|
|
|
|||||||
|
|||||||||
(Received for publication, November 9, 1995; and in revised form, December 18, 1995) From the
Four types of 17 The redox reactions at position C17 of the steroid molecule are
catalyzed by a number of different 17 The amino acid sequence comparison with the Swissprot and EMBL data
bases (17) revealed several interesting features of the type IV
enzyme (Fig. 1). The N-terminal part shows homologies to the
family of short chain alcohol
dehydrogenases(18, 19, 20) , especially to
the two short chain alcohol dehydrogenases domains of the
multifunctional (hydratase-dehydrogenase) enzymes of peroxisomal
Figure 1:
Amino acid similarities of multidomain
proteins. FOX2, hydratase-dehydrogenase of S. cerevisiae; 17
The 80-kDa protein reveals a
complex structure which was unknown among other 17
Figure 2:
Expression of 17
To clarify if the processing of the 80-kDa
protein to its N-terminal 32-kDa fragment is necessary for the
activation of the 17
Figure 3:
Processing of 80-kDa protein. Samples were
subjected to SDS-PAGE and immunoblotting with monoclonal antibody F1
conjugated with peroxidase. Lane 1, molecular mass standards; lane 2, porcine kidney homogenates; lane 3, HEK 293
cells transfected with pRep10-p80 vector coding for full-length 80-kDa
protein; lane 4, cells transfected with pRep10-p32 vector
coding for N-terminal 32-kDa fragment. Lane 2, 5 µg of
protein; lanes 3 and 4, 20 µg of protein.
Specific activities of the 17
Figure 4:
Purified domains of the porcine 80-kDa
protein. Domains were expressed in E. coli in pGex-2T PL2
vector using inserts coding for the N-terminal domain (amino acids
1-323), central hydratase-like domain (aa 324-596) and
C-terminal SCP2-like domain (aa 597-737). The glutathione S-transferase fusion proteins were adsorbed on
glutathione-agarose digested with thrombin and eluted as described
under ``Materials and Methods.'' Samples (5 µg) were
subjected to SDS-PAGE and stained with Coomassie Blue. Lane 1,
molecular mass markers; lane 2, N-terminal domain; lane
3, central domain; lane 4, C-terminal
domain.
More
direct evidence on the involvement of the SCP2-related domain in the
sterol and lipid transfer was obtained with the porcine recombinant
peptide. Both the GST-SCP2 fusion product and the SCP2-like protein
stimulate the transfer of 7-DHC and PC from donors to acceptors. The
purified porcine SCP2-like peptide increases the transfer of 7-DHC and
PC 147- and 158-fold over the control levels, respectively (Table 2). Amino acid sequence comparisons suggest a relationship
between the four human 17 The domains of the
multifunctional (fatty acids hydratase-dehydrogenase) FOX2 gene product
of S. cerevisiae were studied by Hiltunen et
al.(21) . The deletion of the carboxyl-terminal domain
(271 aa) resulted in a loss of hydratase activity (converting
trans-2-enoyl CoA into D-3 hydroxyacyl-CoA) but the D-specific 3-hydroxyacyl-CoA dehydrogenase activity was
retained. This pointed indirectly to the localization of the
dehydrogenase activity in the N-terminal part. In our report different
enzymatic activities have been assigned unequivocally to the individual
regions of the 80-kDa protein by analyses of the isolated domains
expressed in E. coli. All the functionalities suggested by the
amino acid similarities were observed in both the 80-kDa protein and in
its isolated recombinant domains. This excludes the possibility that
the processing into smaller peptides is a prerequisite for the release
of the activities. However, at least the processing into a 32-kDa
fragment was observed in porcine tissues. There are different cleavage
efficiencies: high in hormone target organs like uterus and breast
epithelium but low in non-target tissues such as kidney and
liver(40) . It is yet unclear if the separation of the 32-kDa
17 All amino acids which were shown to be essential for the lipid
transfer activity of human SCP2 by site-directed mutagenesis are
conserved in the porcine SCP2-like domain of the 80-kDa
protein(17, 25) . The relatively low activity of
porcine SCP2 may be due to the fact that some amino acids, which may be
required for the full activity are missing at the N terminus. The high
activity obtained with the purified native protein supports the view
that the separation between hydratase and SCP2 domains is not yet
optimally set. As presumed earlier by Pfeiffer et al.(26) the SCP2 might have an important function in the
beginning of steroidogenesis by stimulating the pregnenolone synthesis.
