NaCl, 2 mM dithiothreitol, 0.1 mM sodium vanadate), resuspended, and
used in an in vitro kinase assay with a recombinant
NH-terminal fragment of ATF 2 (20-50 ng) as substrate
and 20 µCi of [-
P] ATP(31) .
For analysis of p38 kinase activity from Mono Q FPLC fractions,
20-µl aliquots were mixed with kinase buffer containing 20-50
ng of recombinant ATF 2 and 10 µCi of
[
-
P]ATP(29, 31) .
Reactions were quenched in Laemmli sample buffer, boiled, and proteins
were resolved using SDS-10% polyacrylamide gels.
Cloning of MEKK 2 and 3
Degenerate primers were
used in polymerase chain reactions with cDNA synthesized from RNA
isolated from NIH3T3 cells (see ``Materials and Methods'').
Approximately 80% of the polymerase chain reaction products when
sequenced encoded MEKK 1 (18) . 15-20% of the reaction
products encoded a novel cDNA sequence having homology to MEKK 1. The
unique cDNA fragment was used to screen a mouse brain cDNA library
which resulted in the isolation of two unique MEKK cDNAs. Fig. 1shows the DNA sequence and deduced amino acid sequence for
MEKK 2 and 3. MEKK 2 encodes a 619-amino acid protein having a mass of
69.7 kDa. MEKK 3 encodes a 626-amino acid protein having a mass of 71
kDa. The two proteins share a common structure with the kinase
catalytic domain encoded in the COOH-terminal moiety. The
amino-terminal moiety does not encode any definable domain such as a
SH2 or SH3 domain sequence.
-terminal moieties are only 65% conserved in
amino acid sequence. These findings indicate that the primary sequences
of MEKK 2 and 3 diverge significantly in the NH-terminal
half of the proteins. The conservation in sequence of the catalytic
domains suggests they may recognize an overlapping set of substrates.
The divergent NH termini would be consistent with this
region encoding sequences for the differential regulation of the two
proteins.
activities in
transfected cells. The significance of the sequence differences in the
catalytic domains of MEKK 1, 2, and 3 is presently unclear.
MEKK 2 and 3 Activate c-Jun Kinase and p42/44
Transient expression of MEKK 2 and 3 resulted in
the stimulation of c-Jun kinase (JNK) activity (Fig. 3A). The JNK activity also eluted early from a
Mono Q column using a linear sodium chloride elution gradient (Fig. 3B). Immunoblotting (not shown) demonstrated that
this activity corresponded to the JNK/stress-activated protein
kinase(1, 8) . Activity
activity (Fig. 4).
Immunoblotting of hemagglutinin (HA) epitope-tagged MEKK 2 and 3
indicated that MEKK 2 and 3 were expressed at similar levels in HEK293
cells when 2 µg of plasmid DNA was used per transfection (not
shown). To determine whether MEKK 2 and 3 demonstrated selectivity in
activating the JNK and p42/44
pathways, plasmid DNAs
were titrated over a range of concentrations in the transfections. Fig. 5shows that MEKK 2 has a greater selectivity for
stimulation of the JNK pathway. In contrast, MEKK 3 had a greater
selectivity for activating p42/44
relative to JNK. Thus,
even though the kinase domains are approximately 94% conserved, MEKK 2
and 3 differ in their selectivity for regulation of the JNK and
p42/44
pathways. This was particularly evident for MEKK
3 at low plasmid concentrations where the p42/44
pathway
was preferentially activated.
activity was assayed as described under ``Materials and
Methods'' using the EGF receptor 662-681 peptide as
substrate.
MEKK 2 Phosphorylates Both MEK 1 and JNK Kinase in
Vitro
HEK293 cells expressing MEKK 2 and 3 were lysed, and the
recombinant MEKK proteins were immunoprecipitated using the 12CA5
antibody recognizing the HA epitope-tag. The immunoprecipitates were
then used for in vitro kinase assays with recombinant purified
MEK 1 and JNK kinase (JNKK) as substrates (Fig. 6A).
MEKK 2 clearly phosphorylates both MEK 1 and JNKK consistent with its
ability to activate JNK and p42/44 in HEK293 cells. Fig. 6B shows that the MEKK 2-catalyzed phosphorylation
of recombinant JNKK resulted in the enhancement of JNKK activity. Thus,
JNKK is a MEKK 2 substrate whose activity is stimulated both in
vitro and in vivo by MEKK 2. We were unable to
demonstrate the ability of MEKK 3 to phosphorylate MEK 1, MEK 2 (not
shown), or JNKK in vitro using a variety of
immunoprecipitation procedures. Although MEKK 3 was efficiently
immunoprecipitated, as determined by Western blot analysis, it did not
show measurable kinase activity toward MEK 1 or JNKK or show detectable
autophosphorylation. This contrasted dramatically with the ability of
MEKK 3 to activate both JNK and p42/44
in cells (Fig. 3Fig. 4Fig. 5). MEKK 3 protein was clearly
immunoprecipitated using the 12CA5 antibody in these experiments, and a
rabbit antisera raised against a keyhole limpet hemocyanin-conjugated
peptide encoding the last 15 amino acids of MEKK 3 recognized the
intact immunoprecipitated protein indicating that it was not degraded.
The failure of immunoprecipitated MEKK 3 to phosphorylate recombinant
MEK 1 or JNKK suggests one of three possibilities: (i) MEKK 3 is
denatured but not degraded during immunoprecipitation, (ii) MEKK 3
requires an additional protein or co-factor for its activity in
vitro that is lost during immunoprecipitation, (iii) the relevant
substrate for MEKK 3 in cells is neither MEK 1 or 2 nor JNKK. At
present, it is not clear which of these possibilities is responsible
for the failure to detect MEKK 3 activity in vitro. We
demonstrated that a mutant MEKK 3 having lysine 391 mutated to
methionine, rendering it kinase-inactive (19, 27, 32) , did not stimulate JNK or
p42/44
activity when expressed in HEK293 cells (not
shown). This finding indicated that the functional kinase activity of
MEKK 3 was required for the in vivo regulation of JNK and
p42/44
.
phosphorylation by JNK was used as a
measure for activation of the JNKK/JNK
pathway.
MEKK 2 and 3 Do Not Regulate p38 Activity in HEK293
Cells
The p38 kinase is activated by hyperosmotic conditions (5) and recognizes the transcription factor ATF 2 as an in
vitro substrate (33) . Incubation of HEK293 cells with
sorbitol activated p38 kinase (Fig. 7A).
Immunoprecipitation and in vitro kinase assay of p38 from MEKK
2 and 3 transfected HEK293 cells indicated that neither MEKK 2 nor MEKK
3 stimulated p38 kinase activity (not shown). Mono Q FPLC fractionation
of lysates from MEKK 2 or 3 transfected HEK293 cells confirmed that p38
kinase activity was similar to that from control transfected cells (Fig. 7B). ATF 2 is also a substrate for
JNK(31) . Fractions 2-8 from cells transfected with MEKK
2 or 3, that contain immunoreactive JNK, have increased kinase activity
toward ATF 2. This is a predicted result based on the ability of both
MEKK 2 and 3 to stimulate JNK activity in HEK293 cells. Expression of
MEKK 2 and 3 also activated additional ATF 2 phosphorylating activities
resolved by Mono Q fractionation. These activities are seen to elute in
fractions 9-12 and 13-18 for lysates from both MEKK 2 and 3
expressing cells. These activities do not correspond by immunoblotting
to JNK, p42/44, p38, or MEKK 2 or 3 and represent novel
kinase activities capable of phosphorylating recombinant ATF 2 that are
regulated by both MEKK 2 and 3.
and JNK activities. MEKK 1 and 2 appear to
preferentially regulate the JNK pathway, whereas MEKK 3 shows a
preference for activation of the p42/44
pathway in
vivo. Cumulatively, our current and previous results (19) indicate that the different MEKKs when transiently
expressed do not display a high selectivity for the p42/44
or JNK regulatory pathways. At more modest levels of expression,
a greater degree of selectivity is observed for MEKK regulation of
sequential protein kinase pathways. In MEKK 1-inducible clones of
NIH3T3 (34) and Swiss 3T3 (35) cells, JNK is
preferentially activated relative to p42/44
. MEKK 1, 2,
and 3 do not measurably activate the p38 kinase pathway in these cell
types.
pathways(1, 8) . At present, no distinct
pathways or substrates other than MEK and p42/44
have
been defined for Raf kinases, although it is probable that additional
MEK-like kinases will be identified in the future that serve as Raf
substrates. MEKK proteins, in contrast, are capable of regulating both
JNK and p42/44
pathways.
pathways. It will
obviously be necessary to define the organization of potential MEKK
signalsome complexes in the cell and the constituent kinases in each
complex.
)
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  G Schett, J Zwerina, and G Firestein The p38 mitogen-activated protein kinase (MAPK) pathway in rheumatoid arthritis Ann Rheum Dis, July 1, 2008; 67(7): 909 - 916. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. R. Junttila, S.-P. Li, and J. Westermarck Phosphatase-mediated crosstalk between MAPK signaling pathways in the regulation of cell survival FASEB J, April 1, 2008; 22(4): 954 - 965. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Deng, J. Yang, M. McCarty, and B. Su MEKK3 is required for endothelium function but is not essential for tumor growth and angiogenesis Am J Physiol Cell Physiol, October 1, 2007; 293(4): C1404 - C1411. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Padda, A. Wamsley-Davis, M. C. Gustin, R. Ross, C. Yu, and D. Sheikh-Hamad MEKK3-mediated signaling to p38 kinase and TonE in hypertonically stressed kidney cells Am J Physiol Renal Physiol, October 1, 2006; 291(4): F874 - F881. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Fritz, K. J. Brayer, N. McCormick, D. G. Adams, B. E. Wadzinski, and R. R. Vaillancourt Phosphorylation of Serine 526 Is Required for MEKK3 Activity, and Association with 14-3-3 Blocks Dephosphorylation J. Biol. Chem., March 10, 2006; 281(10): 6236 - 6245. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. W. Woodmansee, J. M. Kerr, E. A. Tucker, J. R. Mitchell, D. J. Haakinson, D. F. Gordon, E. C. Ridgway, and W. M. Wood The Proliferative Status of Thyrotropes Is Dependent on Modulation of Specific Cell Cycle Regulators by Thyroid Hormone Endocrinology, January 1, 2006; 147(1): 272 - 282. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Cheng, D. Zhang, K. Kim, Y. Zhao, Y. Zhao, and B. Su Mip1, an MEKK2-Interacting Protein, Controls MEKK2 Dimerization and Activation Mol. Cell. Biol., July 15, 2005; 25(14): 5955 - 5964. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Cheng, L. Yu, D. Zhang, Q. Huang, D. Spencer, and B. Su Dimerization through the Catalytic Domain Is Essential for MEKK2 Activation J. Biol. Chem., April 8, 2005; 280(14): 13477 - 13482. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Blonska, Y. You, R. Geleziunas, and X. Lin Restoration of NF-{kappa}B Activation by Tumor Necrosis Factor Alpha Receptor Complex-Targeted MEKK3 in Receptor-Interacting Protein-Deficient Cells Mol. Cell. Biol., December 15, 2004; 24(24): 10757 - 10765. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Matsumoto, D. Einhaus, E. S. Gold, and A. Aderem Simvastatin Augments Lipopolysaccharide-Induced Proinflammatory Responses in Macrophages by Differential Regulation of the c-Fos and c-Jun Transcription Factors J. Immunol., June 15, 2004; 172(12): 7377 - 7384. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B.-e Xu, S. Stippec, L. Lenertz, B.-H. Lee, W. Zhang, Y.-K. Lee, and M. H. Cobb WNK1 Activates ERK5 by an MEKK2/3-dependent Mechanism J. Biol. Chem., February 27, 2004; 279(9): 7826 - 7831. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. R. Hammaker, D. L. Boyle, M. Chabaud-Riou, and G. S. Firestein Regulation of c-Jun N-Terminal Kinase by MEKK-2 and Mitogen-Activated Protein Kinase Kinase Kinases in Rheumatoid Arthritis J. Immunol., February 1, 2004; 172(3): 1612 - 1618. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. D. Gallagher, S. Gutowski, P. C. Sternweis, and M. H. Cobb RhoA Binds to the Amino Terminus of MEKK1 and Regulates Its Kinase Activity J. Biol. Chem., January 16, 2004; 279(3): 1872 - 1877. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. H. Lee, Q. Huang, S. Oikemus, J. Shank, J.-J. Ventura, N. Cusson, R. R. Vaillancourt, B. Su, R. J. Davis, and M. A. Kelliher The Death Domain Kinase RIP1 Is Essential for Tumor Necrosis Factor Alpha Signaling to p38 Mitogen-Activated Protein Kinase Mol. Cell. Biol., November 15, 2003; 23(22): 8377 - 8385. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. C. Platanias Map kinase signaling pathways and hematologic malignancies Blood, June 15, 2003; 101(12): 4667 - 4679. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. T. Moran, K. Haider, Y. Ow, P. Milton, L. Chen, and S. Pillai Protein Kinase C-associated Kinase Can Activate NF{kappa}B in Both a Kinase-dependent and a Kinase-independent Manner J. Biol. Chem., June 6, 2003; 278(24): 21526 - 21533. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W.-y. Lui, W. M. Lee, and C. Y. Cheng Transforming Growth Factor {beta}3 Regulates the Dynamics of Sertoli Cell Tight Junctions Via the p38 Mitogen-Activated Protein Kinase Pathway Biol Reprod, May 1, 2003; 68(5): 1597 - 1612. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Sun, X. Wei, K. Kesavan, T. P. Garrington, R. Fan, J. Mei, S. M. Anderson, E. W. Gelfand, and G. L. Johnson MEK Kinase 2 and the Adaptor Protein Lad Regulate Extracellular Signal-Regulated Kinase 5 Activation by Epidermal Growth Factor via Src Mol. Cell. Biol., April 1, 2003; 23(7): 2298 - 2308. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Chen, M. A. White, and M. H. Cobb Stimulus-specific Requirements for MAP3 Kinases in Activating the JNK Pathway J. Biol. Chem., December 13, 2002; 277(51): 49105 - 49110. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Holmberg, S. Katz, M. Lerdrup, T. Herdegen, M. Jaattela, A. Aronheim, and T. Kallunki A Novel Specific Role for Ikappa B Kinase Complex-associated Protein in Cytosolic Stress Signaling J. Biol. Chem., August 23, 2002; 277(35): 31918 - 31928. [Abstract] [Full Text] [PDF]
|
|
|
|
ABSTRACT
