Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leenders, F.
Right arrow Articles by Adamski, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leenders, F.
Right arrow Articles by Adamski, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 271, Number 10, Issue of March 8, 1996 pp. 5438-5442
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
Porcine 80-kDa Protein Reveals Intrinsic 17-Hydroxysteroid Dehydrogenase, Fatty Acyl-CoA-hydratase/Dehydrogenase, and Sterol Transfer Activities (*)

(Received for publication, November 9, 1995; and in revised form, December 18, 1995)

Frauke Leenders (§) Jacob G. Tesdorpf (1) Monika Markus (1) Thomas Engel (2) Udo Seedorf (2) Jerzy Adamski (1)(¶)

From the  (1)Max-Planck-Institut für experimentelle Endokrinologie, 30603 Hannover, Germany and the (2)Institut für Arterioskleroseforschung, Universität Münster, 48149 Münster, Germany

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Four types of 17beta-hydroxysteroid dehydrogenases have been identified so far. The porcine peroxisomal 17beta-hydroxysteroid dehydrogenase type IV catalyzes the oxidation of estradiol with high preference over the reduction of estrone. A 2.9-kilobase mRNA codes for an 80-kDa (737 amino acids) protein featuring domains which are not present in the other 17beta-hydroxysteroid dehydrogenases. The 80-kDa protein is N terminally cleaved to a 32-kDa fragment with 17beta-hydroxysteroid dehydrogenase activity. Here we show for the first time that both the 80-kDa and the N-terminal 32 kDa (amino acids 1-323) peptides are able to perform the dehydrogenase reaction not only with steroids at the C17 position but also with 3-hydroxyacyl-CoA. The central part of the 80-kDa protein (amino acids 324-596) catalyzes the 2-enoyl-acyl-CoA hydratase reaction with high efficiency. The C-terminal part of the 80-kDa protein (amino acids 597-737) is similar to sterol carrier protein 2 and facilitates the transfer of 7-dehydrocholesterol and phosphatidylcholine between membranes in vitro. The unique multidomain structure of the 80-kDa protein allows for the catalysis of several reactions so far thought to be performed by complexes of different enzymes.


INTRODUCTION

The redox reactions at position C17 of the steroid molecule are catalyzed by a number of different 17beta-hydroxysteroid dehydrogenases (17beta-HSD)(^1)(1, 2, 3) . Until now, four human 17beta-HSDs were characterized. The soluble 17beta-HSD type I consisting of 327 amino acids (aa) was cloned from human placenta and performs the oxidation of estradiol at the same efficiency as the reduction of estrone(4, 5, 6) . The 17beta-HSD type II is a microsomal enzyme of 387 aa that slightly prefers the oxidation over the reduction of estrogens and androgens and is expressed at high levels in the human placenta(7, 8) . The testes predominantly express the microsomal 17beta-HSD type III consisting of 310 aa and is responsible for the reduction of estrogens and androgens(9) . The porcine 17beta-HSD type IV inactivates hormones very efficiently because of its 360-fold preference for steroid oxidation (10, 11) and is the first steroid metabolizing enzyme localized in peroxisomes(12) . The enzyme is primarily translated as an 80-kDa protein from a 2.9-kilobase message(13) . The post-translational modifications include an N-terminal cleavage leading to a 32-kDa peptide(10) . A fraction of the 32-kDa peptide is covalently linked to actin through an (-glutamyl)-lysine bond(14) . Recently, cloning of the human and mouse 80-kDa 17beta-HSD type IV showed a close relationship revealing 85% amino acid similarity, the same multidomain structure, and identical kinetic parameters of the 17beta-HSD IV(15, 16) . In contrast, the overall similarity between sequences of four human 17beta-HSD type I-IV is less than 25%.

The amino acid sequence comparison with the Swissprot and EMBL data bases (17) revealed several interesting features of the type IV enzyme (Fig. 1). The N-terminal part shows homologies to the family of short chain alcohol dehydrogenases(18, 19, 20) , especially to the two short chain alcohol dehydrogenases domains of the multifunctional (hydratase-dehydrogenase) enzymes of peroxisomal beta-oxidation of fatty acids in Saccharomyces cerevisae(21) and Candida tropicalis(22) . The central domain of the 17beta-HSD type IV is 40 and 38% identical (Fig. 1) with the C-terminal parts of the S. cerevisae and C. tropicalis multidomain proteins, respectively. The C-terminal extension of the 80-kDa protein shows an intriguing similarity to the sterol carrier protein 2 (SCP2) which is assumed to participate in the intracellular transport of sterols and lipids(23, 24, 25, 26, 27) . Although the SCP2 was first identified as a 13-kDa protein it is, however, as well part of a 60-kDa fusion protein between SCP2 and a peroxisomal 3-oxoacyl-CoA thiolase named SCPx(28, 29, 30) . Recently, it was demonstrated that SCP2 and SCPx are expressed from a single gene via alternative transcription initiation from two distinct promoters(31, 32) .