The biological role of the C-terminal sterol transfer domain contained
within the 80-kDa protein is not known at present. The results shown in Table 1strongly suggest that the domain is not involved in the
hydratase/dehydrogenase activity of the enzyme. Because the SCP2-like
domain contains the peroxisomal targeting sequence AKI (other domains
are devoid of any targeting signals) one possibility would be to ensure
proper peroxisomal localization of the whole protein. On the other hand
this exclusive function does not explain the considerable degree of
structural and functional conservation of the domain with SCP2.
Therefore, an additional function appears to be likely. In vitro SCP2 seems not to facilitate the movement of most steroids (41) or fatty acids(42) . However, we currently cannot
exclude that 17 The advantages of the multidomain
structure of porcine 80-kDa protein (17 The porcine 17
Volume 271,
Number 10,
Issue of March 8, 1996 pp. 5438-5442
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
-Hydroxysteroid Dehydrogenase, Fatty
Acyl-CoA-hydratase/Dehydrogenase, and Sterol Transfer Activities (*)
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
-hydroxysteroid dehydrogenases have been
identified so far. The porcine peroxisomal 17-hydroxysteroid
dehydrogenase type IV catalyzes the oxidation of estradiol with high
preference over the reduction of estrone. A 2.9-kilobase mRNA codes for
an 80-kDa (737 amino acids) protein featuring domains which are not
present in the other 17-hydroxysteroid dehydrogenases. The 80-kDa
protein is N terminally cleaved to a 32-kDa fragment with
17-hydroxysteroid dehydrogenase activity. Here we show for the
first time that both the 80-kDa and the N-terminal 32 kDa (amino acids
1-323) peptides are able to perform the dehydrogenase reaction
not only with steroids at the C17 position but also with
3-hydroxyacyl-CoA. The central part of the 80-kDa protein (amino acids
324-596) catalyzes the 2-enoyl-acyl-CoA hydratase reaction with
high efficiency. The C-terminal part of the 80-kDa protein (amino acids
597-737) is similar to sterol carrier protein 2 and facilitates
the transfer of 7-dehydrocholesterol and phosphatidylcholine between
membranes in vitro. The unique multidomain structure of the
80-kDa protein allows for the catalysis of several reactions so far
thought to be performed by complexes of different enzymes.
-hydroxysteroid
dehydrogenases
(17-HSD)(
)(1, 2, 3) . Until
now, four human 17-HSDs were characterized. The soluble
17-HSD type I consisting of 327 amino acids (aa) was cloned from
human placenta and performs the oxidation of estradiol at the same
efficiency as the reduction of
estrone(4, 5, 6) . The 17-HSD type II is
a microsomal enzyme of 387 aa that slightly prefers the oxidation over
the reduction of estrogens and androgens and is expressed at high
levels in the human placenta(7, 8) . The testes
predominantly express the microsomal 17-HSD type III consisting of
310 aa and is responsible for the reduction of estrogens and
androgens(9) . The porcine 17-HSD type IV inactivates
hormones very efficiently because of its 360-fold preference for
steroid oxidation (10, 11) and is the first steroid
metabolizing enzyme localized in peroxisomes(12) . The enzyme
is primarily translated as an 80-kDa protein from a 2.9-kilobase
message(13) . The post-translational modifications include an
N-terminal cleavage leading to a 32-kDa peptide(10) . A
fraction of the 32-kDa peptide is covalently linked to actin through an
(
-glutamyl)-lysine bond(14) . Recently, cloning of
the human and mouse 80-kDa 17
-HSD type IV showed a close
relationship revealing 85% amino acid similarity, the same multidomain
structure, and identical kinetic parameters of the 17-HSD
IV(15, 16) . In contrast, the overall similarity
between sequences of four human 17-HSD type I-IV is less than 25%. -oxidation of fatty acids in Saccharomyces cerevisae(21) and Candida tropicalis(22) . The central
domain of the 17-HSD type IV is 40 and 38% identical (Fig. 1) with the C-terminal parts of the S. cerevisae and C. tropicalis multidomain proteins, respectively. The
C-terminal extension of the 80-kDa protein shows an intriguing
similarity to the sterol carrier protein 2 (SCP2) which is assumed to
participate in the intracellular transport of sterols and
lipids(23, 24, 25, 26, 27) .
