Lrp (Leucine-responsive regulatory protein) ()is a recently recognized global regulator of metabolism in Escherichia coli (reviewed in (1) and (2) ). It acts negatively to reduce expression of some operons and positively to increase expression of others. In general, Lrp appears to stimulate expression of operons that function in biosynthetic pathways and to repress expression of those that function in catabolic pathways. In addition, the expression of many Lrp-related operons is affected by L-leucine. In some cases, leucine overcomes the effect of Lrp, in other cases it is required for the effect, and in yet other cases it does not seem to influence the effect of Lrp(1, 2) .

Lrp has a monomer molecular mass of 18.8 kDa, and at a concentration of 10 µM it exists as a dimer in solution(3) . It is a moderately abundant protein in E. coli grown in a minimal medium (about 3000 dimers/cell)(3) .

The binding of Lrp in vitro to DNA upstream of fimA(4) , ilvIH(5) , lysU(6, 7) , ompC-micF(8) , and pap(9) has been studied by DNase I footprinting. In each case, Lrp perturbs the structure of DNA over a region of 100 bp or more. For the case of ilvIH, Lrp binds to six distinct sites, and the binding is highly cooperative to two groups of those sites(10) . Lrp induces a bend of about 50° in binding to a single site(5) .

A preliminary consensus sequence was derived from a comparison of 12 sites to which Lrp was shown to bind in MPE footprinting experiments (11) . That consensus sequence was confirmed and extended by analyzing 63 sequences obtained using the ``Selex'' procedure of Tuerk and Gold (12, 13) . The consensus, YAGHAWATTWTDCTR (Y = C/T, H =``not G,'' W = A/T, D =``not C,'' R = A/G), is 15 bp in length and is palindromic in part. The central 5 bp are predominantly ATs, with the As distributed mostly on one strand and the Ts on the other.

Here we investigate further the requirements for Lrp interaction with a single binding site. We demonstrate that a double-stranded 15 mer having a sequence that closely matches the consensus does not bind Lrp and that flanking DNA sequences are required for strong binding. Surprisingly, single-stranded DNA in some cases provides the extra energy required for strong binding. In addition, we performed stoichiometry experiments that demonstrate that a single Lrp binding site binds one Lrp dimer.

MATERIALS AND METHODS

Stoichiometry Measurements

Radioactive Lrp was prepared by in vitro transcription and translation in the presence of [H]leucine. Plasmid pCV225, containing the lrp gene downstream of a phage T7 promoter, was constructed as follows. The lrp gene from plasmid pCV180 (15) was cut out with EcoRI and BamHI and cloned between the same sites of plasmid pYFC-0 (a derivative of pBS II SK, in which the lac operator was deleted)(16) . Plasmid pCV225 was isolated from strain CV1211 (JM101/pCV225) and purified by CsCl centrifugation(17) . Lrp was synthesized in a 50-µl reaction mixture containing 1 µg of plasmid pCV225 DNA, 134 pmol of L-[4,5-H]leucine (Amersham, 149 Ci/mmol), 1 µl of a solution containing a mixture of all of the amino acids except leucine (each at 1 mM), 1 µl of a solution containing T7 RNA polymerase, and 25 µl of rabbit reticulocyte extract. All of the components except leucine and DNA were from the TNT T7 coupled rabbit reticulocyte lysate system of Promega. After 90 min at 30 °C, unincorporated leucine was removed by passing the sample through a spin column containing 250 µl of Sephadex G-50 swollen in TGED (10 mM Tris-HCl, pH 8.0, 20% glycerol, 0.1 mM EDTA, and 0.1 mM DTT). This column was centrifuged at 850 g for 1 min, and the flow-through volume containing Lrp was collected. The specific activity of Lrp was calculated as the product: specific activity [H]Leu (dpm/pmol) 23 pmol of Leu/pmol of Lrp. The specific activity of the leucine had to be corrected because of the unradiolabled leucine in the rabbit reticulocyte extract. To do this, a 25-µl sample of the reticulocyte lysate was added to 25 µl of 30% CHOH, and after dilution to 1 ml with 20% CHOH, the sample was passed through an equilibrated C-18 Sep-Pak cartridge. The eluate was dried under vacuum, dissolved in 100 µl of 0.1 M of HCl, and assayed for amino acids with a Beckman amino acid analyzer. The efficiency of the scintillation counter for counting tritium was determined by measuring cpm for samples of [H]leucine (149 Ci/mmol) that had been added to samples of polyacrylamide gel and treated with peroxide and perchlorate as described above.

In a typical experiment to determine stoichiometry, a 100-µl solution containing 40% glycerol, 40 mM Tris-HCl (pH 8.0), 20 µg of bovine serum albumin (BSA), 0.2 mM EDTA, 0.4 mM DTT, 100 mM NaCl, 20 mM MgCl, and about 1.5 pmol of end-labeled site 2 was mixed with 100 µl of the sample containing tritiated Lrp. After 20 min at 20 °C, the sample was distributed into five wells and fractionated by electrophoresis through a 1.5-mm 8% polyacrylamide gel for 2.5 h at 14 V/cm. The LrpDNA complex in each lane identified by autoradiography was excised in a volume of 0.35 cm and counted as described above using Beckman program 6. Channel 1 was used to measure tritium counts/min after corrections were made for spillover of P (approximately 4% of channel 2 counts). Channel 2 was used to measure P with no correction for tritium spillover necessary. Stoichiometry was determined from the following equation: [cpm H specific activity of DNA (cpm/pmol)]/[cpm P H efficiency (cpm/dpm) specific activity of Lrp (dpm/pmol)].

The Molecular Weight of LrpDNA Complexes

Heterodimer Formation in Vitro

()

Following the procedure of Hager and Burgess(19) , heterodimers were prepared by mixing 1 µl of 6XHis-Lrp (6 µg/µl), 3 µl of Lrp (1 µg/µl), and 20 µl of 8 M guanidine hydrochloride, all in TGED, 0.1 M NaCl, and incubating at room temperature for 1 h. The sample was diluted with 1 ml of TGED, 0.1 M NaCl, and after incubation for an additional 5 h, 1 µl was used in binding reactions. Electrophoresis was performed through 38-cm long 8% polyacrylamide gels at 10 V/cm for 15 h at room temperature.

Oligonucleotides Used to Define Minimal Requirements for Lrp Binding

Scheme 1.

5`-GATCGAAGCTTGTCCCATAGCATAATATTCTCCTTACGCTCTAGACGCAT-3` (F) TAGCATAATATTCTC ATAGCATAATATTCTCC CATAGCATAATATTCTCCT CCATAGCATAATATTCTCCTT CCCATAGCATAATATTCTCCTTA TCCCATAGCATAATATTCTCCTTAC 3`-CTAGCTTCGAACAGGGTATCGTATTATAAGAGGAATGCGAGATCTGCGTA-5` (R) ATCGTATTATAAGAG TATCGTATTATAAGAGG GTATCGTATTATAAGAGGA GGTATCGTATTATAAGAGGAA GGGTATCGTATTATAAGAGGAAT AGGGTATCGTATTATAAGAGGAATG

Complementary sequences F and R comprise a double-stranded 50 mer that bound Lrp most strongly from a collection of 63 sequences that were selected in vitro for binding to Lrp (Leu-19 in (12) ). The underlined region corresponds to the 15-bp consensus sequence that was defined by a comparison of the 63 sequences(12) . All oligonucleotides were purified by polyacrylamide gel electrophoresis. To form duplex DNA, equimolar amounts of complementary strands were added to 100 mM NaCl, 10 mM Tris (pH 8.0), 1 mM EDTA, heated to 95 °C for 5 min, and cooled slowly to room temperature.

Determination of Binding Constants for Lrp-DNA Interactions

In other experiments, DNA samples were labeled and incubated with Lrp as described above except that samples were separated through 8% polyacrylamide gels in the cold to avoid denaturing short duplexes. In some cases, the amount of free DNA and LrpDNA complex were measured over a range of Lrp concentrations and binding constants were calculated as the concentration of Lrp at which half of the DNA existed as complex. In other cases, binding constants were determined relative to that for the double-stranded 50 mer using the equation K = (C/D) 1/(P - C), where K is the binding constant, C and D are the band intensities of the complex and free DNA, respectively, and P is the total protein concentration. For these experiments, the DNA concentration was 5 nM, and the Lrp concentration was either 16.6 nM ( Fig. 6and Fig. 7) or 8.3 nM (Fig. 8). Where relative binding strengths are reported, the binding constant for a particular construct was divided by that for the double-stranded 50 mer construct, determined in the same experiment.

Figure 6: Lrp binding as a function of the number of base pairs flanking the consensus. A, schematic drawing of the double-stranded DNA fragments used (sequences are in oligonucleotide section of ``Materials and Methods''). The shaded area represents the base pairs that are a close match to the 15-bp consensus. B, gel retardation experiment employing P-labeled DNA fragments identified in Panel A and 16.6 nM Lrp. C, LrpDNA complex; F, free DNA. C, quantitation of results shown in Panel B. Binding is relative to the double-stranded 50 mer. Values shown are the average of three experiments.

Figure 7: Binding of Lrp to constructs having different lengths of single-stranded DNA flanking a constant 17-bp double-stranded region. A, schematic drawing of constructs having a 17-bp double-stranded region flanked by single-stranded DNA of the R polarity (Fig. 3D). B, same as A, except that single-stranded DNA is of the F polarity (Fig. 3E). C, gel retardation experiments of the type shown in Fig. 6B were performed with P-labeled fragments shown in Panels A and B and 16.6 nM Lrp. Panel C shows the quantitation of these results. Binding is relative to the double-stranded 50 mer. Values shown are the average of three experiments.

Figure 8: Effect of NaCl concentration on binding of Lrp to constructs having flanking double- or single-stranded DNA. A, schematic drawing of constructs used in this experiment. B, gel retardation experiments of the type shown in Fig. 6B were performed with P-labeled fragments shown in Panel A, 8.3 nM Lrp, and the indicated concentrations of NaCl. Values shown are the average of two experiments.

Figure 3: Primer extension analysis of flanking DNA length required for Lrp binding. Primer/template combinations shown in D and E (shaded regions represent consensus) were extended with DNA polymerase in the presence of dNTPs and ddNTPs, yielding a nested set of fragments. With the exception of the full-length fragment, each fragment has both a single and double-stranded region. After incubation with either 8.3 or 16.6 nM Lrp, free DNA was separated from DNA complexed to Lrp, and each was separately analyzed on a sequencing gel. A, primer/template as in Panel D. Lanes 1, 2, 3, and 4, primer extension products (G, A, T, C, respectively) that serve to identify adjacent bands; lanes 6 (8.3 nM Lrp) and 8 (16.6 nM Lrp), free DNA; lanes 5 (8.3 nM Lrp) and 7 (16.6 nM Lrp), DNA complexed to Lrp. B, same as A, except that primer/template as in Panel E. C and F, quantitation of data from Panels A and B, respectively. K/K = (C/D)/(C/D) where K is the binding constant for the full-length 50 mer, C and D are the band intensities of the complex and free DNA for each fragment, and C and D are the band intensities of the complex and free DNA for the 50 mer.

RESULTS

Stoichiometry of Lrp Binding to DNA

Establishing the value of n requires an estimate of the molecular weight of the complex. This was provided by measuring the electrophoretic mobility of LrpDNA complexes through native acrylamide gels of different porosities (Ferguson plots)(18) . Fig. 1A shows the mobility versus percent acrylamide concentration for each of the standards used (globular proteins of molecular mass 14.2-132 kDa), and in Fig. 1B the slopes of each curve are plotted against the respective molecular mass. LrpDNA complexes, analyzed together with standards in the same gels, behaved like proteins having a molecular mass of 65 kDa. This result establishes the stoichiometry as DP (molecular mass = 58 kDa) rather than DP (molecular mass = 116 kDa). The fact that the experimentally determined molecular mass of the complex was higher than the calculated value (65 versus 58 kDa) may be due to differences in shape between the standards employed (globular proteins) and the sample (DNA-protein complex).

Figure 1: Molecular mass estimate of an LrpDNA complex. A, relative electrophoretic mobility (R) of the indicated macromolecules as a function of the acrylamide concentration within native gels. For chicken egg albumin and carbonic anhydrase, the major and fastest-moving isomers, respectively, were analyzed. B, the slope of each curve from panel A was plotted against the known molecular mass of each protein standard. The arrow and black rectangle denote the positioning of the Lrp-site 2 complex on this standard curve, based upon its curve shown in Panel A. The predicted molecular mass of the Lrp-site 2 complex from this experiment is 65 kDa.

The conclusion that two Lrp monomers bind to a single site was confirmed by employing the strategy of Hope and Struhl(22) . An Lrp derivative having 12 extra amino acids at the NH terminus, including 6 His residues (6XHis-Lrp), shows DNA binding characteristics that are almost identical to the wild type (data not shown). By performing electrophoresis for 15 h, LrpDNA and 6XHis-LrpDNA complexes were clearly separated (Fig. 2, lanes 1 and 2). A mixture of homo- and heterodimers was created by mixing the wild type and 6XHis proteins, denaturing in 6 M guanidine, and renaturing by dilution. A band shift experiment performed with this mixture and DNA having a single Lrp binding site showed bands corresponding to complexes of DNA with wild type homodimer, 6XHis-Lrp homodimer, and wild type/6XHis-Lrp heterodimer (Fig. 2, lane 3). This is the expected pattern for binding of two Lrp monomers to a single binding site(22) .

Figure 2: Evidence suggesting that two Lrp monomers bind to a single site on DNA. Wild type (lane 1) and 6XHis-Lrp (lane 2) when complexed with ilvIH site 2 DNA have different electrophoretic mobilities. A mixture of the two proteins, after denaturation, renaturation, incubation with ilvIH site 2 DNA, and electrophoresis, show complexes corresponding to Lrp homodimer, 6XHis-Lrp homodimer, and heterodimer (lane 3; note band of intermediate mobility). Because electrophoresis was performed for 15 h, the free DNA ran off the gel.

Lrp Binding as a Function of DNA Length-Primer Extension Analysis

where K is the binding constant for the full length 50 mer, C and D are the band intensities of the complex and free DNA for each fragment, and C and D are the band intensities of the complex and free DNA for the 50 mer(20) . The radioactivity in each band in Fig. 3, A and B, was quantified with a Betascope blot analyzer and used to calculate values of K/K (Fig. 3, C and F). The results for the R and F strands used as template were similar in the sense that good binding in both cases required extension at least through the 15-bp consensus sequence. Furthermore, good binding in the experiment in which the R strand was template seemed to require 3-5 additional base pairs beyond the consensus sequence (Fig. 3C).

A potential conclusion from these experiments is that given 15 bp or so of flanking double-stranded DNA on one side of the consensus, only a relatively few base pairs (from 0 to 3) are required on the other side of the consensus to get tight binding. However, another possibility has to be considered, namely that the single-stranded DNA portions of these primer-extended molecules affect binding to Lrp. As shown below, that turns out to be true. It makes a difference whether the single-stranded DNA is on the left or right of the double-stranded regions, and whether the polarity of the single-stranded DNA is 5` to 3` or 3` to 5`. These conclusions are derived from a comparison of the results described above with the results of additional primer extension experiments summarized in Fig. 4. In parts A and C, the 50-mer R strand served as template, and the primer was the complementary 15-mer consensus sequence. In parts B and D, the configuration was the same as for A and C, but the single-stranded tail of the template strand to the left of the consensus was not present. To facilitate a comparison of all of these results, we summarize them in Fig. 5using a simplified notation. Binding of the double-stranded 50 mer to Lrp is set at 100% (Fig. 5, line 1), and other results are relative to this. Note that, for each of the comparisons in Fig. 5, the 15-bp consensus region is double-stranded. It is clear that single-stranded DNA flanking the consensus can significantly contribute to binding (Fig. 5, compare lines 2 and 4 with line 5). Furthermore, the polarity of the single-stranded DNA to the left of the consensus affects the degree of binding (Fig. 5, compare lines 2 and 4). Finally, the positioning of double-stranded and single-stranded DNA relative to the consensus affects binding (Fig. 5, compare lines 2 and 3). Thus, the construct having double-stranded DNA to the right of the consensus and single-stranded DNA to the left shows stronger binding than the construct with the opposite configuration.

Figure 4: Evidence from primer extension analysis that flanking single-stranded DNA contributes to binding Lrp. As in Fig. 3except that double-stranded 50 mer (indicated by the arrows) was added to the binding reaction as a reference molecule.

Figure 5: Summary of Lrp binding to DNAs having flanking double and single-stranded regions. Each DNA construct has a 15-bp double-stranded sequence that closely matches the consensus (shaded region), and flanking DNA that is either double-stranded or single-stranded. In each schematic, the top strand has polarity 5` to 3`. Binding is relative to the double-stranded 50 mer that was included in each experiment.

Lrp Binding as a Function of DNA Length: Experiments with Oligonucleotides of Defined Length

In another set of experiments, we investigated the binding of Lrp to constructs having different lengths of single-stranded DNA flanking a constant double-stranded consensus region (Fig. 7, A and B). We chose 17 bp as the length of the double-stranded consensus region because such a minimal sequence did not bind Lrp (Fig. 6), and therefore we could expect to see an effect of single-stranded flanking DNA. In addition, a preliminary experiment showed that a 17:50 mer complex (and 19:50, 21:50, 23:50, and 25:50 complexes) bound Lrp with avidity equal to or greater than the double-stranded 50 mer (data not shown). As shown in Fig. 7C, if the flanking single-stranded DNA was of polarity F, then as little as two additional bases flanking each side of the double-stranded region contributed to increased binding and additional bases added to the strength of binding. The majority of added binding strength, however, was contributed by single-stranded DNA that was longer than 4 bases. The contribution of flanking single-stranded R strand to binding also was substantial only with a relatively long length of DNA, and was always less than that for an equivalent length of F DNA. These results are consistent with those mentioned above indicating that single-stranded DNA can contribute to Lrp binding and that the contribution of F and R single-stranded DNA is different.

The results in Fig. 6and Fig. 7demonstrating that both double- and single-stranded flanking DNA can contribute to Lrp binding were obtained in experiments employing only a single Lrp concentration. In a separate experiment employing just two of the constructs, we measured complex formation over a range of Lrp concentrations including Lrp in great excess. The apparent binding constants for Lrp binding to the double-stranded 50 mer and the 17R:50F construct were very similar (1.5 versus 1.7 nM, respectively), confirming the data for those constructs in Fig. 7.

The Effect of NaCl and Competitor DNA on Binding of Lrp to Constructs Having Flanking Double- or Single-stranded DNA

In addition, we measured the effects of competitor DNA on binding of Lrp to the two constructs shown in Fig. 8A. The competitor DNAs were single and double-stranded forms of a 44 mer having a sequence unrelated to the Lrp binding consensus. Neither single nor double-stranded DNA competed very effectively against either of the constructs bound to Lrp: the binding constant was reduced less than two fold by competitors in 50-100-fold molar excess (data not shown).

DISCUSSION

For each of six operons thought to be directly controlled by Lrp, DNase I footprinting studies suggest that Lrp interacts with or affects the structure of DNA over a region of 100 bp or more(4, 6, 7, 8, 9, 10) . Lrp clearly interacts with multiple sites within these regions, and in the cases of fim A(4) , ilvIH(5) , lysU(6) , and pap, ()those interactions are cooperative. Here we define the stoichiometry of interaction as two Lrp monomers binding to a single site. Lrp in micromolar concentrations exists as a dimer in solution(3) , and some preliminary experiments indicate that the dimer structure of Lrp is maintained even at concentrations well below the nanomolar range. Therefore, the unit of binding can be considered an Lrp dimer.

A consensus for Lrp binding was formulated by a computer analysis of sequences associated with the Lrp regulon (23) and by a comparison of naturally occurring Lrp binding sites(11) . A more extensive analysis of 63 binding sites derived by using the Selex approach of Tuerk and Gold (13) yielded a consensus sequence 15 bp in length that was palindromic in part and that was very similar to the consensus sequences derived previously(12) . The work presented here indicates 15 bp may be sufficient for specificity, but an additional 3-5 flanking base pairs are required for tight binding. These additional flanking base pairs may contribute additional binding energy, as was proposed for the Crp/DNA interaction(20) . Alternatively, DNA ends may be disruptive to binding, and strong binding may require that these ends be displaced from the site of protein-DNA contact by several base pairs. We cannot distinguish between these two possibilities.

Lrp binds tightly to double-stranded DNA having a sequence related to the consensus, but not to that same DNA after it has been denatured (5) . Thus, Lrp does not bind tightly per se to single-stranded DNA. However, as demonstrated here, single-stranded DNA can stimulate Lrp binding when it flanks a double-stranded consensus sequence. There are at least three ways in which single-stranded flanking DNA could affect binding of Lrp. Single-stranded flanking DNA might bind to the same site on Lrp that normally binds double-stranded flanking DNA. The effects of NaCl on binding suggest that this possibility is not correct. Part of the binding of Lrp to DNA is likely driven by an increase in entropy due to the release of Na ions from the DNA(24) . Binding of Lrp to double-stranded DNA is expected to release more sodium ions than binding to an equivalent length of single-stranded DNA and thus higher sodium ion concentrations should reduce binding to double-stranded DNA more than binding to single-stranded DNA. In fact, the opposite is the case (Fig. 8B). Another possibility is that single-stranded DNA interacts with Lrp at a second site and that this binding increases the strength with which the consensus sequence interacts with its binding site on Lrp. This possibility seems ruled out by the data showing that single-stranded competitor DNA reduces rather than increases binding to Lrp. A third possibility is that Lrp interacts only weakly with single-stranded DNA at some site other than the major binding site, but that this weak interaction provides the few kilocalories of energy required for binding of Lrp in the nanomolar range to the 17R:50F construct. The results of the competition experiment are consistent with this interpretation. The fact that single-stranded competitor DNA did not compete effectively can be explained by the fact that its concentration, although high relative to the labeled DNA, is much lower than the effective concentration of tethered single-stranded DNA.

Data summarized in Fig. 5indicate that the binding strength conferred by single-stranded DNA depends upon whether that DNA is on the left or the right of the core binding sequence, and upon which of the two strands is single stranded. The difference in binding strength may reflect differences in the sequences of the single-stranded regions and/or differences in the halves of the 15-bp core binding sequence. The consensus sequence is partially palindromic (12) and for the particular sequence used here, one of the two half sites is calculated to be a better match to the consensus than the other(12) . Thus, it is likely that one of the two subunits of Lrp is bound more tightly than the other, and this might contribute to the asymmetry observed in the binding of flanking single-stranded DNA.

It is not clear that the binding of single-stranded DNA to Lrp has any biological significance. However, one can imagine possible roles for such an activity (for example, binding to single-stranded DNA produced during transcription initiation), and therefore it will be of interest to determine whether mutant Lrps having altered regulatory properties are also altered in their ability to bind single-stranded DNA.

FOOTNOTES

*

This work was supported in part by National Institutes of Health Grant GM39496. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§

Partly supported by a fellowship from the K.-C. Wong Education Foundation, Hong Kong.

¶

Present address: Dept. of Human Genetics, University of Utah Health Sciences Center, Salt Lake City, Utah 84112.

**

To whom correspondence should be addressed: 451 Biotechnology Building, Cornell University, Ithaca, NY 14853. Tel.: 607-255-2437; Fax: 607-255-2428; jmc22{at}Cornell.edu.

()

The abbreviations used are: Lrp, leucine-responsive regulatory protein; bp, base pairs; BSA, bovine serum albumin; DTT, dithiothreitol; dNTP, deoxynucleotide triphosphate; ddNTP, dideoxynucleoside triphosphate; MPE, methidiumpropyl EDTA-Fe(II).

()

Y. Cui and J. M. Calvo, unpublished results.

()

X. Nou, B. Braaten, L. Kaltenbach, and D. Low, manuscript submitted for publication.

ACKNOWLEDGEMENTS

REFERENCES

1. Newman, E. B., D'Ari, R., and Lin, R. T. (1992) Cell 68, 617-619 [CrossRef][Medline] [Order article via Infotrieve]
2. Calvo, J. M., and Matthews, R. G. (1994) Microbiol. Rev. 58, 466-490 [Abstract/Free Full Text]
3. Willins, D. A., Ryan, C. W., Platko, J. V., and Calvo, J. M. (1991) J. Biol. Chem. 266, 10768-10774 [Abstract/Free Full Text]
4. Gally, D. L., Rucker, T. J., and Blomfield, I. C. (1994) J. Bacteriol. 176, 5665-5672 [Abstract/Free Full Text]
5. Wang, Q., and Calvo, J. M. (1993) EMBO J. 12, 2495-2501 [Medline] [Order article via Infotrieve]
6. Gazeau, M., Delort, F., Fromant, M., Dessen, P., Blanquet, S., and Plateau, P. (1994) J. Mol. Biol. 241, 378-389 [CrossRef][Medline] [Order article via Infotrieve]
7. Lin, R., Ernsting, B., Hirshfield, I. N., Matthews, R. G., Neidhardt, F. C., Clark, R. L., and Newman, E. B. (1992) J. Bacteriol. 174, 2779-2784 [Abstract/Free Full Text]
8. Ferrario, M., Ernsting, B. R., Borst, D. W., Wiese II, D. E., Blumenthal, R. M., and Matthews, R. G. (1995) J. Bacteriol. 177, 103-113 [Abstract/Free Full Text]
9. Nou, X., Skinner, B., Braaten, B., Blyn, L., Hirsch, D., and Low, D. (1993) Mol. Microbiol. 7, 545-553 [Medline] [Order article via Infotrieve]
10. Wang, Q., and Calvo, J. M. (1993) J. Mol. Biol. 229, 306-318 [CrossRef][Medline] [Order article via Infotrieve]
11. Wang, Q., Sacco, M., Ricca, E., Lago, C. T., DeFelice, M., and Calvo, J. M. (1993) Mol. Microbiol. 7, 883-891 [CrossRef][Medline] [Order article via Infotrieve]
12. Cui, Y., Wang, Q., Stormo, G. D., and Calvo, J. M. (1995) J. Bacteriol. 177, 4872-4880 [Abstract/Free Full Text]
13. Tuerk, C., and Gold, L. (1990) Science. 249, 505-510 [Abstract/Free Full Text]
14. Yang, C., and Nash, H. A. (1989) Cell 57, 869-880 [CrossRef][Medline] [Order article via Infotrieve]
15. Platko, J. V., and Calvo, J. M. (1993) J. Bacteriol. 175, 1110-1117 [Abstract/Free Full Text]
16. Chen, Y., and Helmann, J. D. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 5123-5127 [Abstract/Free Full Text]
17. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , Vol. I, pp. 1.42-1.43, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
18. Orchard, K., and May, G. E. (1993) Nucleic Acids Res. 21, 3335-3336 [Free Full Text]
19. Hager, D. A., and Burgess, R. R. (1980) Anal. Biochem. 109, 87-93 [CrossRef][Medline] [Order article via Infotrieve]
20. Liu-Johnson, H. N., Gartenberg, M. R., and Crothers, D. M. (1986) Cell 47, 995-1005 [CrossRef][Medline] [Order article via Infotrieve]
21. Svaren, J., Inagami, S., Lovegren, E., and Chalkley, R. (1987) Nucleic Acids Res. 21, 8739-8754
22. Hope, I. A., and Struhl, K. (1987) EMBO J. 6, 2781-2784 [Medline] [Order article via Infotrieve]
23. Rex, J. H., Aronson, B. D., and Somerville, R. L. (1991) J. Bacteriol. 173, 5944-5953 [Abstract/Free Full Text]
24. Lohman, T., and Mascotti, D. P. (1992) Methods Enzymol. 212, 400-424 [Medline] [Order article via Infotrieve]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				K. A. McFarland, S. Lucchini, J. C. D. Hinton, and C. J. Dorman The Leucine-Responsive Regulatory Protein, Lrp, Activates Transcription of the fim Operon in Salmonella enterica Serovar Typhimurium via the fimZ Regulatory Gene J. Bacteriol., January 15, 2008; 190(2): 602 - 612. [Abstract] [Full Text] [PDF]

				J. Casadesus and D. Low Epigenetic Gene Regulation in the Bacterial World Microbiol. Mol. Biol. Rev., September 1, 2006; 70(3): 830 - 856. [Abstract] [Full Text] [PDF]

				N. Baichoo and J. D. Helmann Recognition of DNA by Fur: a Reinterpretation of the Fur Box Consensus Sequence J. Bacteriol., November 1, 2002; 184(21): 5826 - 5832. [Abstract] [Full Text] [PDF]

				I. Dahlke and M. Thomm A Pyrococcus homolog of the leucine-responsive regulatory protein, LrpA, inhibits transcription by abrogating RNA polymerase recruitment Nucleic Acids Res., February 1, 2002; 30(3): 701 - 710. [Abstract] [Full Text] [PDF]

				D. Friedberg, M. Midkiff, and J. M. Calvo Global versus Local Regulatory Roles for Lrp-Related Proteins: Haemophilus influenzae as a Case Study J. Bacteriol., July 1, 2001; 183(13): 4004 - 4011. [Abstract] [Full Text] [PDF]

				E. R. Zinser and R. Kolter Prolonged Stationary-Phase Incubation Selects for lrp Mutations in Escherichia coli K-12 J. Bacteriol., August 1, 2000; 182(15): 4361 - 4365. [Abstract] [Full Text]

				K. Y. Rhee, B. S. Parekh, and G. W. Hatfield Leucine-responsive Regulatory Protein-DNA Interactions in the Leader Region of the ilvGMEDA Operon of Escherichia coli J. Biol. Chem., October 25, 1996; 271(43): 26499 - 26507. [Abstract] [Full Text] [PDF]

				A. B. Brinkman, I. Dahlke, J. E. Tuininga, T. Lammers, V. Dumay, E. de Heus, J. H. G. Lebbink, M. Thomm, W. M. de Vos, and J. van der Oost An Lrp-like Transcriptional Regulator from the Archaeon Pyrococcus furiosus Is Negatively Autoregulated J. Biol. Chem., December 1, 2000; 275(49): 38160 - 38169. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Cui, Y. Articles by Calvo, J. M. Search for Related Content PubMed PubMed Citation Articles by Cui, Y. Articles by Calvo, J. M. Social Bookmarking                      What's this?