Figure 1: Amino acid similarities of multidomain proteins. FOX2, hydratase-dehydrogenase of S. cerevisiae; 17beta-HSD, porcine 80-kDa protein; SCAD, similarity to short chain alcohol dehydrogenase superfamily.



The 80-kDa protein reveals a complex structure which was unknown among other 17beta-hydroxysteroid dehydrogenases and enzymes of peroxisomal beta-oxidation of fatty acids. To evaluate the activities suggested by the amino acid similarities, the functionalities of the purified porcine 17beta-hydroxysteroid dehydrogenase as well as the expressed recombinant single domains were assayed.


MATERIALS AND METHODS

Expression of 80-kDa 17beta-Hydroxysteroid Dehydrogenase Type IV and 32-kDa Peptide in the Human Embryonal Kidney Cell Line 293 (HEK 293)

DNA fragments containing the coding sequence for the amino acids 1-737 (entire 80-kDa coding region, abbreviated as p80) and aa 1-323 (N-terminal 32-kDa fragment, p32) of the porcine 17beta-estradiol dehydrogenase were obtained from the cDNA (13) by polymerase chain reaction amplification using appropriate oligonucleotide primers adding BamHI and KpnI restriction sites at 5`- and 3`-ends, respectively. For the amplification of full-length p80 the 5`-primer (TTTTGGATCCATGGCCTCGATGTTGAACTTC) (position 70-90 of the porcine cDNA sequence) (13) and the 3`-primer (TTTGGTACCTTAAATCTTGGCATAGTCTTTAA) (position 2260-2283) and for the N-terminal fragment p32 another 3`-primer (TTTGGTACCTTATGATGGGGCTGCTGAAGTTGC) (position 1018-1038) were used. The polymerase chain reaction-amplified DNA was digested with BamHI and KpnI and cloned directionally into the BamHI and KpnI restriction sites of the vector pRep10 (Invitrogen, Heidelberg, Germany). The HEK 293 cells (5 times 10^4 cells per dish, 60 mm inner diameter) were transfected by the calcium phosphate coprecipitation method (33) with 10 µg of the plasmids pRep10-p80 or pRep10-p32, respectively. The cells were collected 72 h after the transfection.

Expression of Domains of the 80-kDa Protein in E. coli

DNA fragments containing the coding sequence for amino acids 1-323 (N-terminal domain), 324-596 (central hydratase-like domain), and 597-737 (C-terminal SCP2-like domain) of the porcine 80-kDa protein were obtained by polymerase chain reaction amplification from porcine cDNA. For the N-terminal domain the same set of primers as for expression in pRep10 vector was used. For amplification of other peptides the 5`-primers introduced an EcoRI site (for the hydratase-like domain TTTGAATTCGGACTTGTTGAAGCTGTTGGCTAT, position 1039-1062; and for the SCP2-like domain TTTGAATTCACTGTCATTTCAAATGCATACGTGG, position 1858-1882) and the 3`-primers the KpnI site (for the hydratase-like domain TTTGGTACCTTAGTCTCCAGTTTCTTGGACCTTG, position 1836-1857; for the SCP2-like domain TTTGGTACCTTAAATCTTGGCATAGTCTTTAA, position 2260-2283). Products were ligated into the pGex 2T PL2 vector, a modified pGex 2T vector (Pharmacia, Freiburg, Germany), with an additional KpnI site. The E. coli (strain JM107) containing the pGex-p32, pGex-hydratase-like or the pGex-SCP2-like plasmids, respectively, were grown in M9 minimal media containing 50 µg/ml ampicillin. The cells were grown in a rotary shaker at 37 °C until absorbance at 600 nm reached 0.6, the expression was induced by 0.2 mM (final) isopropyl-D-thiogalactopyranoside and incubated for an additional 3 h. Cell extract preparation, the purification of the glutathione S-transferease (GST) fusion proteins, the cleavage with thrombin and the preparation of human SCP2 and SCPx were performed as described(25) .

Protein Purification

The purification of the porcine 17beta-hydroxysteroid dehydrogenase type IV from kidney resulted in two products as described(10) . A homogenous 32-kDa protein representing the N-terminal fragment (the 17beta-HSD IV) of the primary translation protein and a fraction (addressed as VHF) consisting of 32 kDa (17beta-HSD IV), 45 kDa (actin), and 80 kDa (a mixture of primary translation product and a covalent dehydrogenase-actin complex).

Enzyme Assays

The oxidative and reductive 17beta-hydroxysteroid dehydrogenase activities were measured with 100 µg of protein, 200 pmol of [6,7-^3H]17beta-estradiol (or [6,7-^3H]estrone for the reduction) in 100 mM phosphate buffer, pH 7.8 (pH 6.6), with 1 µM NAD (NADPH) as cofactor. Products of the reaction were separated on a reversed phase (C18) high performance liquid chromatography with mobile phase of acetonitrile:water 1:1 (v/v) as described(11) . The fatty acid-CoA hydratase activity was assayed spectrophotometrically at 263 nm by following the hydration of the trans-double bond using crotonyl-CoA as substrate(34) . A molar extinction coefficient of 3,600 M cm was used to calculate the rates. The fatty acid-CoA dehydrogenase activity was monitored by NAD formation (absorption at 340 nm) using acetoacetyl-CoA as substrate(34) . Michaelis-Menten K(m) values were estimated from initial velocities (conversions of substrate less than 15%) of the corresponding reactions. SDS-PAGE and Western blotting was performed as described(10) .