Although the SCP2 was first identified as a 13-kDa protein it is,
however, as well part of a 60-kDa fusion protein between SCP2 and a
peroxisomal 3-oxoacyl-CoA thiolase named
SCPx(28, 29, 30) . Recently, it was
demonstrated that SCP2 and SCPx are expressed from a single gene via
alternative transcription initiation from two distinct
promoters(31, 32) .
-HSD, porcine 80-kDa
protein; SCAD, similarity to short chain alcohol dehydrogenase
superfamily.
-hydroxysteroid
dehydrogenases and enzymes of peroxisomal -oxidation of fatty
acids. To evaluate the activities suggested by the amino acid
similarities, the functionalities of the purified porcine
17-hydroxysteroid dehydrogenase as well as the expressed
recombinant single domains were assayed.
Expression of 80-kDa 17
DNA fragments containing the coding
sequence for the amino acids 1-737 (entire 80-kDa coding region,
abbreviated as p80) and aa 1-323 (N-terminal 32-kDa fragment,
p32) of the porcine 17-Hydroxysteroid
Dehydrogenase Type IV and 32-kDa Peptide in the Human Embryonal Kidney
Cell Line 293 (HEK 293)-estradiol dehydrogenase were obtained from
the cDNA (13) by polymerase chain reaction amplification using
appropriate oligonucleotide primers adding BamHI and KpnI restriction sites at 5`- and 3`-ends, respectively. For
the amplification of full-length p80 the 5`-primer
(TTTTGGATCCATGGCCTCGATGTTGAACTTC) (position 70-90 of the porcine
cDNA sequence) (13) and the 3`-primer
(TTTGGTACCTTAAATCTTGGCATAGTCTTTAA) (position 2260-2283) and for
the N-terminal fragment p32 another 3`-primer
(TTTGGTACCTTATGATGGGGCTGCTGAAGTTGC) (position 1018-1038) were
used. The polymerase chain reaction-amplified DNA was digested with BamHI and KpnI and cloned directionally into the BamHI and KpnI restriction sites of the vector pRep10
(Invitrogen, Heidelberg, Germany). The HEK 293 cells (5 
10
cells per dish, 60 mm inner diameter) were transfected
by the calcium phosphate coprecipitation method (33) with 10
µg of the plasmids pRep10-p80 or pRep10-p32, respectively. The
cells were collected 72 h after the transfection.Expression of Domains of the 80-kDa Protein in E.
coli
DNA fragments containing the coding sequence for amino
acids 1-323 (N-terminal domain), 324-596 (central
hydratase-like domain), and 597-737 (C-terminal SCP2-like domain)
of the porcine 80-kDa protein were obtained by polymerase chain
reaction amplification from porcine cDNA. For the N-terminal domain the
same set of primers as for expression in pRep10 vector was used. For
amplification of other peptides the 5`-primers introduced an EcoRI site (for the hydratase-like domain
TTTGAATTCGGACTTGTTGAAGCTGTTGGCTAT, position 1039-1062; and for
the SCP2-like domain TTTGAATTCACTGTCATTTCAAATGCATACGTGG, position
1858-1882) and the 3`-primers the KpnI site (for the
hydratase-like domain TTTGGTACCTTAGTCTCCAGTTTCTTGGACCTTG, position
1836-1857; for the SCP2-like domain
TTTGGTACCTTAAATCTTGGCATAGTCTTTAA, position 2260-2283). Products
were ligated into the pGex 2T PL2 vector, a modified pGex 2T vector
(Pharmacia, Freiburg, Germany), with an additional KpnI site.
The E. coli (strain JM107) containing the pGex-p32,
pGex-hydratase-like or the pGex-SCP2-like plasmids, respectively, were
grown in M9 minimal media containing 50 µg/ml ampicillin. The cells
were grown in a rotary shaker at 37 °C until absorbance at 600 nm
reached 0.6, the expression was induced by 0.2 mM (final)
isopropyl-D-thiogalactopyranoside and incubated for an
additional 3 h. Cell extract preparation, the purification of the
glutathione S-transferease (GST) fusion proteins, the cleavage
with thrombin and the preparation of human SCP2 and SCPx were performed
as described(25) .Protein Purification
The purification of the
porcine 17-hydroxysteroid dehydrogenase type IV from kidney
resulted in two products as described(10) . A homogenous 32-kDa
protein representing the N-terminal fragment (the 17-HSD IV) of
the primary translation protein and a fraction (addressed as VHF)
consisting of 32 kDa (17-HSD IV), 45 kDa (actin), and 80 kDa (a
mixture of primary translation product and a covalent
dehydrogenase-actin complex).Enzyme Assays
The oxidative and reductive
17-hydroxysteroid dehydrogenase activities were measured with 100
µg of protein, 200 pmol of
[6,7-
H]17-estradiol (or
[6,7-H]estrone for the reduction) in 100 mM phosphate buffer, pH 7.8 (pH 6.6), with 1 µM NAD (NADPH) as cofactor. Products of the reaction
were separated on a reversed phase (C18) high performance liquid
chromatography with mobile phase of acetonitrile:water 1:1 (v/v) as
described(11) . The fatty acid-CoA hydratase activity was
assayed spectrophotometrically at 263 nm by following the hydration of
the trans-double bond using crotonyl-CoA as
substrate(34) . A molar extinction coefficient of 3,600 M
cm
was used to
calculate the rates. The fatty acid-CoA dehydrogenase activity was
monitored by NAD
formation (absorption at 340 nm)
using acetoacetyl-CoA as substrate(34) . Michaelis-Menten K
values were estimated from initial velocities
(conversions of substrate less than 15%) of the corresponding
reactions. SDS-PAGE and Western blotting was performed as
described(10) .Assay of in Vitro Sterol Carrier Activity and
Phosphatidylcholine Transfer Activities
Sterol and phospholipid
transfer activities were measured by monitoring the net transfer of
7-dehydrocholesterol (7-DHC) and phosphatidylcholine (PC) from small
unilamellar vesicles to Bacillus megaterium protoplasts(25) . Briefly, small unilamellar vesicles
containing egg yolk PC/7-DHC (65:35 mol %) were incubated with B. megaterium protoplasts at 37 °C for 30 min.
The assays contained 2 mM of liposomal lipid, 2.5 mg of
protoplast protein, and 1 nmol of protein in a total volume of 500
µl of SPA buffer (300 mM sucrose, 0.3% (w/v)
NaN, 60 mM potassium phosphate, pH 6.2).
Protoplasts were then separated from small unilamellar vesicles by
centrifugation in an Eppendorf centrifuge for 4 min at 8,000 rpm. The
protoplasts were washed with SPA buffer, resuspended in the same
buffer, and lysed with an equal volume of 15% ethanolic KOH. The 7-DHC
was extracted with 1.2 ml of n-hexane and quantified by
recording a UV spectrum between 320 and 250 nm (molecular absorption
coefficient at 294 nm 7,200 M cm
). Determination of the PC transfer was
performed enzymatically as described earlier(25) . Incubations
using human SCP2, SCPx, or SCP2-glutathione S-transferase
fusion proteins were used as positive controls, negative controls
contained bovine serum albumin. Human proteins were expressed and
purified as described(25) . All other materials were from
Sigma, Deisenhofen, Germany.
Expression of the 80-kDa and the 32-kDa Forms of the
17
Plasmids
containing the inserts coding for the full-length 80 kDa (pRep10-p80)
or only the N-terminal 32-kDa fragment (pRep10-p32) were used to
transfect HEK 293 cells. The capability to convert estradiol to estrone
is only observed in the cells that were transfected with the expression
vector containing the cDNA coding for the 80-kDa translation product or
the 32-kDa peptide, but not the control cells which are not transfected
or transfected with the vector only. The ability to convert
17-Hydroxysteroid Dehydrogenase in HEK 293 Cells-estradiol (E
) to estrone (E) increased
with time after transfection with pRep10-p80 (Fig. 2) or
pRep10-p32 (not shown). After 72 h the ability to oxidize E reached a plateau. Typically, the cells transfected with either
pRep10-p32 or pRep10-p80 revealed about 25-fold higher specific
17-HSD IV activity.
-hydroxysteroid
dehydrogenase activity in HEK 293 cells transfected with pRep10-p80.
HEK 293 cells were transfected with a pRep10-p80 vector coding for the
full-length 80-kDa protein and harvested at time points after
transfection as indicated. The 17-HSD activity was assayed with
17-estradiol in cell homogenates as described under
``Materials and Methods.'' Open bars, control cells; dark bars, transfected cells.
