JBC Anatrace, Inc.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Benna, J. E.
Right arrow Articles by Babior, B. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Benna, J. E.
Right arrow Articles by Babior, B. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 271, Number 11, Issue of March 15, 1996 pp. 6374-6378
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
Phosphorylation of the Respiratory Burst Oxidase Subunit p47 as Determined by Two-dimensional Phosphopeptide Mapping
PHOSPHORYLATION BY PROTEIN KINASE C, PROTEIN KINASE A, AND A MITOGEN-ACTIVATED PROTEIN KINASE (*)

(Received for publication, November 6, 1995; and in revised form, December 27, 1995)

Jamel El Benna (1)(§) La Rosa P. Faust Jennifer L. Johnson Bernard M. Babior (¶)

From the Department of Molecular and Experimental Medicine, The Scripps Research Institute, La Jolla, California 92037 and INSERM-U294, CHU X. Bichat, 75018 Paris, France

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES

ABSTRACT

The respiratory burst oxidase is responsible for superoxide (O(2)) production by phagocytes and B lymphocytes. This multicomponent enzyme is dormant in resting cells but is activated on exposure of the cells to an appropriate stimulus. Upon activation, several serine residues on the cytosolic oxidase subunit p47 become phosphorylated. Using two-dimensional tryptic phosphopeptide mapping, we studied the phosphorylation of p47 in P(i)-loaded Epstein-Barr virus-transformed B lymphoblasts expressing wild type p47or any of several p47 Ser Ala mutants. We were able to identify the labeled peptides from wild type p47 as those containing Ser, Ser, Ser, Ser and/or Ser, and Ser; no P-labeled Ser-containing peptide was found. When purified p47 was phosphorylated in vitro by various protein kinases, varying phosphopeptide patterns were observed. Protein kinase C phosphorylated all the peptides except the one containing Ser; protein kinase A phosphorylated the peptide containing Ser and one or both of the peptides containing Ser and Ser; while mitogen-activated protein kinase phophorylated only the peptide containing Ser. These findings suggest that these three kinases play distinct roles in the activation of the respiratory burst oxidase, each of them catalyzing the phosphorylation of a different group of serines in p47.


INTRODUCTION

The respiratory burst oxidase of phagocytes and B lymphocytes catalyzes the reduction of oxygen to superoxide (O(2)) at the expense of NADPH(1, 2, 3, 4, 5, 6) . In resting cells the enzyme is inactive, and its components are distributed between the cytosol and the membranes of secretory vesicles. When the cells are activated, the cytosolic components migrate to the membranes, where they associate with the membrane-bound components to assemble the catalytically active oxidase (1, 5, 7) .

When the oxidase is activated, p47, one of the cytosolic subunits, becomes phosphorylated on several serines(8, 9) . We recently found that in human neutrophils serines Ser, Ser, Ser, Ser, Ser, Ser, and Ser and/or Ser are phosphorylated and that other serines lying between Ser and Ser could be phosphorylated(10) . We further showed that at least one of these serines is absolutely required for oxidase activation in whole cells stimulated with PMA(11) . In this study, we report the use of site-directed mutagenesis combined with two-dimensional phosphopeptide mapping to further characterize the phosphorylation of p47in B lymphocytes and to compare the in vitro phosphorylation of purified p47 by various serine/threonine-specific protein kinases.


EXPERIMENTAL PROCEDURES

Reagents

Phorbol 12-myristate 13-acetate, leupeptin, pepstatin, aprotinin, phosphatidylserine, diacylglycerol, and protein kinase A (catalytic subunit) were purchased from Sigma. Protein kinase C was obtained from Calbiochem. MAP (^1)kinase was obtained from Santa Cruz Biotechnology, and DNase I and sequencing grade trypsin and Glu-C endopeptidase from Boehringer Mannheim. P(i) (8500-9120 Ci/mmol) and [-P]ATP (3000 Ci/mmol) were purchased from DuPont NEN.

Site-directed Mutagenesis and Transfections

Most of the mutants used for these experiments have been previously reported(11) . S303A,S304A was constructed by cloning the WT p47 cDNA template into the XbaI/NotI fragment of pBluescript KSII, then mutating by an oligonucleotide-directed technique using the oligonucleotide CGGATGGCCGCGCGCCGGGGCGGCGC (deviations from the WT sequence are shown in boldface)(11) . The elimination of a BssHII site in the mutant was used for screening. S328A-S359A was constructed by the sequential introduction of the single mutations S348A, S345A, S359A, and S328A into the WT clone using templates reported elsewhere(11) . S370A,S379A was similarly created by the sequential introduction of the mutations S379A and S370A into the WT clone. S328A-S379A was then constructed by replacing the NaeI/NarI fragment of S370A,S379A with the NaeI/NarI fragment of S328A-S359A. In every case, the mutations were confirmed by dideoxynucleotide-based sequencing(11) . The wild type or mutant cDNAs were then excised from Bluescript, cloned into the XbaI/NotI sites of the mammalian expression vector EBOpLPP and transfected into p47-deficient EBV-transformed B lymphocytes as described elsewhere(12) .

P Labeling of Transfected Cells and p47 Purification

Transfected B lymphoblasts were labeled with P(i) as described previously(11) . Briefly, the cells were incubated overnight in phosphate-free medium, then transferred to fresh medium containing P(i) (0.2 mCi/ml) and incubated for 4 h at 37 °C. The cells were then activated for 12.5 min with PMA (1 µg/ml/10^8 cells), after which their p47 was isolated and purified by immunoaffinity chromatography as described before(10) .

In Vitro Phosphorylation of p47

p47 was isolated by immunoprecipitation from resting neutrophils exactly as described elsewhere(10, 16) . Labeling with protein kinase A was performed by incubating a reaction mixture containing 1 µg of p47, 50 µM (1 µCi) [-P]ATP, and 0.5 µg of protein kinase A (catalytic subunit) in 50 µl of a buffer containing 40 mM HEPES (pH 7.3), 1 mM dithiothreitol, 20 mM MgCl(2), 2 mM EGTA, 0.5 mM NaF, and 0.2 mM beta-glycerophosphate for 30 min at 37 °C. For the protein kinase C reaction, 1 µg of immunopurified p47 was incubated with 0.5 µg of protein kinase C in 20 mM Tris-Cl (pH 7.5), 10 mM MgCl(2), 0.5 mM CaCl(2), 1 mM dithiothreitol, 50 µM (1 µCi) [-P]ATP, 5 µg/ml diolein, and 50 µg/ml phosphatidylserine in a total volume of 50 µl. The reaction was carried out for 30 min at 30 °C. Phosphorylation by MAP kinase was accomplished by incubating 1 µg of p47 with 0.5 µg of MAP kinase (p42-ERK2) and 50 µM (1 µCi) [-P]ATP under the conditions used for the protein kinase A reaction.

SDS-PAGE and Tryptic Phosphopeptide Analysis

Immunoprecipitated or recombinant P-labeled p47 was analyzed by 10% SDS-PAGE and blotted to nitrocellulose using the Laemmli (13) and Towbin et al. (14) systems, respectively. Labeled p47 was detected on the immunoblot by a specific anti-peptide antibody (15) and by autoradiography for 1 to 2 h. The band corresponding to p47 was digested with trypsin, and the resulting peptides were separated by high voltage electrophoresis and chromatography on a cellulose thin layer plate as described elsewhere(10, 17) . Phosphopeptides were detected by exposing the thin layer plates to Reflexion film (DuPont NEN) for 24-72 h at -70 °C with an intensifying screen. For the peptide-containing serines 359 and 370, phosphorylation was analyzed by digesting the blotted p47 with Glu-C, separating the resulting peptides by Tris-Tricine SDS-PAGE and subjecting the resulting gel to autoradiography. Phosphorylated peptide 359/370 appears as a radioactive band at approx4 kDa. Each autoradiogram is representative of two or three separate experiments, each carried out with a different transfection.