Assay of in Vitro Sterol Carrier Activity and Phosphatidylcholine Transfer Activities

Sterol and phospholipid transfer activities were measured by monitoring the net transfer of 7-dehydrocholesterol (7-DHC) and phosphatidylcholine (PC) from small unilamellar vesicles to Bacillus megaterium protoplasts(25) . Briefly, small unilamellar vesicles containing egg yolk PC/7-DHC (65:35 mol %) were incubated with B. megaterium protoplasts at 37 °C for 30 min. The assays contained 2 mM of liposomal lipid, 2.5 mg of protoplast protein, and 1 nmol of protein in a total volume of 500 µl of SPA buffer (300 mM sucrose, 0.3% (w/v) NaN(3), 60 mM potassium phosphate, pH 6.2). Protoplasts were then separated from small unilamellar vesicles by centrifugation in an Eppendorf centrifuge for 4 min at 8,000 rpm. The protoplasts were washed with SPA buffer, resuspended in the same buffer, and lysed with an equal volume of 15% ethanolic KOH. The 7-DHC was extracted with 1.2 ml of n-hexane and quantified by recording a UV spectrum between 320 and 250 nm (molecular absorption coefficient at 294 nm 7,200 M cm). Determination of the PC transfer was performed enzymatically as described earlier(25) . Incubations using human SCP2, SCPx, or SCP2-glutathione S-transferase fusion proteins were used as positive controls, negative controls contained bovine serum albumin. Human proteins were expressed and purified as described(25) . All other materials were from Sigma, Deisenhofen, Germany.


RESULTS

Expression of the 80-kDa and the 32-kDa Forms of the 17beta-Hydroxysteroid Dehydrogenase in HEK 293 Cells

Plasmids containing the inserts coding for the full-length 80 kDa (pRep10-p80) or only the N-terminal 32-kDa fragment (pRep10-p32) were used to transfect HEK 293 cells. The capability to convert estradiol to estrone is only observed in the cells that were transfected with the expression vector containing the cDNA coding for the 80-kDa translation product or the 32-kDa peptide, but not the control cells which are not transfected or transfected with the vector only. The ability to convert 17beta-estradiol (E(2)) to estrone (E(1)) increased with time after transfection with pRep10-p80 (Fig. 2) or pRep10-p32 (not shown). After 72 h the ability to oxidize E(2) reached a plateau. Typically, the cells transfected with either pRep10-p32 or pRep10-p80 revealed about 25-fold higher specific 17beta-HSD IV activity.


Figure 2: Expression of 17beta-hydroxysteroid dehydrogenase activity in HEK 293 cells transfected with pRep10-p80. HEK 293 cells were transfected with a pRep10-p80 vector coding for the full-length 80-kDa protein and harvested at time points after transfection as indicated. The 17beta-HSD activity was assayed with 17beta-estradiol in cell homogenates as described under ``Materials and Methods.'' Open bars, control cells; dark bars, transfected cells.



To clarify if the processing of the 80-kDa protein to its N-terminal 32-kDa fragment is necessary for the activation of the 17beta-hydroxysteroid dehydrogenase Western blot analysis was performed. HEK 293 cells transfected with plasmid coding for the full-length or the N-terminal domain were subjected to immunoblotting with a mouse monoclonal antibody F1 (10) recognizing both the 80- and 32-kDa forms of the enzyme (Fig. 3). The effect of in vivo processing is shown in porcine kidney homogenates (Fig. 3, lane 2). The cells transfected with pRep10-p80 reveal a single band at 80 kDa (lane 3), those transfected with pRep10-p32 a band at 32 kDa (lane 4). Since the transfected cells show comparable specific activity of the 17beta-HSD (Fig. 3) and no 32-kDa band is seen in cells transfected with pRep10-p80, the 80-kDa protein is active as a 17beta-hydroxysteroid dehydrogenase without cleavage to the 32-kDa fragment.


Figure 3: Processing of 80-kDa protein. Samples were subjected to SDS-PAGE and immunoblotting with monoclonal antibody F1 conjugated with peroxidase. Lane 1, molecular mass standards; lane 2, porcine kidney homogenates; lane 3, HEK 293 cells transfected with pRep10-p80 vector coding for full-length 80-kDa protein; lane 4, cells transfected with pRep10-p32 vector coding for N-terminal 32-kDa fragment. Lane 2, 5 µg of protein; lanes 3 and 4, 20 µg of protein. Specific activities of the 17beta-HSD IV are given at the bottom.



Expression of N-terminal, Central and SCP2-like Domains of the 80-kDa Protein in E. coli

In order to check for the presence of activities predicted by amino acid similarities of the 80-kDa protein its three domains were expressed separately. The N-terminal domain and the central hydratase-like part of porcine 80-kDa protein fused to glutathione S-transferase (26 kDa) result in products of about 62 and 58 kDa, respectively. The corresponding fusion protein with the C-terminal SCP2-like part amounts to 44 kDa. Following the isopropyl-D-thiogalactopyranoside induction, approximately 1-5% of total cell protein of cells containing the expression vectors pGex-p32, pGex-hydratase, or pGex-pSCP2 consisted of the recombinant peptides. Essentially pure fusion proteins were obtained after a single passage through glutathione-agarose. Cleavage of the fusion proteins on the glutathione-agarose column with thrombin released single peptides (Fig. 4). The authenticity of the recombinant proteins was checked by DNA sequencing of the expression vectors and by N-terminal amino acid sequencing of the first 10 residues (data not shown).


Figure 4: Purified domains of the porcine 80-kDa protein. Domains were expressed in E. coli in pGex-2T PL2 vector using inserts coding for the N-terminal domain (amino acids 1-323), central hydratase-like domain (aa 324-596) and C-terminal SCP2-like domain (aa 597-737). The glutathione S-transferase fusion proteins were adsorbed on glutathione-agarose digested with thrombin and eluted as described under ``Materials and Methods.'' Samples (5 µg) were subjected to SDS-PAGE and stained with Coomassie Blue. Lane 1, molecular mass markers; lane 2, N-terminal domain; lane 3, central domain; lane 4, C-terminal domain.



Kinetic Parameters of Porcine 17beta-Hydroxysteroid Dehydrogenase Type IV, Fatty Acid-CoA Hydratase, and Fatty Acid-CoA Dehydrogenase

Table 1summarizes catalytic parameters of the 80-kDa protein and its individually expressed domains. The domains were expressed using pGex vector and analyzed after purification. The N-terminal domain (aa 1-323) catalyzes both the 17beta-hydroxysteroid- and 3-hydroxyacyl-CoA dehydrogenase reactions. The central domain (aa 324-596) reveals fatty acyl-CoA 2-enoyl hydratase activity. Kinetic parameters (K(m), V(max)) of the expressed full-length 80-kDa protein are close to those observed in expressed domains or in the native purified enzyme (VHF). The expressed N-terminal domain and the 80-kDa proteins have the same K(m) values for 17beta-estradiol as that of purified 32-kDa enzyme (0.2 µM)(10, 11) .



Sterol and Lipid Transfer Activities

The ability to transfer 7-DHC and PC was first investigated in the VHF fraction of the porcine 17beta-hydroxysteroid dehydrogenase purification(10) . This fraction contains the 80-kDa protein (with its C-terminal SCP2-like domain) which under native conditions copurifies with 32-kDa enzyme, actin, and a covalent actin-32 kDa protein complex. High levels of transfer activities of both, 7-DHC and PC, are revealed by the VHF fraction. Under the assumption that these activities are due to the SCP2-like domain of the 80-kDa protein specific transfer activity for 7-DHC is 39% and for PC 44% of that evaluated for the human SCP2 (Table 2). The specific transfer activities of the 80-kDa protein are close to those of SCPx.



More direct evidence on the involvement of the SCP2-related domain in the sterol and lipid transfer was obtained with the porcine recombinant peptide. Both the GST-SCP2 fusion product and the SCP2-like protein stimulate the transfer of 7-DHC and PC from donors to acceptors. The purified porcine SCP2-like peptide increases the transfer of 7-DHC and PC 147- and 158-fold over the control levels, respectively (Table 2).


DISCUSSION

Amino acid sequence comparisons suggest a relationship between the four human 17beta-hydroxysteroid dehydrogenases and bacterial proteins involved in fatty acid metabolism(35) . The high similarity of 17beta-HSD IV to the C. tropicalis or S. cerevisiae enzymes participating in the peroxisomal beta-oxidation of fatty acids even suggests a common ancestor(17, 35, 36) . The porcine 17beta-HSD IV is the first peroxisomal enzyme with proven dehydrogenase activity against steroids and fatty acids. The K(m) values for 17beta-estradiol (0.2-0.4 µM) and for crotonyl-CoA (31-35 µM) are compatible with the physiological concentrations of the substrates and are close to K(m) observed in other dehydrogenases specialized in either substrate(1, 34, 37, 38) . Recently, a rat homologue (85% amino acid identity) of the porcine protein has been purified (39) and cloned. (^2)The isolated rat enzyme shows activity of 3-hydroxyacyl-CoA dehydrogenase with fatty acids, 2-methyl-branched fatty acids, and bile acid intermediates (3-hydroxyacyl derivative of trihydroxycoprostanic acid)(39) . It remains to be settled which substances are the preferred in vivo substrates for the 80-kDa protein.

The domains of the multifunctional (fatty acids hydratase-dehydrogenase) FOX2 gene product of S. cerevisiae were studied by Hiltunen et al.(21) . The deletion of the carboxyl-terminal domain (271 aa) resulted in a loss of hydratase activity (converting trans-2-enoyl CoA into D-3 hydroxyacyl-CoA) but the D-specific 3-hydroxyacyl-CoA dehydrogenase activity was retained. This pointed indirectly to the localization of the dehydrogenase activity in the N-terminal part. In our report different enzymatic activities have been assigned unequivocally to the individual regions of the 80-kDa protein by analyses of the isolated domains expressed in E. coli. All the functionalities suggested by the amino acid similarities were observed in both the 80-kDa protein and in its isolated recombinant domains. This excludes the possibility that the processing into smaller peptides is a prerequisite for the release of the activities. However, at least the processing into a 32-kDa fragment was observed in porcine tissues. There are different cleavage efficiencies: high in hormone target organs like uterus and breast epithelium but low in non-target tissues such as kidney and liver(40) . It is yet unclear if the separation of the 32-kDa 17beta-HSD IV from the other parts is an advantage in hormone inactivation. Most probably the lack of the hydratase and SCP2 domains in the vicinity of the 17beta-HSD IV could reduce the competition between steroids and fatty acids for the active center of 17beta-HSD IV.

All amino acids which were shown to be essential for the lipid transfer activity of human SCP2 by site-directed mutagenesis are conserved in the porcine SCP2-like domain of the 80-kDa protein(17, 25) . The relatively low activity of porcine SCP2 may be due to the fact that some amino acids, which may be required for the full activity are missing at the N terminus. The high activity obtained with the purified native protein supports the view that the separation between hydratase and SCP2 domains is not yet optimally set. As presumed earlier by Pfeiffer et al.(26) the SCP2 might have an important function in the beginning of steroidogenesis by stimulating the pregnenolone synthesis. The biological role of the C-terminal sterol transfer domain contained within the 80-kDa protein is not known at present. The results shown in Table 1strongly suggest that the domain is not involved in the hydratase/dehydrogenase activity of the enzyme. Because the SCP2-like domain contains the peroxisomal targeting sequence AKI (other domains are devoid of any targeting signals) one possibility would be to ensure proper peroxisomal localization of the whole protein. On the other hand this exclusive function does not explain the considerable degree of structural and functional conservation of the domain with SCP2. Therefore, an additional function appears to be likely. In vitro SCP2 seems not to facilitate the movement of most steroids (41) or fatty acids(42) . However, we currently cannot exclude that 17beta-HSD IV also utilizes other, more hydrophobic substrates in vivo which may require transfer from the peroxisomal membrane to the catalytically active site, located primarily in the peroxisomal matrix. Alternatively, at present it cannot be ruled out that the SCP2-like domain has no direct functional relevance with respect to the catalytic activity of the 80-kDa protein. Additional studies are clearly necessary in order to discriminate between these possibilities.

The advantages of the multidomain structure of porcine 80-kDa protein (17beta-HSD IV + hydratase + SCP2) or of the SCPx (3-oxoacyl-CoA thiolase + SCP2) remain to be established. It permits the coordination of regulation of gene expression for functionally related but yet diverse enzymes. The composition of the 80-kDa protein allows for the catalysis of several processes of peroxisomal beta-oxidation of fatty acids by a single macromolecule instead of a participation of several enzymes(21, 38, 39, 43) . Such a concerted action might further be essential in the metabolism of sterols and steroids.

The porcine 17beta-hydroxysteroid dehydrogenase IV is the first peroxisomal enzyme known to be stimulated by progesterone(40) . The hormone is as well responsible for the regulation of other types of 17beta-HSD(44, 45) . The recently purified and cloned rat 80-kDa homologue responds as well to peroxisomal proliferators such as clofibrate and WY 14,643(39, 46) . The 80-kDa protein seems to be controlled by modulators of steroid and fatty acid metabolism. The high level of conservation of amino acid sequence (85% identity) between human, mouse, rat, and porcine 80-kDa proteins suggests an essential function of this type of protein.


FOOTNOTES

*
This work was supported by Institut für Arterioskleroseforschung Grant DFG S.E. 459/2-2. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
Present address: Unité d'Oncologie Moléculaire, CNRS URA 1160, 1 rue Calmette, Institut Pasteur de Lille, 59019 Lille, France.

To whom correspondence should be addressed: Max-Planck-Institut für experimentelle Endokrinologie, Postfach 610309, 30603 Hannover, Germany. Tel.: 49-511-5359-0; Fax: 49-511-5359-203; 100410.3454{at}compuserve.com.

(^1)
The abbreviations used are: 17beta-HSD, 17beta-hydroxysteroid dehydrogenase; aa, amino acid(s); 7-DHC, 7-dehydrocholesterol; GST, glutathione S-transferase; HEK 293, human embryonal kidney cell line 293; PC, phosphatidylcholine; SCAD, short chain alcohol dehydrogenase; SCP2, sterol carrier protein 2; SCPx, sterol carrier protein x; PAGE, polyacrylamide gel electrophoresis.

(^2)
M. Dieuaide, D. K. Novikov, G. P. Mannaerts, and P. P. Van Veldhoven, personal communication.


ACKNOWLEDGEMENTS

We are grateful to Prof. Dr. P. W. Jungblut for discussions and support during the course of this work. We thank Dr. H. Thole for amino acid sequencing of recombinant proteins and Dr. B. Schoeman, Max Planck Institute for Cell Biology, Ladenburg, for the synthesis of oligonucleotides. We thank Niels Krebsfänger, Hendrik Knötgen, and Alexandra Koch for excellent technical assistance.


REFERENCES

  1. Williamson, D. G. (1979) in Steroid Biochemistry (Hobkirk, R., ed) Vol. I, pp. 83-111, CRC Press, Inc., Boca Raton, FL
  2. Reed, M. J. (1991) J. Endocr. 129, 163-165 [Abstract/Free Full Text]
  3. Andersson, S. (1995) J. Endocr. 146, 197-200 [Abstract/Free Full Text]
  4. Engel, L. L., and Groman, E. V. (1974) Recent Prog. Horm. Res. 30, 139-169
  5. Peltoketo, H., Isomaa, V., Mäentausta, O., and Vihko, R. (1988) FEBS Lett. 239, 73-77 [CrossRef][Medline] [Order article via Infotrieve]
  6. Luu-The, V., Labrie, C., Zhao, H. F., Couët, J., Lachance, Y., Simard, J., Leblanc, G., Côté, J., Bérubé, D., Gagné, R., and Labrie, F. (1989) Mol. Endocrinol. 3, 1301-1309 [Abstract/Free Full Text]
  7. Casey, M. L., MacDonald, P. C., and Andersson, S. (1994) J. Clin. Invest. 94, 2135-2141
  8. Wu, L., Einstein, M., Geissler, W. M., Chan, H. K., Elliston, K. O., and Andersson, S. (1993) J. Biol. Chem. 268, 12964-12969 [Abstract/Free Full Text]
  9. Geissler, W. M., Davis, D. L., Wu, L., Bradshaw, K., Patel, S., Mendonca, B. B., Elliston, K. O., Wilson, J. D., Russell, D. W., and Andersson, S. (1994) Nature Genet. 7, 34-39 [CrossRef][Medline] [Order article via Infotrieve]
  10. Adamski, J., Husen, B., Marks, F., and Jungblut, P. W. (1992) Biochem. J. 288, 375-381
  11. Adamski, J., Sierralta, W. D., and Jungblut, P. W. (1989) Acta Endocr. 121, 161-167
  12. Markus, M., Husen, B., Leenders, F., Jungblut, P. W., Hall, P. F., and Adamski, J. (1995) Eur. J. Cell Biol. 68, 263-267 [Medline] [Order article via Infotrieve]
  13. Leenders, F., Adamski, J., Husen, B., Thole, H. H., and Jungblut, P. W. (1994) Eur. J. Biochem. 222, 221-227 [Medline] [Order article via Infotrieve]
  14. Adamski, J., Husen, B., Thole, H. H., Groeschel-Stewart, U., and Jungblut, P. W. (1993) Biochem. J. 296, 797-802
  15. Adamski, J., Normand, T., Leenders, F., Monte, D., Begue, A., Stehelin, D., Jungblut, P. W., and de Launoit, Y. (1995) Biochem. J. 311, 437-443
  16. Normand, T., Husen, B., Leenders, F., Pelczar, H., Baert, J.-L., Begue, A., Flourens, A.-C., Adamski, J., and de Launoit, Y. (1995) J. Ster. Biochem. Mol. Biol. 55, 541-548 [CrossRef][Medline] [Order article via Infotrieve]
  17. Leenders, F., Husen, B., Thole, H. H., and Adamski, J. (1994) Mol. Cell. Endocrinol. 104, 127-131 [CrossRef][Medline] [Order article via Infotrieve]
  18. Persson, B., Krook, M., and Jörnvall, H. (1991) Eur. J. Biochem. 200, 537-543 [Medline] [Order article via Infotrieve]
  19. Krozowski, Z. (1994) J. Steriod Biochem. Mol. Biol. 51, 125-130 [CrossRef][Medline] [Order article via Infotrieve]
  20. Jörnvall, H., Persson, B., Krook, M., Atrian, S., Gonzalez-Duarte, R., Jeffery, J., and Ghosh, D. (1995) Biochemistry 34, 6003-6013 [CrossRef][Medline] [Order article via Infotrieve]
  21. Hiltunen, J. K., Wenzel, B., Beyer, A., Erdmann, R., Fosså, A., and Kunau, W.-H. (1992) J. Biol. Chem. 267, 6646-6653 [Abstract/Free Full Text]
  22. Nuttley, W. M., Aitchison, J. D., and Rachubinski, R. A. (1988) Gene (Amst.) 69, 171-180
  23. Billheimer, J. T., Strehl, L. L., Davis, G. L., Strauss, J. F., and Davis, L. G. (1990) DNA Cell Biol. 9, 159-165 [Medline] [Order article via Infotrieve]
  24. Seedorf, U., and Assmann, G. (1991) J. Biol. Chem. 266, 630-636 [Abstract/Free Full Text]
  25. Seedorf, U., Scheek, S., Engel, T., Steif, C., Hinz, H. J., and Assmann, G. (1994) J. Biol. Chem. 269, 2613-2618 [Abstract/Free Full Text]
  26. Pfeifer, S. M., Furth, E. E., Ohba, T., Chang, Y. J., Rennert, H., Sakuragi, N., Billheimer, J. T., and Strauss, J. F. (1993) J. Steriod Biochem. Mol. Biol. 47, 167-172 [CrossRef][Medline] [Order article via Infotrieve]
  27. Chanderbhan, R., Tanaka, T., Strauss, J. F., Irwin, D., Noland, B. J., Scallen, T. J., and Vahouny, G. V. (1983) Biochem. Biophys. Res. Commun. 117, 702-709 [CrossRef][Medline] [Order article via Infotrieve]
  28. Pfeifer, S. M., Sakuragi, N., Ryan, A., Johnson, A. L., Deeley, R. G., Billheimer, J. T., Baker, M. E., and Strauss, J. F. (1993) Arch. Biochem. Biophys. 304, 287-293 [CrossRef][Medline] [Order article via Infotrieve]
  29. Seedorf, U., Brysch, P., Engel, T., Schrage, K., and Assmann, G. (1994) J. Biol. Chem. 269, 21277-21283 [Abstract/Free Full Text]
  30. Seedorf, U., Raabe, M., and Assmann, G. (1993) Gene (Amst.) 123, 165-172
  31. Ohba, T., Rennert, H., Pfeifer, S. M., He, Z., Yamamoto, R., Holt, J. A., Billheimer, J. T., and Strauss, J. F., III (1994) Genomics 24, 370-374 [CrossRef][Medline] [Order article via Infotrieve]
  32. Ohba, T., Holt, J. A., Billheimer, J. T., and Strauss, J. F., III (1995) Biochemistry 34, 10660-10668 [CrossRef][Medline] [Order article via Infotrieve]
  33. Wigler, M., Silverstein, S., Lee, L. S., Pellicer, A., Cheng, V. C., and Axel, R. (1977) Cell 11, 223-232 [CrossRef][Medline] [Order article via Infotrieve]
  34. Steinman, H. M., and Hill, R. L. (1975) Methods Enzymol. 35, 136-139 [Medline] [Order article via Infotrieve]
  35. Baker, M. E. (1996) Bioessays 18, 63-70 [CrossRef][Medline] [Order article via Infotrieve]
  36. Baker, M. E. (1990) FASEB J. 4, 3028-3032 [Abstract]
  37. Adamski, J., Carstensen, J., Husen, B., Kaufmann, M., de Launoit, Y., Leenders, F., and Jungblut, P. W. (1996) Ann. N. Y. Acad. Sci. U. S. A. , in press
  38. Palosaari, P. M., and Hiltunen, J. K. (1990) J. Biol. Chem. 265, 2446-2449 [Abstract/Free Full Text]
  39. Novikov, D. K., Vanhove, G., Carchon, H., Asselberghs, S., Eyssen, H. J., Van Veldhoven, P. P., and Mannaerts, G. P. (1994) J. Biol. Chem. 269, 27125-27135 [Abstract/Free Full Text]
  40. Kaufmann, M., Carstensen, J., Husen, B., and Adamski, J. (1995) J. Steriod Biochem. Mol. Biol. 55, 535-539 [CrossRef][Medline] [Order article via Infotrieve]
  41. Billheimer, J. T., and Gaylor, J. L. (1990) Biochim. Biophys. Acta 1046, 136-143 [Medline] [Order article via Infotrieve]
  42. Noland, B. J., Arebalo, R. E., Hansbury, E., and Scallen, T. J. (1980) J. Biol. Chem. 255, 4282-4289 [Free Full Text]
  43. Palosaari, P. M., Vihinen, M., Mäntsälä, P. I., Alexson, S. E. H., Pihlajaniemi, T., and Hiltunen, J. K. (1991) J. Biol. Chem. 266, 10750-10753 [Abstract/Free Full Text]
  44. Tseng, L., and Gurpide, E. (1975) Endocrinology 97, 825-833 [Abstract/Free Full Text]
  45. Tseng, L., and Gurpide, E. (1979) Endocrinology 104, 1745-1750 [Abstract/Free Full Text]
  46. Corton, J. C., Bocos, C., Cattley, R. C., and Gustafsson, J.-A. (1995) in Peroxisomes: Biology and Role in Toxicology and Disease , Abstr. 80, The Aspen Institute, Aspen, CO

©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
J. Edqvist, E. Ronnberg, S. Rosenquist, K. Blomqvist, L. Viitanen, T. A. Salminen, M. Nylund, J. Tuuf, and P. Mattjus
Plants Express a Lipid Transfer Protein with High Similarity to Mammalian Sterol Carrier Protein-2
J. Biol. Chem., December 17, 2004; 279(51): 53544 - 53553.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. A. Brown, D. Boerboom, N. Bouchard, M. Dore, J. G. Lussier, and J. Sirois
Human Chorionic Gonadotropin-Dependent Regulation of 17{beta}-Hydroxysteroid Dehydrogenase Type 4 in Preovulatory Follicles and Its Potential Role in Follicular Luteinization
Endocrinology, April 1, 2004; 145(4): 1906 - 1915.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Z. Marijanovic, D. Laubner, G. Moller, C. Gege, B. Husen, J. Adamski, and R. Breitling
Closing the Gap: Identification of Human 3-Ketosteroid Reductase, the Last Unknown Enzyme of Mammalian Cholesterol Biosynthesis
Mol. Endocrinol., September 1, 2003; 17(9): 1715 - 1725.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. G. Erben, D. W. Soegiarto, K. Weber, U. Zeitz, M. Lieberherr, R. Gniadecki, G. Moller, J. Adamski, and R. Balling
Deletion of Deoxyribonucleic Acid Binding Domain of the Vitamin D Receptor Abrogates Genomic and Nongenomic Functions of Vitamin D
Mol. Endocrinol., July 1, 2002; 16(7): 1524 - 1537.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-M. Qin, A. M. Haapalainen, S. H. Kilpelainen, M. S. Marttila, M. K. Koski, T. Glumoff, D. K. Novikov, and J. K. Hiltunen
Human Peroxisomal Multifunctional Enzyme Type 2. SITE-DIRECTED MUTAGENESIS STUDIES SHOW THE IMPORTANCE OF TWO PROTIC RESIDUES FOR 2-ENOYL-CoA HYDRATASE 2 ACTIVITY
J. Biol. Chem., February 18, 2000; 275(7): 4965 - 4972.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-M. Qin, M. S. Marttila, A. M. Haapalainen, K. M. Siivari, T. Glumoff, and J. K. Hiltunen
Yeast Peroxisomal Multifunctional Enzyme: (3R)-Hydroxyacyl-CoA Dehydrogenase Domains A and B Are Required for Optimal Growth on Oleic Acid
J. Biol. Chem., October 1, 1999; 274(40): 28619 - 28625.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. A. English, K. F. Kane, N. Cruickshank, M. J. S. Langman, P. M. Stewart, and M. Hewison
Loss of Estrogen Inactivation in Colonic Cancer
J. Clin. Endocrinol. Metab., June 1, 1999; 84(6): 2080 - 2085.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
X.-Y. He, G. Merz, P. Mehta, H. Schulz, and S.-Y. Yang
Human Brain Short Chain L-3-Hydroxyacyl Coenzyme A Dehydrogenase Is a Single-domain Multifunctional Enzyme. CHARACTERIZATION OF A NOVEL 17beta -HYDROXYSTEROID DEHYDROGENASE
J. Biol. Chem., May 21, 1999; 274(21): 15014 - 15019.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Fomitcheva, M. E. Baker, E. Anderson, G. Y. Lee, and N. Aziz
Characterization of Ke 6, a New 17beta -Hydroxysteroid Dehydrogenase, and Its Expression in Gonadal Tissues
J. Biol. Chem., August 28, 1998; 273(35): 22664 - 22671.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
U. Seedorf, M. Raabe, P. Ellinghaus, F. Kannenberg, M. Fobker, T. Engel, S. Denis, F. Wouters, K. W.A. Wirtz, R. J.A. Wanders, et al.
Defective peroxisomal catabolism of branched fatty acyl coenzyme A in mice lacking the sterol carrier protein-2/sterol carrier protein-x gene function
Genes & Dev., April 15, 1998; 12(8): 1189 - 1201.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. G. van Grunsven, E. van Berkel, L. Ijlst, P. Vreken, J. B. C. de Klerk, J. Adamski, H. Lemonde, P. T. Clayton, D. A. Cuebas, and R. J. A. Wanders
Peroxisomal D-hydroxyacyl-CoA dehydrogenase deficiency: Resolution of the enzyme defect and its molecular basis in bifunctional protein deficiency
PNAS, March 3, 1998; 95(5): 2128 - 2133.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. A. M. Castagnetta, G. Carruba, A. Traina, O. M. Granata, M. Markus, M. Pavone-Macaluso, C. H. Blomquist, and J. Adamski
Expression of Different 17{beta}-Hydroxysteroid Dehydrogenase Types and Their Activities in Human Prostate Cancer Cells
Endocrinology, November 1, 1997; 138(11): 4876 - 4882.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. D. Antonenkov, P. P. Van Veldhoven, E. Waelkens, and G. P. Mannaerts
Substrate Specificities of 3-Oxoacyl-CoA Thiolase A and Sterol Carrier Protein 2/3-Oxoacyl-CoA Thiolase Purified from Normal Rat Liver Peroxisomes. STEROL CARRIER PROTEIN 2/3-OXOACYL-CoA THIOLASE IS INVOLVED IN THE METABOLISM OF 2-METHYL-BRANCHED FATTY ACIDS AND BILE ACID INTERMEDIATES
J. Biol. Chem., October 10, 1997; 272(41): 26023 - 26031.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
T. M. Penning
Molecular Endocrinology of Hydroxysteroid Dehydrogenases
Endocr. Rev., June 1, 1997; 18(3): 281 - 305.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leenders, F.
Right arrow Articles by Adamski, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leenders, F.
Right arrow Articles by Adamski, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1996 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement