JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blank, J. L.
Right arrow Articles by Johnson, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blank, J. L.
Right arrow Articles by Johnson, G. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 271, Number 10, Issue of March 8, 1996 pp. 5361-5368
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
Molecular Cloning of Mitogen-activated Protein/ERK Kinase Kinases (MEKK) 2 and 3
REGULATION OF SEQUENTIAL PHOSPHORYLATION PATHWAYS INVOLVING MITOGEN-ACTIVATED PROTEIN KINASE AND c-Jun KINASE (*)

(Received for publication, September 1, 1995; and in revised form, November 27, 1995)

Jonathan L. Blank (1)(§) Pär Gerwins (1)(¶) Elicia M. Elliott (1)(**) Susan Sather (1) Gary L. Johnson (1) (2)(§§)

From the  (1)Division of Basic Sciences, National Jewish Center for Immunology and Respiratory Medicine, Denver, Colorado 80206 and the (2)Department of Pharmacology, University of Colorado Medical School, Denver, Colorado 80262

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES

ABSTRACT

Mitogen-activated protein/ERK kinase kinases (MEKKs) phosphorylate and activate protein kinases which in turn phosphorylate and activate the p42/44 mitogen-activated protein kinase (MAPK), c-Jun/stress-activated protein kinases (JNKs), and p38/Hog1 kinase. We have isolated the cDNAs for two novel mammalian MEKKs (MEKK 2 and 3). MEKK 2 and 3 encode proteins of 69.7 and 71 kDa, respectively. The kinase domains encoded in the COOH-terminal moiety are 94% conserved; the NH(2)-terminal moieties are approximately 65% homologous, suggesting this region may encode sequences conferring differential regulation of the two kinases. Expression of MEKK 2 or 3 in HEK293 cells results in activation of p42/44 and JNK but not of p38/Hog1 kinase. Immunoprecipitated MEKK 2 phosphorylated the MAP kinase kinases, MEK 1, and JNK kinase. Titration of MEKK 2 and 3 expression in transfection assays indicated that MEKK 2 preferentially activated JNK while MEKK 3 preferentially activated p42/44. These findings define a family of MEKK proteins capable of regulating sequential protein kinase pathways involving MAPK members.


INTRODUCTION

A variety of extracellular signals including growth factors, hormones, cytokines, antigens, and stresses such as heat shock and osmotic imbalance activate members of the mitogen-activated protein kinase (MAPK) (^1)family(1, 2, 3, 4, 5) . MAPKs are characterized as serine/threonine-protein kinases activated by dual phosphorylation on both a tyrosine and a threonine(6) . The MAPK family includes p42/44 (also referred to as ERK2 and -1)(7) , the c-Jun kinases (JNKs which are also referred to as stress-activated protein kinases)(8) , and p38, the osmotic imbalance responsive kinase similar to the yeast Hog1 enzyme(5) . The regulation of different MAPKs including p42/44, JNKs, and p38 involves sequential protein kinase pathways whose upstream activators include the MEKs (MAPK/ERK kinases) and the JNK kinases (also referred to as SEKs or stress/ERK kinases)(9, 10, 11, 12, 13) . MEKs and JNK kinases (JNKKs) phosphorylate specific MAPK family members on both a tyrosine and threonine resulting in MAPK activation.

Raf-1 and B-Raf are serine/threonine-protein kinases that selectively phosphorylate and activate MEK 1 and MEK 2(14, 15, 16, 17) . Recently, we isolated the cDNA for a novel serine/threonine-protein kinase referred to as MEK kinase (MEKK 1) that phosphorylates and activates MEK 1 and 2 and JNKKs(13, 18, 19, 20) . The catalytic domain of MEKK 1 is homologous to the kinase domains of the Ste11 and Byr2 serine/threonine-protein kinases, involved in the control of mating in Saccharomyces cerevisiae and Schizosaccharomyces pombe, respectively(21, 22, 23) . In this report, we have isolated and expressed the cDNAs for two new MEKK proteins. MEKK 2 and 3, when expressed in cells, are similar to MEKK 1 in that they are capable of regulating MEK and JNKK activities. Thus, there exists a family of MEKKs controlling sequential protein kinase systems involving MAPK members in addition to the Raf family of protein kinases.


MATERIALS AND METHODS

Isolation of MEKK 2 and 3 cDNAs

The degenerate primers GA(A/G)(C/T)TIATGGCIGTIAA(A/G)CA (sense) and TTIGCICC(T/C)TTIAT(A/G)TCIC(G/T)(A/G)TG (antisense) were used in a polymerase chain reaction (PCR) using first strand cDNA generated from polyadenylated RNA prepared from NIH 3T3 cells. The PCR reaction involved 30 cycles (1 min, 94 °C; 2 min, 52 °C; 3 min, 72 °C) followed by a 10-min cycle at 72 °C. A band of approximately 300 base pairs was recovered from the PCR mixture, and the products were cloned into pGEM-T (Promega). The PCR cDNA products were sequenced and compared to the MEKK 1 sequence(19) . A unique cDNA sequence of 322 base pairs having significant homology to MEKK 1 cDNA was identified and used to screen an oligo(dT)-primed mouse brain cDNA library (Stratagene). The phage library was plated, and DNA from plaques were transferred to Hybond N filters (Amersham) followed by UV-cross-linking of DNA to the filters. Filters were prehybridized for 2 h and then hybridized overnight in 0.5 M Na(2)H(2)PO(4) (pH 7.2), 10% bovine serum albumin, 1 mM EDTA, 7% SDS at 68 °C. Filters were washed twice at 42 °C with 2 times SSC, once with 1 times SSC, and once with 0.5 times SSC containing 0.1% SDS (1 times SSC is 0.15 M NaCl, 0.015 M sodium citrate, pH 7.0). Positive hybridizing clones were purified and sequenced. To resolve GC-rich regions, cDNAs were subcloned into M13 vectors (New England Biolabs), and single strand DNA was sequenced. In all cases, both strands of DNA were sequenced.

Plasmid Expression of MEKK 2 and 3

The proteins for MEKK 2 and 3 were epitope-tagged at their NH(2) terminus with the hemagglutinin (HA)-tag sequence GYPYDVPDYAS (24) using a PCR strategy as described previously(25) . For inserting the NH(2)-terminal epitope tag in MEKK 2 and 3, sense oligonucleotides were synthesized having a methionine codon (ATG), 33 bases coding for the GYPYDVPDYAS epitope-tag sequences, and 20 bases of MEKK 2 or 3 sequence starting at codon 2. For MEKK 2, the sense oligonucleotide was ATGGGGTACCCGTACGACGTGCCGGACTACGCTTCCGATGATCAGCAAGCTTTGAA. The sense oligonucleotide for MEKK 3 was ATGGGGTACCCGTACGACGTGCCGGACTACGCTTCCGATGAACAAGAGGCATTAGA. The antisense oligonucleotides for MEKK 2 and 3 were AGACTTAGATCTCAGGTCTTC encoding a BglII site for MEKK 2 and GATTCTGACGTCACTCTGCCT encoding an AatII site for MEKK 3. The PCR reactions were performed for 30 cycles using MEKK 2 or MEKK 3 cDNAs as template. The PCR products were purified, and a second PCR reaction was performed using the first PCR product as template, the MEKK 2 or 3 antisense oligonucleotide described above and the common sense oligonucleotide encoding a XbaI restriction site, a consensus Kozak initiation site and 17 bases overlapping with the initiation methionine, and HA-tag sequence (TGACGTTCTAGAGCCACCATGGGGTACCCGTACGA). The resulting PCR products were digested with XbaI and BglII for MEKK 2 and XbaI and AatII for MEKK 3 and ligated in-frame into the appropriate MEKK 2 or 3 cDNA. The sequences were confirmed by DNA sequencing, and the cDNAs were inserted into the expression plasmid pCMV5. HEK293 cells were transfected with pCMV5 expression plasmids using LipofectAMINE (Life Technologies, Inc.) and assayed 48 h later. The 12CA5 monoclonal antibody (Berkeley Antibody Co.) was used for recognition of the HA epitope tag encoded in expressed MEKK 2 and 3.

Antibody Production

Peptides corresponding to COOH-terminal sequences of MEKK 3 (CEARQRPSAEELLTHHFAQ) and p38 (CFVPPPLDQEEMES) were conjugated to keyhole limpet hemocyanin and used to immunize rabbits. Antisera were characterized for specificity by immunoblotting of lysates prepared from appropriately transfected HEK293 cells.

Assay of JNK Activity

JNK activity was measured using GST (glutathione S-transferase)-c-Jun coupled to glutathione-Sepharose 4B(26) . Cells transfected with MEKK 2 or 3 and control transfected cells were lysed in 0.5% Nonidet P-40, 20 mM TrisbulletHCl, pH 7.6, 0.25 M NaCl, 3 mM EDTA, 3 mM EGTA, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 2 mM sodium vanadate, 20 µg/ml aprotinin, and 5 µg/ml leupeptin. Nuclei were removed by centrifugation at 15,000 times g for 10 min, and the supernatants (25 µg of protein) were mixed with 10 µl of a slurry of GST-c-Jun-Sepharose (3-5 µg of GST-c-Jun). The mixture was rotated at 4 °C for 1 h, washed twice in lysis buffer and once in kinase buffer (20 mM Hepes, pH 7.5, 10 mM MgCl(2), 20 mM beta-glycerophosphate, 10 mMp-nitrophenyl phosphate, 1 mM dithiothreitol, 50 µM sodium vanadate). Beads were suspended in 40 µl of kinase assay buffer containing 10 µCi of [-P]ATP and incubated at 30 °C for 20 min. Reaction mixtures were added to Laemmli sample buffer, boiled, and phosphorylated proteins were resolved on SDS-10% polyacrylamide gels. When JNK activity was assayed following fractionation by Mono Q ion exchange chromatography, 50 µl of each fraction was incubated with the GST-c-Jun beads.

p42/44 Assay

MAPK activity following Mono Q FPLC fractionation was measured as described previously (28) using the epidermal growth factor receptor 662-681 peptide as a selective p42/44 substrate(29) . Alternatively, for cells transfected with varying amounts of MEKK plasmids (Fig. 5), MAPK activity was assayed after elution from DEAE-Sephacel columns(30) .


Figure 5: Selective regulation of p42/44 and JNK by MEKK 2 and 3. HEK293 cells were transfected with 5, 1, 0.25, 0.05, and 0.01 µg of plasmid DNA encoding either MEKK 2 or 3. Cells were harvested 48 h post-transfection and assayed for both JNK and p42/44 activity. The results are representative of two independent experiments for both MEKK 2 and 3. B, MEKK 2 phosphorylation of JNKK stimulates JNK kinase activity. MEKK 2 immunoprecipitates were incubated with the indicated combinations of wild-type or kinase-inactive JNKK and JNK as described under ``Materials and Methods. Gst-c-Jun phosphorylation by JNK was used as a measure for activation of the JNKK/JNK pathway.



Assay of MEKK 2 and 3 Kinase Activity in Vitro

To assay MEKK activity in vitro, immune complexes were incubated with recombinant wild type or kinase-inactive MEK 1 (Lys Met) or JNKK (Lys Arg) as a substrate(13, 19, 29) . Transfected HEK293 cells were lysed in 1% Triton X-100, 0.5% Nonidet P-40, 20 mM TrisbulletHCl, pH 7.5, 150 mM NaCl, 20 mM NaF, 0.2 mM sodium vanadate, 1 mM EDTA, 1 mM EGTA, 5 mM phenylmethylsulfonyl fluoride. Nuclei were removed by centrifugation at 15,000 times g for 5 min. HA epitope-tagged MEKK 2 and 3 were immunoprecipitated with the 12CA5 antibody and protein A-Sepharose(24, 25) . Immunoprecipitates were washed twice in lysis buffer, twice in PAN (10 mM Pipes, pH 7.0, 100 mM NaCl, 20 µg/ml aprotinin), suspended in 20 mM Pipes, 10 mM MnCl(2), 20 µg/ml aprotinin, and used in an in vitro kinase assay with 20-50 ng of recombinant MEK 1 or JNKK as substrates and 20 µCi of [-P]ATP(29) . Reactions were terminated by the addition of Laemmli sample buffer, boiled, and proteins were resolved by SDS-10% polyacrylamide gel electrophoresis.

To demonstrate MEKK activation of JNKK activity, the in vitro kinase reactions were performed with different combinations of recombinant wild type or kinase-inactive JNKK (lysine 116 mutated to methionine) and wild type or kinase-inactive JNK. Kinase-inactive JNK was made by mutating the active site lysine 55 to methionine (provided by Dr. Matt Jarpe). Incubations were for 30 min at 30 °C in the presence of 50 µM ATP. GST-c-Jun-Sepharose beads were then added, and the mixture was rotated at 4 °C for 30 min. The beads were washed, suspended in 40 µl of c-Jun kinase assay buffer containing 20 µCi of [-P]ATP, and incubated for 15 min at 30 °C. Reaction mixtures were added to Laemmli sample buffer, boiled, and phosphorylated proteins were resolved on SDS-10% polyacrylamide gels.

Assay of p38 Kinase Activity

Sorbitol-treated (0.4 M, 20 min) or control HEK293 cells were lysed in the same buffer as that used for assay of MEKK 2 and 3. Supernatants (200 µg of protein) were used for immunoprecipitation of p38 using rabbit antiserum raised against the COOH-terminal peptide sequence of p38(5) . Immunoprecipitates were washed once in lysis buffer, once in assay buffer (25 mM Hepes, pH 7.4, 25 mM beta-glycerophosphate, 25 mM NaCl(2), 2 mM dithiothreitol, 0.1 mM sodium vanadate), resuspended, and used in an in vitro kinase assay with a recombinant NH(2)-terminal fragment of ATF 2 (20-50 ng) as substrate and 20 µCi of [-P] ATP(31) . For analysis of p38 kinase activity from Mono Q FPLC fractions, 20-µl aliquots were mixed with kinase buffer containing 20-50 ng of recombinant ATF 2 and 10 µCi of [-P]ATP(29, 31) . Reactions were quenched in Laemmli sample buffer, boiled, and proteins were resolved using SDS-10% polyacrylamide gels.


RESULTS

Cloning of MEKK 2 and 3

Degenerate primers were used in polymerase chain reactions with cDNA synthesized from RNA isolated from NIH3T3 cells (see ``Materials and Methods''). Approximately 80% of the polymerase chain reaction products when sequenced encoded MEKK 1 (18) . 15-20% of the reaction products encoded a novel cDNA sequence having homology to MEKK 1. The unique cDNA fragment was used to screen a mouse brain cDNA library which resulted in the isolation of two unique MEKK cDNAs. Fig. 1shows the DNA sequence and deduced amino acid sequence for MEKK 2 and 3. MEKK 2 encodes a 619-amino acid protein having a mass of 69.7 kDa. MEKK 3 encodes a 626-amino acid protein having a mass of 71 kDa. The two proteins share a common structure with the kinase catalytic domain encoded in the COOH-terminal moiety. The amino-terminal moiety does not encode any definable domain such as a SH2 or SH3 domain sequence.


Figure 1: DNA and deduced amino acid sequences for MEKK 2 and 3. A, MEKK 2; B, MEKK 3. In-frame stop codons 5` to the predicted start methionine are underlined.



The 5` ends of both MEKK 2 and 3 are highly G/C-rich making DNA sequencing difficult. To verify the presence of stop codons in all three possible reading frames 5` to the predicted start site methionine, the MEKK 2 and 3 cDNAs were inserted in pRSET A, B, and C (Invitrogen) and expressed in Escherichia coli (not shown). Each construct gave a truncated RSET fragment confirming that the MEKK 2 and 3 cDNAs encoded 5` stop sites and that the isolated cDNAs encode full-length proteins.

Alignment of the deduced amino acid sequences demonstrated significant homology between the two proteins (Fig. 2A). Overall, the two proteins are approximately 77% homologous. The catalytic domain is encoded in the COOH-terminal moiety of both MEKK 2 and 3. The first consensus kinase domain (32) comprising the catalytic site of MEKK 2 and 3 begins at residues 361 and 367, respectively. The COOH-terminal catalytic domains of MEKK 2 and 3 are approximately 94% conserved, whereas the NH(2)-terminal moieties are only 65% conserved in amino acid sequence. These findings indicate that the primary sequences of MEKK 2 and 3 diverge significantly in the NH(2)-terminal half of the proteins. The conservation in sequence of the catalytic domains suggests they may recognize an overlapping set of substrates. The divergent NH(2) termini would be consistent with this region encoding sequences for the differential regulation of the two proteins.


Figure 2: Comparison of amino acid sequences for MEKK 2 and 3. A, amino acids not having homology are boxed in the alignment of MEKK 2 and 3. B, alignment of the catalytic domains for MEKK 1, 2, and 3. Roman numerals indicate the 11 conserved regions within the protein kinase catalytic domain, with the most highly conserved residues underlined(32) . Lowercase letters represent nonconserved amino acids in one or more of the MEKK sequences.



Fig. 2B shows the alignment of MEKK 1, 2, and 3 catalytic domains. The 11 conserved subdomains comprising the protein kinase catalytic domain are designated by Roman numerals. The COOH terminus of MEKK 1 encoding the catalytic domain is only 50% homologous to the corresponding regions of MEKK 2 and 3. Thus, the catalytic domains of MEKK 2 and 3 are very similar to each other but significantly divergent from MEKK 1. As shown below, MEKK 1, 2, and 3 can all stimulate JNK and p42/44 activities in transfected cells. The significance of the sequence differences in the catalytic domains of MEKK 1, 2, and 3 is presently unclear.

MEKK 2 and 3 Activate c-Jun Kinase and p42/44 Activity

Transient expression of MEKK 2 and 3 resulted in the stimulation of c-Jun kinase (JNK) activity (Fig. 3A). The JNK activity also eluted early from a Mono Q column using a linear sodium chloride elution gradient (Fig. 3B). Immunoblotting (not shown) demonstrated that this activity corresponded to the JNK/stress-activated protein kinase(1, 8) .


Figure 3: Stimulation of JNK activity in MEKK 2 and 3 transfected HEK293 cells. Cells were harvested 48 h post-transfection and assayed for GST-c-Jun phosphorylating activity by mixing of lysates with a slurry of GST-c-Jun-Sepharose (A). Alternatively, lysates were fractionated using a 0-0.5 M NaCl linear gradient on a Mono Q ion exchange column before assay with GST-c-Jun-Sepharose as substrate (B).



Transient expression of MEKK 2 and 3 also stimulated p42/44 activity (Fig. 4). Immunoblotting of hemagglutinin (HA) epitope-tagged MEKK 2 and 3 indicated that MEKK 2 and 3 were expressed at similar levels in HEK293 cells when 2 µg of plasmid DNA was used per transfection (not shown). To determine whether MEKK 2 and 3 demonstrated selectivity in activating the JNK and p42/44 pathways, plasmid DNAs were titrated over a range of concentrations in the transfections. Fig. 5shows that MEKK 2 has a greater selectivity for stimulation of the JNK pathway. In contrast, MEKK 3 had a greater selectivity for activating p42/44 relative to JNK. Thus, even though the kinase domains are approximately 94% conserved, MEKK 2 and 3 differ in their selectivity for regulation of the JNK and p42/44 pathways. This was particularly evident for MEKK 3 at low plasmid concentrations where the p42/44 pathway was preferentially activated.


Figure 4: MAPK activity in HEK293 cells transfected with MEKK 2 and 3. Cells were harvested 48 h post-transfection, and lysates were fractionated using a linear 0-0.5 M NaCl gradient on a Mono Q ion exchange column. p42/44 activity was assayed as described under ``Materials and Methods'' using the EGF receptor 662-681 peptide as substrate.



MEKK 2 Phosphorylates Both MEK 1 and JNK Kinase in Vitro

HEK293 cells expressing MEKK 2 and 3 were lysed, and the recombinant MEKK proteins were immunoprecipitated using the 12CA5 antibody recognizing the HA epitope-tag. The immunoprecipitates were then used for in vitro kinase assays with recombinant purified MEK 1 and JNK kinase (JNKK) as substrates (Fig. 6A). MEKK 2 clearly phosphorylates both MEK 1 and JNKK consistent with its ability to activate JNK and p42/44 in HEK293 cells. Fig. 6B shows that the MEKK 2-catalyzed phosphorylation of recombinant JNKK resulted in the enhancement of JNKK activity. Thus, JNKK is a MEKK 2 substrate whose activity is stimulated both in vitro and in vivo by MEKK 2. We were unable to demonstrate the ability of MEKK 3 to phosphorylate MEK 1, MEK 2 (not shown), or JNKK in vitro using a variety of immunoprecipitation procedures. Although MEKK 3 was efficiently immunoprecipitated, as determined by Western blot analysis, it did not show measurable kinase activity toward MEK 1 or JNKK or show detectable autophosphorylation. This contrasted dramatically with the ability of MEKK 3 to activate both JNK and p42/44 in cells (Fig. 3Fig. 4Fig. 5). MEKK 3 protein was clearly immunoprecipitated using the 12CA5 antibody in these experiments, and a rabbit antisera raised against a keyhole limpet hemocyanin-conjugated peptide encoding the last 15 amino acids of MEKK 3 recognized the intact immunoprecipitated protein indicating that it was not degraded. The failure of immunoprecipitated MEKK 3 to phosphorylate recombinant MEK 1 or JNKK suggests one of three possibilities: (i) MEKK 3 is denatured but not degraded during immunoprecipitation, (ii) MEKK 3 requires an additional protein or co-factor for its activity in vitro that is lost during immunoprecipitation, (iii) the relevant substrate for MEKK 3 in cells is neither MEK 1 or 2 nor JNKK. At present, it is not clear which of these possibilities is responsible for the failure to detect MEKK 3 activity in vitro. We demonstrated that a mutant MEKK 3 having lysine 391 mutated to methionine, rendering it kinase-inactive (19, 27, 32) , did not stimulate JNK or p42/44 activity when expressed in HEK293 cells (not shown). This finding indicated that the functional kinase activity of MEKK 3 was required for the in vivo regulation of JNK and p42/44.


Figure 6: Phosphorylation of recombinant MEK 1 and JNKK by immunoprecipitated MEKK 2. A, HEK293 cells were transfected with pCMV5 alone(-) or encoding HA epitope-tagged MEKK 2 or 3. Forty-eight h post-transfection, cells were lysed, and MEKK 2 and 3 were immunoprecipitated using the 12CA5 monoclonal antibody. Immunoprecipitates were then assayed for kinase activity using recombinant kinase-inactive MEK 1 or JNKK as substrate. The JNKK only lane shows the low level of autophosphorylation of recombinant JNKK. Results are representative of 5-6 experiments for both MEKK 2 and 3. B, MEKK 2 phosphorylation of JNKK stimulates JNK kinase activity. MEKK 2 immunoprecipitates were incubated with the indicated combinations of wild-type or kinase-inactive JNKK and JNK as described under ''Materials and Methods. Gst-c-Jun phosphorylation by JNK was used as a measure for activation of the JNKK/JNK pathway.



MEKK 2 and 3 Do Not Regulate p38 Activity in HEK293 Cells

The p38 kinase is activated by hyperosmotic conditions (5) and recognizes the transcription factor ATF 2 as an in vitro substrate (33) . Incubation of HEK293 cells with sorbitol activated p38 kinase (Fig. 7A). Immunoprecipitation and in vitro kinase assay of p38 from MEKK 2 and 3 transfected HEK293 cells indicated that neither MEKK 2 nor MEKK 3 stimulated p38 kinase activity (not shown). Mono Q FPLC fractionation of lysates from MEKK 2 or 3 transfected HEK293 cells confirmed that p38 kinase activity was similar to that from control transfected cells (Fig. 7B). ATF 2 is also a substrate for JNK(31) . Fractions 2-8 from cells transfected with MEKK 2 or 3, that contain immunoreactive JNK, have increased kinase activity toward ATF 2. This is a predicted result based on the ability of both MEKK 2 and 3 to stimulate JNK activity in HEK293 cells. Expression of MEKK 2 and 3 also activated additional ATF 2 phosphorylating activities resolved by Mono Q fractionation. These activities are seen to elute in fractions 9-12 and 13-18 for lysates from both MEKK 2 and 3 expressing cells. These activities do not correspond by immunoblotting to JNK, p42/44, p38, or MEKK 2 or 3 and represent novel kinase activities capable of phosphorylating recombinant ATF 2 that are regulated by both MEKK 2 and 3.


Figure 7: Measurement of p38 kinase activation in MEKK 2 and 3 transfected cells. A, stimulation of p38 kinase activity in response to sorbitol. HEK293 cells were incubated for 20 min with 0.4 M sorbitol. Cells were then lysed, and p38 was immunoprecipitated using a rabbit antisera raised against a COOH-terminal peptide sequence of p38. Recombinant ATF 2 was used in an in vitro kinase assay as a substrate for p38 as described under ``Materials and Methods.'' The results are representative of two independent experiments. B, HEK293 cells were transfected with pCMV5 plasmids encoding no cDNA or MEKK 2 or 3. Lysates were prepared 48 h post-transfection and fractionated using a 0-0.5 M NaCl gradient on a Mono Q ion exchange column. Fractions were assayed for kinase activity using recombinant ATF 2 as substrate. JNK and p38 were identified in the column fractions by immunoblotting using specific antibodies for JNK and p38 (not shown).




DISCUSSION

The cloning and characterization of MEKK 2 and 3 define a family of MEKK proteins. MEKK 1, 2, and 3 are all capable of regulating both p42/44 and JNK activities. MEKK 1 and 2 appear to preferentially regulate the JNK pathway, whereas MEKK 3 shows a preference for activation of the p42/44 pathway in vivo. Cumulatively, our current and previous results (19) indicate that the different MEKKs when transiently expressed do not display a high selectivity for the p42/44 or JNK regulatory pathways. At more modest levels of expression, a greater degree of selectivity is observed for MEKK regulation of sequential protein kinase pathways. In MEKK 1-inducible clones of NIH3T3 (34) and Swiss 3T3 (35) cells, JNK is preferentially activated relative to p42/44. MEKK 1, 2, and 3 do not measurably activate the p38 kinase pathway in these cell types.

Based on the biochemical characterization of MEKK proteins, it is evident that their activities are quite distinct from those of Raf-1 and B-Raf kinases. The Raf kinases selectively regulate MEK 1 and 2 and do not recognize the JNKK proteins(1, 14, 20, 33, 34, 35) . Thus, Raf proteins which evolved in metazoan organisms appear to be highly selective for the regulation of p42/44 pathways(1, 8) . At present, no distinct pathways or substrates other than MEK and p42/44 have been defined for Raf kinases, although it is probable that additional MEK-like kinases will be identified in the future that serve as Raf substrates. MEKK proteins, in contrast, are capable of regulating both JNK and p42/44 pathways.

The ability of MEKKs to regulate multiple sequential protein kinase pathways in the cell suggests that a different mechanism exists for their regulation compared to the Raf kinases. The simplest prediction would be that MEKK proteins are selectively organized in ``signalsome'' complexes much like that for the mating pathway in S. cerevisiae. In this pathway, the protein kinases Ste11 (MEKK-like), Ste7 (MEK-like), and Fus3 (MAPK-like) are held together in a high affinity complex by Ste5(36, 37, 38) . Ste5 functions as a scaffold to keep these proteins in an organized complex. Expression of gain-of-function Ste11 mutants can result in overcoming a threshold where Ste11 crosses over to activate another sequential protein kinase pathway such as that involved in morphogenesis(21, 22, 23) . No Ste5 equivalent has yet been reported for mammalian cells and MEKKs. If such scaffold-like proteins do exist in mammalian cells and their expression is limiting, it would explain the ability of transiently expressed MEKKs to regulate both JNK and p42/44 pathways. It will obviously be necessary to define the organization of potential MEKK signalsome complexes in the cell and the constituent kinases in each complex.

Finally, the MEKK/JNK pathways can be activated by a diverse set of stimuli. These include cytokines such as TNF and IL-1(39) , low molecular weight GTP-binding regulatory proteins including Ras, Rac, and Cdc42(40, 41) , high intracellular calcium(42) , and stresses such as ultraviolet light, heat shock, osmotic imbalance, sphingomyelinase activity, protein synthesis inhibitors, etc.(1, 8, 13, 14, 20) . Based on this array of stimuli capable of activating JNK, it is likely that several independent pathways converge to regulate the JNK sequential protein kinase pathway. It is possible that MEKK 1, 2, and 3 may all regulate the JNK pathway and each functions to respond to different upstream inputs. Alternatively, it is possible that MEKK 1, 2 and 3 are not only capable of regulating the JNK pathway but also other sequential protein kinase pathways as well. Such a mechanism would allow co-ordinate regulation of both the JNK pathway and additional parallel sequential protein kinase pathways in the cell. In support of this hypothesis, we have found that MEKK 1 also selectively regulates a protein kinase pathway leading to the phosphorylation and transactivation of c-Myc that is independent of JNK and c-Jun(35) . The magnitude of a specific MEKK activation in response to a stimulus could selectively regulate different pathways such as those for JNK and c-Myc kinase activity by requiring different thresholds of MEKK activity to be obtained for stimulation of each pathway. The thresholds for MEKK regulation of these pathways might be regulated in part by the relative abundance or cellular localization of specific signalsome complexes. The cloning of MEKK 2 and 3 allows us to now address these potential regulatory mechanisms for the three MEKK proteins using both genetic and biochemical approaches.


FOOTNOTES

*
This work was supported in part by National Institutes of Health Grants DK 37871, GM 30324, CA 58157, and DK 48845. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank(TM)/EMBL Data Bank with accession number(s) U43186 [GenBank](MEKK 2) and U43187 [GenBank](MEKK 3).

§
Present address: University of Leicester School of Medicine, Cell Physiology and Pharmacology, Medical Sciences Building, University Road, Leicester LE1 9HN, UK. The first two authors contributed equally to the work in this manuscript.

Supported by the Fulbright Commission, the Wennergren Foundation and the Swedish Medical Research Council, Cancer Foundation, Society of Medicine and Institute. The first two authors contributed equally to the work in this manuscript.

**
Present address: Dept. of Pharmacology, University of Washington School of Medicine, Seattle, WA 98105.

§§
To whom correspondence should be addressed: Division of Basic Sciences, National Jewish Center for Immunology and Respiratory Medicine, 1400 Jackson St., Denver, CO 80206. Tel.: 303-398-1504; Fax: 303-398-1225.

(^1)
The abbreviations used are: MAPK, mitogen-activated protein kinase; JNK, c-Jun/stress-activated protein kinase; MEKK, mitogen-activated protein/ERK kinase kinase; PCR, polymerase chain reaction; HA, hemagglutinin; GST, glutathione S-transferase; FPLC, fast protein liquid chromatography; Pipes, 1,4-piperazinediethanesulfonic acid.


REFERENCES

  1. Kyriakis, J. M., App, H., Zhang, X.-F., Banerjee, P., Brautigan, D. C., Rapp, U. R., and Avruch, J. (1992) Nature 358, 417-421 [CrossRef][Medline] [Order article via Infotrieve]
  2. Johnson, G. L., and Vaillancourt, R. R. (1994) Curr. Opin. Cell Biol. 6, 230-238 [CrossRef][Medline] [Order article via Infotrieve]
  3. Blumer, K. J., and Johnson, G. L. (1994) Trends Biochem. Sci. 19, 236-240 [CrossRef][Medline] [Order article via Infotrieve]
  4. Davis, R. J. (1993) J. Biol. Chem. 268, 14553-14556 [Free Full Text]
  5. Han, J., Lee, J.-D., and Ulevitch, R. J. (1994) Science 265, 808-811 [Abstract/Free Full Text]
  6. Ray, L. B., and Sturgill, T. W. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 3753-3757 [Abstract/Free Full Text]
  7. Boulton, T. G., Nye, S. H., Robbins, D. J., Ip, N. Y., Radziejewska, E., Morgenbesser, S. D., DePinko, R. A., Panayotatos, N., Cobb, M. H., and Yancopoulos, G. D. (1991) Cell 65, 663-675 [CrossRef][Medline] [Order article via Infotrieve]
  8. Derijard, B., Hibi, M., Wu, H., Barrett, T., Su, B., Deng, T., Karin, M., and Davis, R. J. (1994) Cell 76, 1025-1037 [CrossRef][Medline] [Order article via Infotrieve]
  9. Crews, C. M., Alessandrini, A., and Erickson, R. L. (1992) Science 258, 478-480 [Abstract/Free Full Text]
  10. Wu, J., Harrison, J. K., Dent, P., Lynch, K. R., Weber, M. J., and Sturgill, T. W. (1993) Mol. Cell. Biol. 13, 4539-4548 [Abstract/Free Full Text]
  11. Zheng, C.-F., and Guan, K. L. (1993) J. Biol. Chem. 268, 11435-11439 [Abstract/Free Full Text]
  12. Derijard, B., Rainglaud, J., Barrett, T., Wu, I.-H., Han, J., Ulevitch, R. J., and Davis, R. J. (1995) Science 267, 682-685 [Abstract/Free Full Text]
  13. Lin, A., Minden, A., Martinetto, H., Lange-Carter, C. A., Johnson, G. L., Mercurio, F., and Karin, M. (1995) Science 268, 286-290 [Abstract/Free Full Text]
  14. Kyriakis, J. M., App, H., Zhang, X.-F., Banerjee, P., Brautigan, D. L., Rapp, U. R., and Avruch, J. (1992) Nature 358, 417-421
  15. Vaillancourt, R. R., Gardner, A. M., and Johnson, G. L. (1994) Mol. Cell. Biol. 14, 6522-6530 [Abstract/Free Full Text]
  16. Catling, A. D., Reuter, C. W. M., Cox, M. E., Parson, S. J., and Weber, M. J. (1994) J. Biol. Chem. 269, 30014-30021 [Abstract/Free Full Text]
  17. Reuter, C. W. M., Catling, A. D., Jelinek, T., and Weber, M. J. (1995) J. Biol. Chem. 270, 7644-7655 [Abstract/Free Full Text]
  18. Lange-Carter, C. A., Pleiman, C. M., Gardner, A. M., Blumer, K. J., and Johnson, G. L. (1993) Science 260, 315-319 [Abstract/Free Full Text]
  19. Lange-Carter, C. A., and Johnson, G. L. (1994) Science 265, 1458-1461 [Abstract/Free Full Text]
  20. Minden, A., Lin, A., McMahon, M., Lange-Carter, C. A., Derijard, B., Davis, R. J., Johnson, G. L., and Karin, M. (1994) Science 266, 1719-1722 [Abstract/Free Full Text]
  21. Neiman, A. M. (1993) Trends Genet. 9, 390-394 [CrossRef][Medline] [Order article via Infotrieve]
  22. Erede, B., and Levin, D. E. (1993) Curr. Opin. Cell Biol. 5, 254-260 [CrossRef][Medline] [Order article via Infotrieve]
  23. Herskowitz, I. (1995) Cell 80, 187-197 [CrossRef][Medline] [Order article via Infotrieve]
  24. Wadzinski, B. E., Eisfelder, B. J., Peruski, L. F., Jr., Mumby, M. C., and Johnson, G. L. (1992) J. Biol. Chem. 267, 16883-16888 [Abstract/Free Full Text]
  25. Qian, N.-X., Winitz, S., and Johnson, G. L. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 4077-4081 [Abstract/Free Full Text]
  26. Hibi, M., Lin, A., Smeal, T., Minden, A., and Karin, M. (1993) Genes & Dev. 7, 2135-2148
  27. Gardner, A. M., Lange-Carter, C. A., Vaillancourt, R. R., and Johnson, G. L. (1994) Methods Enzymol. 238, 258-270 [Medline] [Order article via Infotrieve]
  28. Heasley, L. E., and Johnson, G. L. (1992) Mol. Biol. Cell 3, 545-553 [Abstract]
  29. Russell, M., Lange-Carter, C. A., and Johnson, G. L. (1995) Biochemistry 34, 6611-6615 [CrossRef][Medline] [Order article via Infotrieve]
  30. Heasley, L. E., Senkfor, S. I., Winitz, S., Strasheim, A., Teitelbaum, I., and Berl, T. (1994) Am. J. Physiol. 267, F366-F373
  31. Abdel-Hafez, H., Heasley, L. E., Kyriakis, J. M., Avruch, J., Knoll, D. J., Johnson, G. L., and Hoeffler, J. P. (1992) Mol. Endocrinol. 6, 2079-2089 [Abstract]
  32. Hanks, S. K., Quinn, A. M., and Hunter, T. (1988) Science 241, 42-52 [Abstract/Free Full Text]
  33. Gupta, S., Campbell, D., Derijard, B., and Davis, R. J. (1995) Science 267, 389-393 [Abstract/Free Full Text]
  34. Yan, M., Dai, T., Deak, J. C., Kyriakis, J. M., Zon, L. I., Woodgett, J. R., and Templeton, D. J. (1994) Nature 372, 798-800 [Medline] [Order article via Infotrieve]
  35. Johnson, N. L., Gardner, A. M., Diener, K. M., Lange-Carter, C. A., Gleavy, J., Jarpe, M. B., Minden, A., Karin, M., Zon, L. I., and Johnson, G. L. (1996) J. Biol. Chem. , in press
  36. Choi, K.-Y., Satterberg, B., Lyons, D. M., and Elion, E. A. (1994) Cell 78, 499-512 [CrossRef][Medline] [Order article via Infotrieve]
  37. Marcus, S., Polverino, A., Barr, M., and Wigler, M. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 7762-7766 [Abstract/Free Full Text]
  38. Printen, J. A., and Sprague, G. F., Jr. (1994) Genetics 138, 609-619 [Abstract]
  39. Sluss, H. K., Barrett, T., Derijard, B., and Davis, R. J. (1994) Mol. Cell. Biol. 14, 8376-8384 [Abstract/Free Full Text]
  40. Coso, D. A., Chiariello, M., Yu, J.-C., Teramoto, H., Crespo, P., Xu, N., Miki, T., and Gutkind, J. S. (1995) Cell 81, 1137-1146 [CrossRef][Medline] [Order article via Infotrieve]
  41. Minden, A., Lin, A., Claret, F.-X., Abo, A., and Karin, M. (1995) Cell 81, 1147-1158 [CrossRef][Medline] [Order article via Infotrieve]
  42. Mitchell, F. M., Russell, M., and Johnson, G. L. (1995) Biochem. J. 309, 381-384

©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Ann Rheum DisHome page
G Schett, J Zwerina, and G Firestein
The p38 mitogen-activated protein kinase (MAPK) pathway in rheumatoid arthritis
Ann Rheum Dis, July 1, 2008; 67(7): 909 - 916.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
M. R. Junttila, S.-P. Li, and J. Westermarck
Phosphatase-mediated crosstalk between MAPK signaling pathways in the regulation of cell survival
FASEB J, April 1, 2008; 22(4): 954 - 965.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
Y. Deng, J. Yang, M. McCarty, and B. Su
MEKK3 is required for endothelium function but is not essential for tumor growth and angiogenesis
Am J Physiol Cell Physiol, October 1, 2007; 293(4): C1404 - C1411.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. Padda, A. Wamsley-Davis, M. C. Gustin, R. Ross, C. Yu, and D. Sheikh-Hamad
MEKK3-mediated signaling to p38 kinase and TonE in hypertonically stressed kidney cells
Am J Physiol Renal Physiol, October 1, 2006; 291(4): F874 - F881.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Fritz, K. J. Brayer, N. McCormick, D. G. Adams, B. E. Wadzinski, and R. R. Vaillancourt
Phosphorylation of Serine 526 Is Required for MEKK3 Activity, and Association with 14-3-3 Blocks Dephosphorylation
J. Biol. Chem., March 10, 2006; 281(10): 6236 - 6245.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
W. W. Woodmansee, J. M. Kerr, E. A. Tucker, J. R. Mitchell, D. J. Haakinson, D. F. Gordon, E. C. Ridgway, and W. M. Wood
The Proliferative Status of Thyrotropes Is Dependent on Modulation of Specific Cell Cycle Regulators by Thyroid Hormone
Endocrinology, January 1, 2006; 147(1): 272 - 282.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Cheng, D. Zhang, K. Kim, Y. Zhao, Y. Zhao, and B. Su
Mip1, an MEKK2-Interacting Protein, Controls MEKK2 Dimerization and Activation
Mol. Cell. Biol., July 15, 2005; 25(14): 5955 - 5964.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Cheng, L. Yu, D. Zhang, Q. Huang, D. Spencer, and B. Su
Dimerization through the Catalytic Domain Is Essential for MEKK2 Activation
J. Biol. Chem., April 8, 2005; 280(14): 13477 - 13482.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Blonska, Y. You, R. Geleziunas, and X. Lin
Restoration of NF-{kappa}B Activation by Tumor Necrosis Factor Alpha Receptor Complex-Targeted MEKK3 in Receptor-Interacting Protein-Deficient Cells
Mol. Cell. Biol., December 15, 2004; 24(24): 10757 - 10765.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Matsumoto, D. Einhaus, E. S. Gold, and A. Aderem
Simvastatin Augments Lipopolysaccharide-Induced Proinflammatory Responses in Macrophages by Differential Regulation of the c-Fos and c-Jun Transcription Factors
J. Immunol., June 15, 2004; 172(12): 7377 - 7384.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B.-e Xu, S. Stippec, L. Lenertz, B.-H. Lee, W. Zhang, Y.-K. Lee, and M. H. Cobb
WNK1 Activates ERK5 by an MEKK2/3-dependent Mechanism
J. Biol. Chem., February 27, 2004; 279(9): 7826 - 7831.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. R. Hammaker, D. L. Boyle, M. Chabaud-Riou, and G. S. Firestein
Regulation of c-Jun N-Terminal Kinase by MEKK-2 and Mitogen-Activated Protein Kinase Kinase Kinases in Rheumatoid Arthritis
J. Immunol., February 1, 2004; 172(3): 1612 - 1618.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. D. Gallagher, S. Gutowski, P. C. Sternweis, and M. H. Cobb
RhoA Binds to the Amino Terminus of MEKK1 and Regulates Its Kinase Activity
J. Biol. Chem., January 16, 2004; 279(3): 1872 - 1877.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. H. Lee, Q. Huang, S. Oikemus, J. Shank, J.-J. Ventura, N. Cusson, R. R. Vaillancourt, B. Su, R. J. Davis, and M. A. Kelliher
The Death Domain Kinase RIP1 Is Essential for Tumor Necrosis Factor Alpha Signaling to p38 Mitogen-Activated Protein Kinase
Mol. Cell. Biol., November 15, 2003; 23(22): 8377 - 8385.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. C. Platanias
Map kinase signaling pathways and hematologic malignancies
Blood, June 15, 2003; 101(12): 4667 - 4679.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. T. Moran, K. Haider, Y. Ow, P. Milton, L. Chen, and S. Pillai
Protein Kinase C-associated Kinase Can Activate NF{kappa}B in Both a Kinase-dependent and a Kinase-independent Manner
J. Biol. Chem., June 6, 2003; 278(24): 21526 - 21533.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
W.-y. Lui, W. M. Lee, and C. Y. Cheng
Transforming Growth Factor {beta}3 Regulates the Dynamics of Sertoli Cell Tight Junctions Via the p38 Mitogen-Activated Protein Kinase Pathway
Biol Reprod, May 1, 2003; 68(5): 1597 - 1612.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
W. Sun, X. Wei, K. Kesavan, T. P. Garrington, R. Fan, J. Mei, S. M. Anderson, E. W. Gelfand, and G. L. Johnson
MEK Kinase 2 and the Adaptor Protein Lad Regulate Extracellular Signal-Regulated Kinase 5 Activation by Epidermal Growth Factor via Src
Mol. Cell. Biol., April 1, 2003; 23(7): 2298 - 2308.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Chen, M. A. White, and M. H. Cobb
Stimulus-specific Requirements for MAP3 Kinases in Activating the JNK Pathway
J. Biol. Chem., December 13, 2002; 277(51): 49105 - 49110.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Holmberg, S. Katz, M. Lerdrup, T. Herdegen, M. Jaattela, A. Aronheim, and T. Kallunki
A Novel Specific Role for Ikappa B Kinase Complex-associated Protein in Cytosolic Stress Signaling
J. Biol. Chem., August 23, 2002; 277(35): 31918 - 31928.
[Abstract] [Full Text] [PDF]