RESULTS

Identification of Phosphopeptides on the Tryptic Peptide Map of Phosphorylated p47, Including a Phosphopeptide Containing Ser

During the activation of the respiratory burst oxidase in phagocytes and B lymphocytes, p47 becomes extensively phosphorylated. Using CNBr cleavage followed by proteolysis, Tricine gel electrophoresis, and Edman degradation, we showed that the targets of phosphorylation in p47 are the serine residues lying between Ser and Ser inclusively, and that among these serines the following are phosphorylated: Ser, Ser, Ser, Ser, Ser, Ser, Ser and/or Ser, and Ser(10, 11) , the last phosphorylated much less extensively than the rest. The methods employed in that study were elaborate and time-consuming, however, and presented certain limitations: in qualitative analysis because manual Edman degradation is only reliable through the first 10-15 cycles (18) and in quantitative analysis because of unequal losses of phosphorylated peptides during the workup of the samples. A simpler and more quantifiable method would be the analysis of phosphorylation by two-dimensional tryptic peptide mapping(17) . We therefore carried out experiments to identify the phosphopeptides on the tryptic peptide map of P-labeled p47.

Our approach was to express p47 Ser Ala mutants in EBV-transformed p47-deficient B lymphocytes; to load these lymphocytes with P(i) and then activate them with PMA to label their p47; and finally to purify the labeled p47 mutants, map them, and look for differences between those maps and the map of P-labeled WT p47. In a tryptic digest of p47, the phosphorylation targets are distributed among several peptides (Table 1; trypsin is unable to split Lys-Pro and Arg-Pro bonds)(17) . Of these, the peptide containing Ser and Ser would probably be difficult to see because it would contain very little P relative to the other peptides(10, 11) . The results (Fig. 1, left) showed that the map of WT p47 contained six major phosphopeptides (arrows), all of which were seen in each of 15 separate experiments, together with several minor phosphopeptides whose presence in the maps was inconstant. Taking into consideration the serines known to be phosphorylated during oxidase activation (10) and the peptides generated by tryptic digestion of p47 (Table 1), we made a number of mutants in which two or more serines had been converted to alanines, and used these together with mutants containing a single Ser Ala change to identify the labeled peptides on the two-dimensional map.




Figure 1: Phosphopeptide maps of p47isolated from PMA-activated p47-deficient B lymphocytes expressing WT and mutant forms of p47. Labeling and activation of EBV-transformed p47-deficient B lymphoblasts expressing WT and mutant p47, isolation and purification of the labeled p47, and phosphopeptide mapping were carried out as described under ``Experimental Procedures.'' The mutations are indicated in a corner of each panel; 47S = WT. The point of application of the sample is indicated by the dot in the lower left corner of each panel. Missing peptides are outlined with dotted lines. Left, mutations that produce a change in the phosphopeptide map. Arrows show the major phosphorylated peptides. Right, mutations that have no effect on the phosphopeptide map.



Restricting our analysis to the six constant phosphopeptides (Fig. 1), we found that maps of p47 mutants containing single Ser Ala mutations were the same as WT maps (Fig. 1, left) except for the map of S320A, which lacked a single spot, and the map of S315A, which lacked two spots (Fig. 1, left). The latter result suggests that at least two peptides were produced, probably because of partial cleavage at the sequence RKR (residues 316-318). Sequences containing basic residues in tandem are known to be susceptible to partial cleavage(17) .

Certain of the peptides of interest contain two serines, and it may be that the elimination of both serines is necessary to eliminate a spot corresponding to such a peptide. In accord with this idea, a single spot was eliminated from the phosphopeptide maps of S303A,S304A and S345A,S348A (Fig. 1, left). The map of the sextuple mutant S328A-S379A lacked two spots: one known to correspond to the peptide Ser, and another that by elimination has to represent the two peptides Ser and Ser, because the spots corresponding to the remaining phosphopeptides (i.e. Ser, Ser, and Ser) were present on the map. (^2)It appears that the phosphorylated peptides Ser and Ser coincide on the tryptic peptide map. Finally, these results suggest that Ser is not phosphorylated during oxidase activation.

A diagram of the tryptic peptide map of WT p47 giving the identities of the major peptides is shown in Fig. 2. This diagram also shows the location of P(i), which proved to be a useful marker for identifying peptides on maps with missing spots. P(i) lies at a level between peptides Ser and Ser, and migrates toward the anode, while the phosphopeptides all migrate toward the cathode. The location of the P(i) spot relative to the point of application of the sample (marked by a plus sign (+) in the lower left corner of the figure) provides a mobility standard that allows the identification of individual peptides even in the absence of information concerning the overall distribution of spots on the chromatogram, as would occur under conditions in which only one or two peptides are phosphorylated.


Figure 2: A diagram of the phosphopeptide map of p47 showing the locations and identities of the major peptides. The major phosphopeptides (filled areas) are identified by the target serines they contain. The location of the 32P(i) spot is also shown. Open areas represent inconstant phosphopeptides on the autoradiogram from which this figure was derived. The plus sign (+) indicates the point of application of the sample. On the electrophoresis axis, the cathode is on the right. TLC, thin layer chromatography.



Comparison of Phosphopeptides in p47 Isolated from Activated Neutrophils and EBV-transformed B Cells

Using tryptic phosphopeptide mapping, we compared the sites of phosphorylation of p47 from activated human neutrophils and EBV-transformed normal B lymphocytes. The results (Fig. 3) showed that the same six major phosphopeptides appeared in both maps. These findings suggest that the p47 phosphopeptide assignments made through the experiments described above are valid for neutrophils as well as B lymphocytes, and that this method can therefore be employed to study the phosphorylation of p47 during the activation of neutrophils and probably other phagocytes as well.


Figure 3: Phosphopeptide maps of p47isolated from activated neutrophils and B cells. Labeling and activation of EBV-transformed p47-deficient B lymphoblasts expressing WT p47 and of human neutrophils, isolation and purification of the labeled p47 and phosphopeptide mapping were carried out as described under ``Experimental Procedures.'' The point of application of the sample is indicated by the dot in the lower left corner of each panel.



Phosphorylation of Purified p47 by Various Protein Kinases

We employed tryptic phosphopeptide mapping to identify the sites phosphorylated by various kinases thought to be involved in the regulation of O(2) production by the respiratory burst oxidase. For this purpose, p47 immunopurified from resting neutrophils was incubated with [-P]ATP together with the kinase of interest (protein kinase A, protein kinase C, or MAP kinase), then repurified and analyzed either by CNBr cleavage followed by Tris-Tricine SDS-PAGE (19) or by tryptic peptide mapping. As shown previously with p47 that had been phosphorylated in intact cells(10) , the sites phosphorylated in vitro by all three kinases were located in the C-terminal CNBr peptide of the labeled p47 (Fig. 4). Peptide mapping showed that protein kinase C phosphorylated all the p47 peptides except the peptide corresponding to Ser (Fig. 5, top), while protein kinase A, a more selective kinase, phosphorylated only the Ser peptide and the Ser and/or the Ser peptides (Fig. 5, middle). When p47 phosphorylated by protein kinase C or protein kinase A was cleaved by Glu-C endopeptidase and then analyzed by SDS-PAGE, a labeled fragment appeared at 4 kDa (Fig. 6), indicating that the peptide containing Ser was phosphorylated. The status of Ser remained unresolved, although its phosphorylation in PMA-activated neutrophils suggests that it was probably phosphorylated at least by protein kinase C. MAP kinase, used here as an example of a proline-directed kinase, phosphorylated only the Ser peptide, as expected from the sequences around the target serines in p47 (Fig. 5, bottom). Taken together, these results suggest that the three kinases could play different roles in regulating the activity of the respiratory burst oxidase.


Figure 4: Phosphopeptides produced by CNBr cleavage of p47 purified by immunoprecipitation from human neutrophils phosphorylated with protein kinase C, protein kinase A, or MAP kinase. The experiment was carried out as described under ``Experimental Procedures'' using p47 purified from human neutrophils. The arrow shows the location of the C-terminal CNBr fragment of p47.




Figure 5: Phosphopeptide maps of p47phosphorylated with protein kinase C (top), protein kinase A (middle), and MAP kinase (bottom). The experiment was carried out as described under ``Experimental Procedures'' using p47 purified from human neutrophils. The point of application of the sample is indicated by the dot in the lower left corner of each panel.




Figure 6: Phosphorylation of phosphopeptide 359/370 by protein kinase C and protein kinase A. The experiment was carried out as described under ``Experimental Procedures.'' A labeled band at approx4 kDa is seen in both tracks.



On the phosphopeptide maps of purified p47 that had been labeled with a known kinase, major spots were seen that were not present on the maps of p47 labeled in whole cells. These spots were disregarded as irrelevant to the physiological labeling pattern of activated p47.


DISCUSSION

Tryptic peptide mapping of p47 labeled with P either in intact cells or in a cell-free system provides an efficient way of identifying which of the target peptides are phosphorylated, and in combination with image analysis of radioactivity could yield important information on the relative quantities of phosphate on various of the serines of the protein. The results obtained by tryptic peptide mapping retain a certain amount of ambiguity, however, because they provide no information as to which of the two serines on a two-serine peptide is (are) phosphorylated. Whether it is important to answer that question will depend on studies correlating structure and function in Ser Ala mutants of p47, although a partial answer is provided by our recent report showing that Ser Ala mutations of individual serines from position 303 to 370 have little effect on oxidase activity(11) .

The present results provide some information as to the order of phosphorylation of the target serines on p47. Except for the mutant S315A, whose anomalous properties were discussed above, mutations affecting the serines on a single tryptic peptide caused the loss of at most one spot on the phosphopeptide map. This finding suggests that there is no target serine whose phosphorylation is absolutely dependent on the phosphorylation of a serine on a different peptide, or the phosphorylation of a group of such serines. Rather, it appears that these serines can be phosphorylated in any order.

We previously showed that when the respiratory burst oxidase is activated, serines Ser, Ser, Ser, Ser, Ser, Ser, Ser and/or Ser, and Ser of p47 are phosphorylated(10, 11) . The present studies confirm the earlier results by another method, and in addition have shown that Ser is also phosphorylated, bringing the total number of phosphorylated serines in the C-terminal region of activated p47 to 9 or 10. Ser has already been found to play an important role in oxidase activation and p47 translocation, and it is likely that protein kinase-mediated phosphorylation of other target serines is equally important. In fact, several lines of evidence already support a role for protein kinase C in oxidase activation. For example, PMA, an activator of several forms of protein kinase C, is a powerful stimulator of O(2) production in whole cells(20) . Purified p47 is a good substrate for protein kinase C in vitro(21) , while staurosporine, a potent inhibitor of protein kinase C (and other kinases), blocks PMA-induced O(2) generation as well as the phosphorylation of p47(22, 23) . Finally, we show in this study that the phosphopeptide map of p47 isolated from PMA-activated neutrophils and EBV-transformed B lymphocytes is identical to the phosphopeptide map of p47 phosphorylated in vitro by protein kinase C, except for the absence of the Ser peptide from the latter map. These findings suggest that one or more of the PMA-responsive forms of protein kinase C could be a critical mediator of oxidase activation. We showed recently that Ser and Ser are not required for oxidase activation(11) , since the S345A,S348A mutant of p47 is fully active in EBV-transformed B cells. This finding suggests that, in contrast to protein kinase C, phosphorylation of p47 by proline-directed kinases such as MAP kinase may have little to do with oxidase activation. The role of target serines in the regulation of oxidase activity is currently under investigation in our laboratory.

Phosphorylation of p47 was also shown to occur upon addition of dibutyryl cAMP to neutrophil cytoplasts or cytosol, suggesting that p47 is also a substrate for protein kinase A(24) . Dibutyryl cAMP did not induce O(2) production, however, indicating that phosphorylation by protein kinase A alone is not sufficient to activate the oxidase. It is possible, in fact, that the the phosphorylation of p47 by protein kinase A prevents the assembly of the oxidase, since the elevation of neutrophil cAMP inhibits O(2) production(25) . Our results show that protein kinase A phosphorylates fewer target serines than protein kinase C, phosphorylating only peptides Ser, Ser, and possibly Ser (a maximum of four target serines), in contrast to the five peptides (up to seven target serines) phosphorylated by protein kinase C. The protein kinase A targets could be responsible for the negative regulation of p47 phosphorylation and oxidase activation by protein kinase A.


FOOTNOTES

*
This work was supported in part by United States Public Health Service Grants AI-24227, AI-28479, and RR-00833 and by the Stein Endowment Fund. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
A Chargé de Recherche-1-CNRS and recipient of a postdoctoral fellowship from the Arthritis Foundation.

To whom correspondence should be addressed: Dept. of Molecular and Experimental Medicine, The Scripps Research Institute, 10666 N. Torrey Pines Rd., La Jolla, CA 92037. Tel.: 619-784-7937; Fax: 619-784-7981.

(^1)
The abbreviations used are: MAP kinase, mitogen activated protein kinase; PMA, phorbol 12-myristate 13-acetate; WT, wild type; EBV, Epstein-Barr virus; PAGE, polyacrylamide gel electrophoresis; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine.

(^2)
There is too little P in Ser to produce a spot on the autoradiogram under the conditions used for these experiments(11) .


REFERENCES

  1. Chanock, S. J., El Benna, J., Smith, R. M., and Babior, B. M. (1994) J. Biol. Chem. 269, 24519-24522 [Free Full Text]
  2. Uhlinger, D. J., Tyagi, S. R., Inge, K. L., and Lambeth, J. D. (1993) J. Biol. Chem. 268, 8624-8631 [Abstract/Free Full Text]
  3. Segal, A. W. (1988) in Hematology/Oncology Clinics of North America. Phagocytic Defects II , Vol. 2 (Curnutte, J. T., ed) pp. 213-223, W. B. Saunders, Philadelphia
  4. Malech, H. L., and Gallin, J. I. (1987) N. Engl. J. Med. 317, 687-694 [Medline] [Order article via Infotrieve]
  5. Lomax, K. J., Malech, H. L., and Gallin, J. I. (1989) Blood Rev. 3, 94-104 [CrossRef][Medline] [Order article via Infotrieve]
  6. Maly, F.-E., Nakamura, M., Gauchat, J.-F., Urwyler, A., Walker, C., Dahinden, C. A., Cross, A. R., Jones, O. T. G., and de Weck, A. L. (1989) J. Immunol. 142, 1260-1267 [Abstract]
  7. Nauseef, W. M. (1993) Eur. J. Haematol. 51, 301-308 [Medline] [Order article via Infotrieve]
  8. Hayakawa, T., Suzuki, K., Suzuki, S., Andrews, P. C., and Babior, B. M. (1986) J. Biol. Chem. 261, 9109-9115 [Abstract/Free Full Text]
  9. Okamura, N., Curnutte, J. T., Roberts, R. L., and Babior, B. M. (1988) J. Biol. Chem. 263, 6777-6782 [Abstract/Free Full Text]
  10. El Benna, J., Faust, L. P., and Babior, B. M. (1994) J. Biol. Chem. 269, 23431-23436 [Abstract/Free Full Text]
  11. Faust, L. P., El Benna, J., Babior, B. M., and Chanock, S. J. (1995) J. Clin. Invest. 96, 1499-1505
  12. Chanock, S. J., Faust, L. P., Barrett, D., Bizal, C., Maly, F. E., Newburger, P. E., Ruedi, J. M., Smith, R. M., and Babior, B. M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 10174-10177 [Abstract/Free Full Text]
  13. Laemmli, U. K. (1970) Nature 227, 680-685 [CrossRef][Medline] [Order article via Infotrieve]
  14. Towbin, H., Staehlin, T., and Gordon, J. (1979) Proc. Natl. Acad. Sci. U. S. A. 76, 4350-4354 [Abstract/Free Full Text]
  15. Park, J-W., Ma, M., Ruedi, J. M., Smith, R. M., and Babior, B. M. (1992) J. Biol. Chem. 267, 17327-17332 [Abstract/Free Full Text]
  16. Park, J.-W., El Benna, J., Scott, K. E., Christensen, B. L., Chanock, S. J., and Babior, B. M. (1994) Biochemistry 33, 2907-2911 [CrossRef][Medline] [Order article via Infotrieve]
  17. Boyle, W. J., van der Geer, P., and Hunter, T. (1991) Methods Enzymol. 201, 110-149 [Medline] [Order article via Infotrieve]
  18. Sullivan, S., and Wong, T. W. (1991) Anal. Biochem. 197, 65-68 [CrossRef][Medline] [Order article via Infotrieve]
  19. Schagger, H., and von Jagow, G. (1990) Anal. Biochem. 166, 368-379
  20. Wolfson, M., McPhail, L. C., Nasrallah, V. N., and Snyderman, R. (1985) J. Immunol. 135, 2057-2062 [Abstract]
  21. Kramer, I. M., Verhoeven, A. J., van der Bend, R. L., Weening, R. S., and Roos, D. (1988) J. Biol. Chem. 263, 2352-2357 [Abstract/Free Full Text]
  22. Combadiere, C., El Benna, J., Pedruzzi, E., Hakim, J., and Perianin, A. (1993) Blood 82, 2890-2898 [Abstract/Free Full Text]
  23. Nauseef, W. M., Volpp, B. D., McCormick, S., Leidal, K. G., and Clark, R. A. (1991) J. Biol. Chem. 266, 5911-5917 [Abstract/Free Full Text]
  24. Kramer, I. J. M., and van der Bend, R. L. (1988) Biochim. Biophys. Acta 971, 189-196 [Medline] [Order article via Infotrieve]
  25. Tyagi, S. R., Olson, S. C., Burnham, D. N., and Lambeth, J. D. (1991) J. Biol. Chem. 266, 3498-3504 [Abstract/Free Full Text]

©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
K. Roepstorff, I. Rasmussen, M. Sawada, C. Cudre-Maroux, P. Salmon, G. Bokoch, B. van Deurs, and F. Vilhardt
Stimulus-dependent Regulation of the Phagocyte NADPH Oxidase by a VAV1, Rac1, and PAK1 Signaling Axis
J. Biol. Chem., March 21, 2008; 283(12): 7983 - 7993.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
L. A. Tephly and A. B. Carter
Constitutive NADPH oxidase and increased mitochondrial respiratory chain activity regulate chemokine gene expression
Am J Physiol Lung Cell Mol Physiol, November 1, 2007; 293(5): L1143 - L1155.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. V. Usatyuk, L. H. Romer, D. He, N. L. Parinandi, M. E. Kleinberg, S. Zhan, J. R. Jacobson, S. M. Dudek, S. Pendyala, J. G. N. Garcia, et al.
Regulation of Hyperoxia-induced NADPH Oxidase Activation in Human Lung Endothelial Cells by the Actin Cytoskeleton and Cortactin
J. Biol. Chem., August 10, 2007; 282(32): 23284 - 23295.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Med.Home page
C.-S. Yang, D.-S. Lee, C.-H. Song, S.-J. An, S. Li, J.-M. Kim, C. S. Kim, D. G. Yoo, B. H. Jeon, H.-Y. Yang, et al.
Roles of peroxiredoxin II in the regulation of proinflammatory responses to LPS and protection against endotoxin-induced lethal shock
J. Exp. Med., March 19, 2007; 204(3): 583 - 594.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
C. F. Fortin, O. Lesur, and T. Fulop Jr
Effects of TREM-1 activation in human neutrophils: activation of signaling pathways, recruitment into lipid rafts and association with TLR4
Int. Immunol., January 1, 2007; 19(1): 41 - 50.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
A. N. Lyle and K. K. Griendling
Modulation of vascular smooth muscle signaling by reactive oxygen species.
Physiology, August 1, 2006; 21: 269 - 280.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Ogura, I. Nobuhisa, S. Yuzawa, R. Takeya, S. Torikai, K. Saikawa, H. Sumimoto, and F. Inagaki
NMR Solution Structure of the Tandem Src Homology 3 Domains of p47phox Complexed with a p22phox-derived Proline-rich Peptide
J. Biol. Chem., February 10, 2006; 281(6): 3660 - 3668.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Guichard, E. Pedruzzi, C. Dewas, M. Fay, C. Pouzet, M. Bens, A. Vandewalle, E. Ogier-Denis, M.-A. Gougerot-Pocidalo, and C. Elbim
Interleukin-8-induced Priming of Neutrophil Oxidative Burst Requires Sequential Recruitment of NADPH Oxidase Components into Lipid Rafts
J. Biol. Chem., November 4, 2005; 280(44): 37021 - 37032.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
T. Reistad and E. Mariussen
A Commercial Mixture of the Brominated Flame Retardant Pentabrominated Diphenyl Ether (DE-71) Induces Respiratory Burst in Human Neutrophil Granulocytes In Vitro
Toxicol. Sci., September 1, 2005; 87(1): 57 - 65.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Reinehr, S. Becker, A. Eberle, S. Grether-Beck, and D. Haussinger
Involvement of NADPH Oxidase Isoforms and Src Family Kinases in CD95-dependent Hepatocyte Apoptosis
J. Biol. Chem., July 22, 2005; 280(29): 27179 - 27194.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Piccoli, R. Ria, R. Scrima, O. Cela, A. D'Aprile, D. Boffoli, F. Falzetti, A. Tabilio, and N. Capitanio
Characterization of Mitochondrial and Extra-mitochondrial Oxygen Consuming Reactions in Human Hematopoietic Stem Cells: NOVEL EVIDENCE OF THE OCCURRENCE OF NAD(P)H OXIDASE ACTIVITY
J. Biol. Chem., July 15, 2005; 280(28): 26467 - 26476.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
D. Bergin, E. P. Reeves, J. Renwick, F. B. Wientjes, and K. Kavanagh
Superoxide Production in Galleria mellonella Hemocytes: Identification of Proteins Homologous to the NADPH Oxidase Complex of Human Neutrophils
Infect. Immun., July 1, 2005; 73(7): 4161 - 4170.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. K. Chowdhury, T. Watkins, N. L. Parinandi, B. Saatian, M. E. Kleinberg, P. V. Usatyuk, and V. Natarajan
Src-mediated Tyrosine Phosphorylation of p47phox in Hyperoxia-induced Activation of NADPH Oxidase and Generation of Reactive Oxygen Species in Lung Endothelial Cells
J. Biol. Chem., May 27, 2005; 280(21): 20700 - 20711.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Massenet, S. Chenavas, C. Cohen-Addad, M.-C. Dagher, G. Brandolin, E. Pebay-Peyroula, and F. Fieschi
Effects of p47phox C Terminus Phosphorylations on Binding Interactions with p40phox and p67phox: STRUCTURAL AND FUNCTIONAL COMPARISON OF p40phox and p67phox SH3 DOMAINS
J. Biol. Chem., April 8, 2005; 280(14): 13752 - 13761.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
C. Elbim, C. Guichard, P. M. C. Dang, M. Fay, E. Pedruzzi, H. Demur, C. Pouzet, J. El Benna, and M.-A. Gougerot-Pocidalo
Interleukin-18 Primes the Oxidative Burst of Neutrophils in Response to Formyl-Peptides: Role of Cytochrome b558 Translocation and N-Formyl Peptide Receptor Endocytosis
Clin. Vaccine Immunol., March 1, 2005; 12(3): 436 - 446.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. T. Quinn and K. A. Gauss
Structure and regulation of the neutrophil respiratory burst oxidase: comparison with nonphagocyte oxidases
J. Leukoc. Biol., October 1, 2004; 76(4): 760 - 781.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Ueyama, M. R. Lennartz, Y. Noda, T. Kobayashi, Y. Shirai, K. Rikitake, T. Yamasaki, S. Hayashi, N. Sakai, H. Seguchi, et al.
Superoxide Production at Phagosomal Cup/Phagosome through {beta}I Protein Kinase C during Fc{gamma}R-Mediated Phagocytosis in Microglia
J. Immunol., October 1, 2004; 173(7): 4582 - 4589.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Yuzawa, K. Ogura, M. Horiuchi, N. N. Suzuki, Y. Fujioka, M. Kataoka, H. Sumimoto, and F. Inagaki
Solution Structure of the Tandem Src Homology 3 Domains of p47phox in an Autoinhibited Form
J. Biol. Chem., July 9, 2004; 279(28): 29752 - 29760.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. E. Brown, M. Q. Stewart, S. A. Bissonnette, A. E. H. Elia, E. Wilker, and M. B. Yaffe
Distinct Ligand-dependent Roles for p38 MAPK in Priming and Activation of the Neutrophil NADPH Oxidase
J. Biol. Chem., June 25, 2004; 279(26): 27059 - 27068.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. Tsunawaki, L. S. Yoshida, S. Nishida, T. Kobayashi, and T. Shimoyama
Fungal Metabolite Gliotoxin Inhibits Assembly of the Human Respiratory Burst NADPH Oxidase
Infect. Immun., June 1, 2004; 72(6): 3373 - 3382.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
S. Yuzawa, N. N. Suzuki, Y. Fujioka, K. Ogura, H. Sumimoto, and F. Inagaki
A molecular mechanism for autoinhibition of the tandem SH3 domains of p47phox, the regulatory subunit of the phagocyte NADPH oxidase
Genes Cells, May 1, 2004; 9(5): 443 - 456.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
N. Miyoshi, S. Takabayashi, T. Osawa, and Y. Nakamura
Benzyl isothiocyanate inhibits excessive superoxide generation in inflammatory leukocytes: implication for prevention against inflammation-related carcinogenesis
Carcinogenesis,