-hydroxysteroid dehydrogenase Western blot
analysis was performed. HEK 293 cells transfected with plasmid coding
for the full-length or the N-terminal domain were subjected to
immunoblotting with a mouse monoclonal antibody F1 (10) recognizing both the 80- and 32-kDa forms of the enzyme (Fig. 3). The effect of in vivo processing is shown in
porcine kidney homogenates (Fig. 3, lane 2). The cells
transfected with pRep10-p80 reveal a single band at 80 kDa (lane
3), those transfected with pRep10-p32 a band at 32 kDa (lane
4). Since the transfected cells show comparable specific activity
of the 17-HSD (Fig. 3) and no 32-kDa band is seen in cells
transfected with pRep10-p80, the 80-kDa protein is active as a
17-hydroxysteroid dehydrogenase without cleavage to the 32-kDa
fragment.
-HSD IV are given at the bottom.
Expression of N-terminal, Central and SCP2-like Domains
of the 80-kDa Protein in E. coli
In order to check for the
presence of activities predicted by amino acid similarities of the
80-kDa protein its three domains were expressed separately. The
N-terminal domain and the central hydratase-like part of porcine 80-kDa
protein fused to glutathione S-transferase (26 kDa) result in
products of about 62 and 58 kDa, respectively. The corresponding fusion
protein with the C-terminal SCP2-like part amounts to 44 kDa. Following
the isopropyl-D-thiogalactopyranoside induction, approximately
1-5% of total cell protein of cells containing the expression
vectors pGex-p32, pGex-hydratase, or pGex-pSCP2 consisted of the
recombinant peptides. Essentially pure fusion proteins were obtained
after a single passage through glutathione-agarose. Cleavage of the
fusion proteins on the glutathione-agarose column with thrombin
released single peptides (Fig. 4). The authenticity of the
recombinant proteins was checked by DNA sequencing of the expression
vectors and by N-terminal amino acid sequencing of the first 10
residues (data not shown).
Kinetic Parameters of Porcine 17
Table 1summarizes catalytic parameters of
the 80-kDa protein and its individually expressed domains. The domains
were expressed using pGex vector and analyzed after purification. The
N-terminal domain (aa 1-323) catalyzes both the
17-Hydroxysteroid
Dehydrogenase Type IV, Fatty Acid-CoA Hydratase, and Fatty Acid-CoA
Dehydrogenase-hydroxysteroid- and 3-hydroxyacyl-CoA dehydrogenase reactions.
The central domain (aa 324-596) reveals fatty acyl-CoA 2-enoyl
hydratase activity. Kinetic parameters (K, V
) of the expressed full-length 80-kDa protein
are close to those observed in expressed domains or in the native
purified enzyme (VHF). The expressed N-terminal domain and the 80-kDa
proteins have the same K values for
17-estradiol as that of purified 32-kDa enzyme (0.2
µM)(10, 11) .
Sterol and Lipid Transfer Activities
The ability
to transfer 7-DHC and PC was first investigated in the VHF fraction of
the porcine 17-hydroxysteroid dehydrogenase
purification(10) . This fraction contains the 80-kDa protein
(with its C-terminal SCP2-like domain) which under native conditions
copurifies with 32-kDa enzyme, actin, and a covalent actin-32 kDa
protein complex. High levels of transfer activities of both, 7-DHC and
PC, are revealed by the VHF fraction. Under the assumption that these
activities are due to the SCP2-like domain of the 80-kDa protein
specific transfer activity for 7-DHC is 39% and for PC 44% of that
evaluated for the human SCP2 (Table 2). The specific transfer
activities of the 80-kDa protein are close to those of SCPx.
-hydroxysteroid dehydrogenases and
bacterial proteins involved in fatty acid metabolism(35) . The
high similarity of 17-HSD IV to the C. tropicalis or S. cerevisiae enzymes participating in the
peroxisomal -oxidation of fatty acids even suggests a common
ancestor(17, 35, 36) . The porcine
17-HSD IV is the first peroxisomal enzyme with proven
dehydrogenase activity against steroids and fatty acids. The K values for 17-estradiol (0.2-0.4
µM) and for crotonyl-CoA (31-35 µM) are
compatible with the physiological concentrations of the substrates and
are close to K observed in other dehydrogenases
specialized in either
substrate(1, 34, 37, 38) . Recently,
a rat homologue (85% amino acid identity) of the porcine protein has
been purified (39) and cloned. ()The isolated rat
enzyme shows activity of 3-hydroxyacyl-CoA dehydrogenase with fatty
acids, 2-methyl-branched fatty acids, and bile acid intermediates
(3-hydroxyacyl derivative of trihydroxycoprostanic acid)(39) .
It remains to be settled which substances are the preferred in vivo substrates for the 80-kDa protein.-HSD IV from the other parts is an advantage in hormone
inactivation. Most probably the lack of the hydratase and SCP2 domains
in the vicinity of the 17-HSD IV could reduce the competition
between steroids and fatty acids for the active center of 17-HSD
IV.-HSD IV also utilizes other, more hydrophobic
substrates in vivo which may require transfer from the
peroxisomal membrane to the catalytically active site, located
primarily in the peroxisomal matrix. Alternatively, at present it
cannot be ruled out that the SCP2-like domain has no direct functional
relevance with respect to the catalytic activity of the 80-kDa protein.
Additional studies are clearly necessary in order to discriminate
between these possibilities.-HSD IV + hydratase
+ SCP2) or of the SCPx (3-oxoacyl-CoA thiolase + SCP2) remain
to be established. It permits the coordination of regulation of gene
expression for functionally related but yet diverse enzymes. The
composition of the 80-kDa protein allows for the catalysis of several
processes of peroxisomal -oxidation of fatty acids by a single
macromolecule instead of a participation of several
enzymes(21, 38, 39, 43) . Such a
concerted action might further be essential in the metabolism of
sterols and steroids.-hydroxysteroid
dehydrogenase IV is the first peroxisomal enzyme known to be stimulated
by progesterone(40) . The hormone is as well responsible for
the regulation of other types of 17-HSD(44, 45) .
The recently purified and cloned rat 80-kDa homologue responds as well
to peroxisomal proliferators such as clofibrate and WY
14,643(39, 46) . The 80-kDa protein seems to be
controlled by modulators of steroid and fatty acid metabolism. The high
level of conservation of amino acid sequence (85% identity) between
human, mouse, rat, and porcine 80-kDa proteins suggests an essential
function of this type of protein.
)-HSD,
17-hydroxysteroid dehydrogenase; aa, amino acid(s); 7-DHC,
7-dehydrocholesterol; GST, glutathione S-transferase; HEK 293,
human embryonal kidney cell line 293; PC, phosphatidylcholine; SCAD,
short chain alcohol dehydrogenase; SCP2, sterol carrier protein 2;
SCPx, sterol carrier protein x; PAGE, polyacrylamide gel
electrophoresis.)
We are grateful to Prof. Dr. P. W. Jungblut for
discussions and support during the course of this work. We thank Dr. H.
Thole for amino acid sequencing of recombinant proteins and Dr. B.
Schoeman, Max Planck Institute for Cell Biology, Ladenburg, for the
synthesis of oligonucleotides. We thank Niels
Krebsfänger, Hendrik Knötgen,
and Alexandra Koch for excellent technical assistance.
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  J. Edqvist, E. Ronnberg, S. Rosenquist, K. Blomqvist, L. Viitanen, T. A. Salminen, M. Nylund, J. Tuuf, and P. Mattjus Plants Express a Lipid Transfer Protein with High Similarity to Mammalian Sterol Carrier Protein-2 J. Biol. Chem., December 17, 2004; 279(51): 53544 - 53553. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. Brown, D. Boerboom, N. Bouchard, M. Dore, J. G. Lussier, and J. Sirois Human Chorionic Gonadotropin-Dependent Regulation of 17{beta}-Hydroxysteroid Dehydrogenase Type 4 in Preovulatory Follicles and Its Potential Role in Follicular Luteinization Endocrinology, April 1, 2004; 145(4): 1906 - 1915. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Marijanovic, D. Laubner, G. Moller, C. Gege, B. Husen, J. Adamski, and R. Breitling Closing the Gap: Identification of Human 3-Ketosteroid Reductase, the Last Unknown Enzyme of Mammalian Cholesterol Biosynthesis Mol. Endocrinol., September 1, 2003; 17(9): 1715 - 1725. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. G. Erben, D. W. Soegiarto, K. Weber, U. Zeitz, M. Lieberherr, R. Gniadecki, G. Moller, J. Adamski, and R. Balling Deletion of Deoxyribonucleic Acid Binding Domain of the Vitamin D Receptor Abrogates Genomic and Nongenomic Functions of Vitamin D Mol. Endocrinol., July 1, 2002; 16(7): 1524 - 1537. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-M. Qin, A. M. Haapalainen, S. H. Kilpelainen, M. S. Marttila, M. K. Koski, T. Glumoff, D. K. Novikov, and J. K. Hiltunen Human Peroxisomal Multifunctional Enzyme Type 2. SITE-DIRECTED MUTAGENESIS STUDIES SHOW THE IMPORTANCE OF TWO PROTIC RESIDUES FOR 2-ENOYL-CoA HYDRATASE 2 ACTIVITY J. Biol. Chem., February 18, 2000; 275(7): 4965 - 4972. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-M. Qin, M. S. Marttila, A. M. Haapalainen, K. M. Siivari, T. Glumoff, and J. K. Hiltunen Yeast Peroxisomal Multifunctional Enzyme: (3R)-Hydroxyacyl-CoA Dehydrogenase Domains A and B Are Required for Optimal Growth on Oleic Acid J. Biol. Chem., October 1, 1999; 274(40): 28619 - 28625. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. English, K. F. Kane, N. Cruickshank, M. J. S. Langman, P. M. Stewart, and M. Hewison Loss of Estrogen Inactivation in Colonic Cancer J. Clin. Endocrinol. Metab., June 1, 1999; 84(6): 2080 - 2085. [Abstract] [Full Text]
|
|
|
|
|
|
X.-Y. He, G. Merz, P. Mehta, H. Schulz, and S.-Y. Yang Human Brain Short Chain L-3-Hydroxyacyl Coenzyme A Dehydrogenase Is a Single-domain Multifunctional Enzyme. CHARACTERIZATION OF A NOVEL 17beta -HYDROXYSTEROID DEHYDROGENASE J. Biol. Chem., May 21, 1999; 274(21): 15014 - 15019. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Fomitcheva, M. E. Baker, E. Anderson, G. Y. Lee, and N. Aziz Characterization of Ke 6, a New 17beta -Hydroxysteroid Dehydrogenase, and Its Expression in Gonadal Tissues J. Biol. Chem., August 28, 1998; 273(35): 22664 - 22671. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Seedorf, M. Raabe, P. Ellinghaus, F. Kannenberg, M. Fobker, T. Engel, S. Denis, F. Wouters, K. W.A. Wirtz, R. J.A. Wanders, et al. Defective peroxisomal catabolism of branched fatty acyl coenzyme A in mice lacking the sterol carrier protein-2/sterol carrier protein-x gene function Genes & Dev., April 15, 1998; 12(8): 1189 - 1201. [Abstract] [Full Text]
|
|
|
|
 |
|
 E. G. van Grunsven, E. van Berkel, L. Ijlst, P. Vreken, J. B. C. de Klerk, J. Adamski, H. Lemonde, P. T. Clayton, D. A. Cuebas, and R. J. A. Wanders Peroxisomal D-hydroxyacyl-CoA dehydrogenase deficiency: Resolution of the enzyme defect and its molecular basis in bifunctional protein deficiency PNAS, March 3, 1998; 95(5): 2128 - 2133. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. A. M. Castagnetta, G. Carruba, A. Traina, O. M. Granata, M. Markus, M. Pavone-Macaluso, C. H. Blomquist, and J. Adamski Expression of Different 17{beta}-Hydroxysteroid Dehydrogenase Types and Their Activities in Human Prostate Cancer Cells Endocrinology, November 1, 1997; 138(11): 4876 - 4882. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. D. Antonenkov, P. P. Van Veldhoven, E. Waelkens, and G. P. Mannaerts Substrate Specificities of 3-Oxoacyl-CoA Thiolase A and Sterol Carrier Protein 2/3-Oxoacyl-CoA Thiolase Purified from Normal Rat Liver Peroxisomes. STEROL CARRIER PROTEIN 2/3-OXOACYL-CoA THIOLASE IS INVOLVED IN THE METABOLISM OF 2-METHYL-BRANCHED FATTY ACIDS AND BILE ACID INTERMEDIATES J. Biol. Chem., October 10, 1997; 272(41): 26023 - 26031. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. M. Penning Molecular Endocrinology of Hydroxysteroid Dehydrogenases Endocr. Rev., June 1, 1997; 18(3): 281 - 305. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |