Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reddy, A. S. N.
Right arrow Articles by Hu, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reddy, A. S. N.
Right arrow Articles by Hu, X.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 271, Number 12, Issue of March 22, 1996 pp. 7052-7060
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
A Novel Plant Calmodulin-binding Protein with a Kinesin Heavy Chain Motor Domain (*)

(Received for publication, July 26, 1995; and in revised form, December 4, 1995)

A. S. N. Reddy (§) Farida Safadi Soma B. Narasimhulu Maxim Golovkin Xu Hu

From the Department of Biology and Program in Cell and Molecular Biology, Colorado State University, Fort Collins, Colorado 80523

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Calmodulin, a ubiquitous calcium-binding protein, regulates many diverse cellular functions by modulating the activity of the proteins that interact with it. Here, we report isolation of a cDNA encoding a novel kinesin-like calmodulin-binding protein (KCBP) from Arabidopsis using biotinylated calmodulin as a probe. Calcium-dependent binding of the cDNA-encoded protein to calmodulin is confirmed by S-labeled calmodulin. Sequence analysis of a full-length cDNA indicates that it codes for a protein of 1261 amino acids. The predicted amino acid sequence of the KCBP has a domain of about 340 amino acids in the COOH terminus that shows significant sequence similarity with the motor domain of kinesin heavy chains and kinesin-like proteins and contains ATP and microtubule binding sites typical of these proteins. Outside the motor domain, the KCBP has no sequence similarity with any of the known kinesins, but contains a globular domain in the NH(2) terminus and a putative coiled-coil region in the middle. By analyzing the calmodulin binding activity of truncated proteins expressed in Escherichia coli, the calmodulin binding region is mapped to a stretch of about 50 amino acid residues in the COOH terminus region of the protein. Using a synthetic peptide, the calmodulin binding domain is further narrowed down to a 23-amino acid stretch. The synthetic peptide binds to calmodulin with high affinity in a calcium-dependent manner as judged by electrophoretic mobility shift assay of calmodulin-peptide complex. The KCBP is coded by a single gene and is highly expressed in developing flowers and suspension cultured cells. Although many kinesin heavy chains and kinesin-like proteins have been extensively characterized at the biochemical and molecular level in evolutionarily distant organisms, none of them is known to bind calmodulin. The plant kinesin-like protein with a calmodulin binding domain and a unique amino-terminal region is a new member of the kinesin superfamily. The presence of a calmodulin-binding motif in a kinesin heavy chain-like protein suggests a role for calcium and calmodulin in kinesin-driven motor function(s) in plants.


INTRODUCTION

Calcium is a key messenger in transducing many hormonal and environmental signals in plants(1, 2, 3, 4) . Several recent studies demonstrated elevation of cytosolic calcium by various hormonal and physical signals(3) . Increased cytosolic calcium is believed to control biochemical and molecular processes by modulating the activity of specific proteins either directly or through calmodulin(1, 2) . Calmodulin, a highly conserved multifunctional calcium-binding protein, is implicated in many calcium-dependent cellular processes in plant and animal cells(2, 5) . However, unlike animal calmodulin genes, plant calmodulin genes are highly responsive to various signals. The expression of calmodulin is found to be induced by many signals in plants(2, 6, 7) . Furthermore, the amount of calmodulin varies in different tissues and is high in actively dividing tissues(8, 9, 10, 11) . In plants, calmodulin is implicated in controlling a wide variety of cellular functions and physiological processes. These include phytochrome-regulated gene expression and chloroplast development(4) , cell division(12, 13) , thigmomorphogenesis(7) , gravitropism(6, 14) , and microtubule organization(15) .

Calmodulin action in regulating biochemical and molecular events and ultimately physiological processes involves its interaction with other proteins called calmodulin-binding proteins. The effect of this interaction usually results in regulation of enzymatic activity of the binding protein. In animal systems over 20 calmodulin-binding proteins such as protein kinases, a protein phosphatase, a plasma membrane calcium ATPase, an inositol trisphosphate kinase, a nitric oxide synthase, transcription factors, enzymes involved in cyclic nucleotide metabolism, and several cytoskeletal proteins have been characterized (2, 16, 17) . In plants, little is known about the identity and function of calmodulin-binding proteins. Using gel overlay assays, it has been shown that there are a number of proteins in plants that bind to calmodulin in a calcium-dependent manner(18, 19, 20) . Some of these proteins are detected only in specific tissues or cells suggesting their tissue specific role. To understand calmodulin-regulated processes, various strategies have been used to isolate, identify, and characterize the proteins that interact with calmodulin. These studies have resulted in identification of a few calmodulin-modulated proteins such as NAD kinase, calcium ATPase, nuclear nucleoside triphosphatase, a vacuolar ion channel, glutamate decarboxylase, elongation factor-1alpha, and protein kinases in plants (1, 21, 22, 23, 24, 25, 26) . Complementary DNAs that encode calmodulin-binding proteins of unknown function have also been isolated from maize and tobacco(27, 28) .

The kinesin superfamily of microtubule motor proteins is comprised of conventional kinesin heavy chains and other related proteins called kinesin-like proteins(29, 30) . The common feature among the members of the kinesin superfamily is a highly conserved motor domain of about 350 amino acid residues that contains ATP and microtubule binding sites. These motor proteins hydrolyze ATP and use the derived energy to translocate unidirectionally on microtubules. Kinesins and kinesin-like proteins are implicated in controlling diverse functions including spindle formation, chromosome segregation during cell division, and organellar and vesicular transport(30, 31, 32, 33, 34) . The conventional kinesin is a tetramer consisting of two heavy chains and two light chains, and the motor activity is associated with the heavy chain(35, 36) . The heavy chain has three structural domains: a motor domain that is located in the amino-terminal region, and contains conserved ATP and microtubule binding sites, a central stalk region that forms an alpha-helical coiled-coil region involved in dimerization, and a globular tail that binds to two light chains(37, 38, 39, 40) . However, kinesin-like proteins are either dimeric or monomeric(41, 42, 43) . The motor domain in kinesin-like proteins is located either in the NH(2) terminus, the COOH terminus, or in the middle region of the protein (33, 39, 41, 44, 45) . Outside the motor region kinesin-like proteins show limited or no sequence homology. Because of the presence of a superfamily of kinesins, it is suggested that the motor domain performs many diverse microtubule-based transport functions by being fused to unique domains that are specific to the cargo that they transport. Little is known about kinesins and their role in cellular functions in plants. Using a monoclonal antibody to the calf brain kinesin, an immunoreactive homolog of kinesin was identified in the tobacco pollen tube(46) . More recently, Mitsui et al.(47, 48) used primers corresponding to conserved regions in the motor domain of kinesin heavy chains to isolate three cDNAs (KatA, KatB, and KatC) encoding kinesin-like proteins from Arabidopsis. The predicted amino acid sequence of KatA, KatB, and KatC showed significant sequence similarity to motor domains of kinesins and kinesin-like proteins. This report describes the isolation and characterization of a cDNA which encodes a novel kinesin-like protein with a calmodulin binding domain from Arabidopsis. The calmodulin-binding motif, which is absent in all the previously reported kinesins and kinesin-like proteins, is mapped to a short stretch of 23 amino acids in the carboxyl-terminal region of the protein. The predicted amino acid sequence shows significant sequence similarity with the motor domain of kinesin heavy chain and contains structural features associated with kinesins and kinesin-like proteins. However, the calmodulin binding region is unique to this protein, suggesting that it is a new member of the kinesin superfamily. To our knowledge, this is first report to show that a calmodulin-binding protein is a kinesin heavy chain-like protein. The presence of a calmodulin binding domain and a motor domain in a single protein implies a role for calcium and calmodulin in kinesin heavy chain-driven motor functions in plant cells.


EXPERIMENTAL PROCEDURES

Materials

Arabidopsis thaliana (L.) Heynh. ecotype Columbia was grown at 22 °C on a mixture of peat:perlite:vermiculite (1:1:1) under continuous light. Leaves, stems, and flowers were collected from 5-6-week-old plants. Roots were grown in liquid cultures as described earlier(49) . Suspension-cultured cells from the same ecotype were grown in Murashige and Skoog salts supplemented with vitamins, 3% sucrose, and 0.5 µg/ml 2,4-dichlorophenoxyacetic acid. Triton X-100 free nitrocellulose filters (0.45 µm) were obtained from Millipore. [S]Methionine was purchased from Amersham Corp. ZipLox vector, Escherichia coli DH10B(ZIP), biotinylated calmodulin, and IPTG (^1)were from Life Technologies, Inc. Avidin/biotin blocking reagents and a Vectastain ABC horseradish peroxidase kit were obtained from Vector Laboratories. Calmodulin was from Calbiochem. Gelatin, calcineurin, and diaminobenzidine tetrahydrochloride were from Sigma. pET vectors and E. coli BL21 (DE3) were purchased from Novagen. All other chemicals were of reagent grade.

Screening of an Expression Library with Biotinylated Calmodulin

A directionally cloned (SalI-NotI) cDNA library of A. thaliana (L.) Heynh. ecotype Columbia prepared in ZipLox vector was used for screening. About 800,000 recombinants were screened with biotinylated calmodulin(50) . Approximately 5 times 10^4 pfu per 15-cm plate were plated on NZCYM plates (51) using E. coli XL1-blue MRA (Stratagene) as the host strain. The plates were incubated at 42 °C until the plaques appeared, at which time the plates were overlaid with nitrocellulose filters that were previously soaked in 10 mM IPTG. Growth of the plaques was then continued overnight at 37 °C. Following overnight incubation, the plates were cooled to 4 °C. The nitrocellulose filters were removed and washed briefly in TBS/Ca/Mg (50 mM Tris, pH 7.5, 0.2 M NaCl, 0.5 mM CaCl(2), 50 mM MgCl(2)) at room temperature. The filters were blocked for 1 h with gentle shaking in TBS/Ca/Mg containing 3% (w/v) gelatin at 30 °C and rinsed in TBS/Ca/Mg. The filters were then incubated in avidin solution for 45 min, rinsed in TBS/Ca/Mg, 0.1% Tween-20, and incubated for 45 min in biotin solution. Both avidin and biotin solutions were prepared in TBS/Ca/Mg, 0.1% Tween-20 by adding 20 drops to 10 ml of buffer. The filters were then incubated in TBS/Ca/Mg buffer containing biotinylated calmodulin (59 nM) and 1% gelatin for 3 h at 30 °C. The filters were rinsed briefly in TBS/Ca/Mg, washed for 10 min in the same buffer, and incubated for 30 min in Vectastain avidin DH-biotinylated horseradish peroxidase H complex (ABCbulletHRP) reagent in TBS/Ca/Mg containing 0.1% Tween 20 at 30 °C. ABCbulletHRP was prepared according to the manufacturer's instructions. The filters were then washed twice, 10 min each, in TBS/Ca/Mg at room temperature. The positive plaques were detected by immersing the filters, one at a time, in a freshly prepared substrate solution containing diaminobenzidine. The positive plaques appeared within 1-2 min in the substrate solution. The color reaction was stopped by transferring the filters into distilled water. Putative positive plaques were plaque-purified by three additional rounds of screening. The cDNA inserts from ZipLox phage were excised in vivo in a plasmid (pZL1) form by infecting E. coli DH10B(ZIP) with phage recombinants.

Confirmation of Positive Clones with S-Labeled Calmodulin

The positive clones were confirmed for calmodulin binding activity with S-labeled calmodulin (18 nM) in the presence and absence of calcium. E. coli UT481 containing the calmodulin gene in an expression vector (pVUCH-1) was used to label calmodulin with [S]methionine(52) . S-Labeled calmodulin was prepared essentially as described earlier(50) . A known calmodulin-binding protein, a partial cDNA (ICM-1) for calcium/calmodulin-dependent protein kinase from mouse, was used as a positive control(53) .

Isolation of a Full-length cDNA

Poly(A) mRNA from hypocotyls of 3-day-old seedlings was used to synthesize cDNA using oligo(dT) as a primer. Three- to six-kb cDNAs were selected and cloned into a ZapII vector (Stratagene)(54) . This size-selected cDNA library was screened with a radiolabeled partial (1.4 kb) cDNA as a probe according to standard procedures(51) . Six positive clones were isolated after three rounds of screening. The cDNA inserts from phage recombinants were excised in vivo in plasmid (pBluescript) form according to the instructions provided by Stratagene. Based on restriction mapping and sequencing of the ends of the cDNA inserts, it was found that all the isolated clones are derived from the same gene. The longest cDNAs were used for further analysis.

DNA Sequencing and Sequence Analysis

Both strands of cDNAs were sequenced by dideoxynucleotide chain termination using double-stranded DNA. DNA and protein sequences were assembled using MacVector and Sequencher programs from International Biotechnologies, Inc. Sequences were analyzed using BLAST, Macstripe, MacPattern, and PESTFIND programs. BLAST searches were performed at National Center for Biotechnology Information E-mail server. Macstripe program was provided by Andrei Lupas, Princeton University, and PESTFIND software was obtained from Martin Rechsteiner, University of Utah.

Expression of Truncated cDNAs in E. coli

All the fusion proteins were expressed in E. coli BL21 (DE3) using pET28b expression vector. A 1.4-kb cDNA insert containing the coding region for 402 amino acids in the carboxyl-terminal region was isolated from one of the partial cDNAs with SalI and NotI, and cloned in-frame into pET28 vector. The construct with 1.0-kb region (SalI-PvuI fragment) containing the motor domain without the last 52 amino acid residues in the carboxyl-terminal region was generated by digesting pET28 containing a 1.4-kb insert with NotI followed by partial digestion with PvuI to eliminate the 0.4-kb fragment. The digested DNA was electrophoresed on an agarose gel. The fragment lacking the 0.4-kb region was isolated, the PvuI/NotI ends were filled with T4 DNA polymerase, ligated, and used for transformation. The 0.4-kb region of the cDNA was amplified with sense (GATCGTGAATGATCCCAGCAAAC) and antisense (GAGACATATAGGACTACTCTTCG) primers that contained restriction sites for EcoRI and HindIII, respectively, and cloned in-frame in a pET-28b vector. All the constructs were introduced into E. coli BL21 (DE3) strain, grown to 0.6 OD in LB medium containing kanamycin (30 µg/ml). Then the fusion protein was induced by adding IPTG to a final concentration of 1 mM and growing the culture for 2 h. Soluble and insoluble protein fractions from uninduced and induced cultures were isolated by incubating the pelleted bacterial cells in 0.1 of the culture volume in lysis buffer (50 mM Tris-HCl, pH 8.0, 2 mM EDTA, 0.1 mg/ml lysozyme, and 0.1% (v/v) Triton) for 15 min at 30 °C. The mixture was then placed on ice and sonicated three times, 10 s each, using a Virsonic digital 475 ultrasonic cell disrupter (Virtis, NY). The extract was centrifuged at 12,000 times g for 15 min to obtain soluble (supernatant) and insoluble (pellet) protein fractions.

Calmodulin Binding to Fusion Proteins

Fusion proteins were separated on 12% SDS-polyacrylamide gels, transblotted onto a nitrocellulose membrane using Bio-Rad transfer cell, and then blocked for 2 h in 3% gelatin in TBS/Ca/Mg (50 mM Tris-HCl, pH 7.5, 50 mM MgCl(2), 200 mM NaCl, and 0.5 mM CaCl(2)). The blots were washed three times, 10 min each, with TBS/Ca/Mg plus 0.05% Tween-20 and then incubated for 2 h in 60 nM of biotinylated calmodulin in TBS/Ca/Mg containing 0.05% Tween and 1% gelatin. The blots were then washed as above and incubated with Vectastain ABCbulletHRP in TBS/Ca/Mg, 0.1% Tween-20 for 30 min. All incubations were performed at 30 °C. The membranes were then washed twice for 10 min each in TBS/Ca/Mg, and the calmodulin binding proteins were detected colorimetrically by immersing the filter in a substrate solution (0.8 mg/ml diaminobenzidine, 0.4 mg/ml NiCl(2) and 0.009% H(2)O(2) in 100 mM Tris-HCl, pH 7.5).

Calmodulin Binding to Synthetic Peptide

A peptide (ISSKEMVRLKKLVAYWKEOAGKK) that corresponds to a stretch of 23 amino acids in the COOH terminus of a kinesin-like calmodulin-binding protein (KCBP) was synthesized in the Macromolecular Resource facility at Colorado State University. This region was selected as it contained features that are typical of calmodulin binding domains. The interaction of calmodulin with the synthetic peptide was analyzed using electrophoretic mobility shift of calmodulin in the presence of synthetic peptide(55) . Calmodulin (166 or 221 pmol) was incubated with increasing concentrations of synthetic peptide (16-282 pmol) in the presence of 4 M urea, 100 mM Tris-HCl, pH 8.0, and CaCl(2) or EGTA at room temperature for 1 h in a total volume of 20 µl. One-half volume of 3 times sample buffer (0.375 M Tris-HCl. pH 6.8, 30% glycerol, and 0.023% bromphenol blue) (56) was added to the samples and electrophoresed in 12% polyacrylamide gels containing 4 M urea, 0.375 M Tris, pH 8.8, and either CaCl(2) or EGTA as described by Erickson-Vitanen and DeGrado(55) . The gels were run at a constant voltage of 25 V/gel in an electrode buffer consisting of 25 mM Tris-HCl, pH 8.3, 192 mM glycine, and either CaCl(2) or EGTA. Gels were stained with 0.25% Coomassie Blue R-250 in 7.5% acetic acid and 50% methanol for 1 h, and then destained with 30% methanol and 7% acetic acid.

Fluorescence spectra of free and calmodulin-bound synthetic peptide was recorded with a Hitachi F-3010/4010 spectrofluorometer. The concentration of peptide and calmodulin were 166 pmol in a buffer containing 5 mM Tris-HCl, pH 7.3, 0.5 mM CaCl(2). The excitation wavelength was 290 nm and the bandwidth for excitation and emission was 5 nm. Corrections were made for the protein and solvent blanks.

Calmodulin-Sepharose Column Chromatography

Calmodulin Sepharose-4B column was prepared and equilibrated according to the instructions provided by Pharmacia Biotech Inc. The inclusion bodies containing the fusion protein from the 1.4-kb cDNA were dissolved in 6 M urea, diluted with binding buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, and 2 mM CaCl(2)) to reduce the concentration of urea to 0.625 M, and loaded onto the column. The unbound protein was washed with binding buffer, and the bound protein was eluted with binding buffer except that CaCl(2) was replaced with 2 mM EGTA.

Southern and Northern Blot Analysis

Five µg of genomic DNA were digested with different restriction enzymes, electrophoresed in 1.0% agarose gel, and transferred onto a Hybond N nylon membrane. The DNA was fixed to the membrane by UV cross-linking. The blot was hybridized to the radiolabeled 1.4-kb cDNA at 65 °C and washed under high stringency conditions(51) . Total RNA was isolated by homogenizing the tissue in guanidinium thiocyanate and pelleting the RNA through a cesium chloride cushion(51) . The RNA was separated on 1.2% agarose containing formaldehyde and blotted onto a nylon membrane. The RNA blots were prehybridized and hybridized as above using the same probe. RNA blots were tested for equal loading by probing the same blot with ubiquitin cDNA.


RESULTS

Isolation of a Kinesin Heavy Chain-like Calmodulin-binding Protein

We used a protein-protein interaction based screening to isolate cDNAs encoding calmodulin-binding proteins. A cDNA library from A. thaliana (L.) Heynh. ecotype Columbia prepared in ZipLox expression vector was screened with biotinylated calmodulin(50) . Screening of about 8 times 10^5 recombinants yielded several clones coding for putative calmodulin-binding proteins. Rescreening of the isolated clones by excluding the incubation step with biotinylated calmodulin did not yield any positive signals, suggesting that the isolated clones are not false positives due to interaction of ABCbulletHRP with biotin-containing proteins. Several cDNAs that ranged in size from 0.8 to 1.4 kb were grouped into four classes based on the size of the insert. To further confirm that the isolated clones code for calmodulin-binding protein, we tested the binding of the fusion protein to S-labeled calmodulin (50, 52) . All of the clones showed binding to S-labeled calmodulin only in the presence of calcium but not in the presence of EGTA, a calcium chelator (Fig. 1). We have sequenced one clone from each size group and found that all of them are identical except that they differ in length. Since the size of the transcript that hybridized to the isolated clones was found to be about 4 kb (see below, Fig. 9), a size-selected cDNA library was screened using the longest cDNA (1.4 kb) isolated by biotinylated calmodulin. A clone containing the longest cDNA was completely sequenced.


Figure 1: Calcium-dependent binding of the fusion protein from isolated clones to S-labeled calmodulin. Left, line diagram showing the length of the different cDNAs that are used for binding studies. Open bars represent the coding region in the cDNA and solid lines represent 3` untranslated region. Right, plaque purified recombinants isolated using biotinylated calmodulin as a probe and a positive control (ICM-1), which encodes a calmodulin-binding protein from mouse (53) were probed with S-labeled calmodulin(50) . Recombinant phages were plated with appropriate bacteria and incubated at 42 °C for 3 h. The fusion protein was induced by applying an IPTG-soaked nitrocellulose filter. The filter containing the fusion protein was incubated with the binding buffer containing 18 nMS-labeled calmodulin and 1 mM calcium chloride for overnight(50) . One-half of each filter was then washed with binding buffer containing 1 mM CaCl(2) (1) and the other half with binding buffer containing 5 mM EGTA (2). The filters were dried and exposed to x-ray film.




Figure 9: Expression of KCBP in different tissues and suspension culture. Total RNA (80 µg) was electrophoresed on a formaldehyde-containing agarose gel, transferred to a Hybond N membrane and sequentially hybridized with P-labeled KCBP cDNA (a 1.4-kb fragment) (A) and ubiquitin cDNA (B). C, ethidium bromide-stained gel. Lane 1, flowers; lane 2, leaves; lane 3, roots; lane 4, suspension of cultured cells. Numbers at left indicate the size of the RNA markers in kilobase pairs for blot A.



Structural Analysis of the KCBP

Complete nucleotide and deduced amino acid sequence of a full-length KCBP is shown in Fig. 2. The full-length cDNA is 4019 bp long with an open reading frame starting at nucleotide position 50 and ending with a termination codon at nucleotide 3829. The size of the cDNA is in agreement with the estimated size of the transcript on Northern blot analyses. The nucleotides surrounding the initiator codon agree with Kozak's (57) consensus. The predicted protein has 1261 amino acid residues with an estimated molecular weight of about 143,000. A search of sequence data bases with the predicted amino acid sequence using BLAST searches has revealed that an about 340-amino acid-long region in the COOH terminus is highly similar to kinesin heavy chain motor domain and contained all conserved motifs present in the motor domain of the heavy chain of known kinesins and kinesin-like proteins. The Arabidopsis calmodulin-binding protein showed highest sequence similarity with the motor domain of a recently reported kinesin homolog (KHP1) from Chlamydomonas(58) . Because of the similarity of this calmodulin-binding protein with kinesins, we have designated this protein as KCBP. Fig. 3shows the alignment of the deduced amino acid sequence of the putative motor domain of KCBP (860-1261 amino acids) with the amino acid sequence of the motor domain of kinesin-like proteins from Chlamydomonas (KHP1), yeast (Kar3), Arabidopsis (Kata), and Drosophila (Clar). The amino acid sequence of the KCBP motor domain showed about 40-42% identity and 60-64% similarity with the motor domain of kinesin-like proteins. The KCBP motor domain contained the conserved ATP-binding consensus sequence as well as four highly conserved peptide motifs of the kinesin heavy chain motor domain that are implicated in microtubule binding(39) .


Figure 2: Nucleotide and deduced amino acid sequences of KCBP. The amino acid sequence is presented below the nucleotide sequence. Numbers at right correspond to nucleotides and deduced amino acids. The underscored bases surrounding the translation initiation codon represent the Kozak's (57) consensus nucleotides. Amino acid sequences in bold denote putative PEST sequences(60) . The underscored amino acids (623-641, 755-774, and 774-793) represent potential nuclear localization signals. Bold and underscored amino acid sequence corresponds to a synthetic peptide that binds calmodulin.




Figure 3: Alignment of predicted amino acid sequences (1) of KCBP of Arabidopsis(79) with the motor domain of kinesin-like proteins from Chlamydomonas (KHP1) (58) , Saccharomyces cerevisiae (kar3)(80) , Arabidopsis (Kata)(47) , and Drosophila ncd (Clar)(81) . The conserved ATP binding site is shown with asterisks. Four highly conserved sequences in the microtubule binding region are underlined. Dashes indicate amino acid residues that are identical to KCBP. Upper case letters denote aligned nonidentical amino acids, and lower case letters denote unaligned amino acids. Gaps in alignment are denoted by dots. The amino acid sequence that showed calcium dependent binding to calmodulin is boxed.



In the region outside the motor domain, KCBP showed no significant sequence similarity with other kinesin heavy chains or heavy chain-like proteins. Analysis of the sequence amino-terminal to motor domain indicates that it is likely to be composed of two domains. First, amino acids from 610 to 890 form an alpha-helix (Fig. 4A). Analysis of the predicted amino acid sequence using a computer program that predicts coiled-coil structure (59) has revealed that a region (from amino acid residues 610 to 890) has extremely high probability to form coiled-coil structure (Fig. 4B). The presence of the coiled-coil region implies that the native KCBP may form a dimer. The second domain is a globular domain that extends from the beginning of the protein to the coiled coil region. This region showed some sequence similarity with myosins. It has been shown that ``PEST'' motifs that are rich in proline, glutamate, serine, and threonine are usually associated with proteins that have a short half-life(60, 61) . Using PESTFIND program, we found two potential PEST sequences in the amino-terminal region (residues 5-70, 334-350 with PESTFIND scores of +1 and +4, respectively) of KCBP (Fig. 4C). Hence, it is likely that the KCBP is a rapidly turned over protein. Proteins that move into the nucleus contain nuclear targeting sequences such as a bipartite signal motif in which two regions of basic amino acids are separated by a spacer of 10 or more amino acids(62) . The deduced amino acid sequence of KCBP has three likely bipartite signal motifs (623-641, 755-774, and 774-793), suggesting that it may be a nuclear protein (Fig. 2).


Figure 4: Predicted structural features of KCBP based on primary sequence. A, the secondary structure of KCBP as predicted by Robson-Garnier and Chou-Fasman methods. Regions predicted to be alpha helices (Hlx), beta sheets (Sht), or beta turns (Trn) are indicated by solid boxes. B, location of putative coiled-coil region in KCBP. The probability that each residue of KCBP will participate in a coiled-coil region is calculated according to Lupas et al.(59) and represented in a bar graph. C, schematic diagram of predicted protein of KCBP showing different structural features.



Localization of Calmodulin Binding Domain

The protein encoded by the shortest cDNA (0.8 kb) binds to calmodulin, suggesting that the calmodulin binding domain is located within the carboxyl-terminal region (Fig. 1). In many calmodulin target proteins in animals, the calmodulin binding domain has been shown to reside in a stretch of 18-20 amino acid residues. Although the amino acid sequence in the calmodulin binding domain in different target proteins is not conserved, the binding region is predicted to form a basic, amphiphilic alpha-helix in which hydrophobic residues are segregated from hydrophilic residues along the helix(16) . In addition, studies using synthetic peptides confirmed the speculation that calmodulin recognizes basic amphiphilic peptides(16) . Analysis of the deduced amino acid sequence from the 0.8-kb cDNA has shown that a stretch of amino acids from 1218 to 1255 in the carboxyl-terminal region forms alpha-helical structure. To test whether or not the calmodulin binding region is located in the carboxyl-terminal end, a 1.4-kb cDNA and two shorter cDNAs (1.0 and 0.4 kb) that code for truncated portions of the predicted protein were expressed in E. coli as His-Tag fusions using pET28, and the fusion proteins were analyzed for their ability to bind calmodulin (Fig. 5). The protein expressed from the 1.0-kb cDNA contains the motor domain of KCBP without a carboxyl-terminal end, whereas the 0.4-kb cDNA has the coding region for 52 amino acid residues in the carboxyl-terminal region that contains the putative calmodulin binding domain (Fig. 5). The soluble and insoluble protein fractions from uninduced and induced cultures were analyzed for fusion protein. Only the insoluble protein fraction from induced cultures showed the presence of fusion protein. Fig. 5B shows a Coomassie-stained gel of fusion protein from the three constructs. The size of the fusion protein corresponds to the predicted size of the protein from the gene fusions. The fusion protein from the three constructs was analyzed for calmodulin binding activity by probing the protein blots with biotinylated calmodulin. The fusion protein from the 1.4-kb cDNA (Fus.1) and from the 0.4-Kb cDNA (Fus.3) bound to calmodulin, whereas the fusion protein from 1.0-kb cDNA (Fus.2) which lacks the carboxyl-terminal region did not show any binding to calmodulin (Fig. 5C). As low as 100 ng of Fus.1 and Fus.3 proteins could be detected by biotinylated calmodulin (data not shown). These results confirm that the calmodulin binding domain is located in the 52-amino acid stretch in the carboxyl-terminal end of the protein and indicate the specificity of calmodulin binding. Within this region, a 14-amino acid stretch(1218-1231) is likely to be the calmodulin binding domain as it contains features of known calmodulin binding domains, including the presence of a large number of basic amino acid residues interspersed with hydrophobic residues and a basic amphiphilic structure(16) . The fusion protein from the 1.4-kb cDNA that was solubilized in urea bound to calmodulin-Sepharose also in a calcium-dependent manner and eluted with buffer containing EGTA (Fig. 5D), which further confirms calcium-dependent binding of the cDNA-encoded protein to calmodulin.


Figure 5: Localization of calmodulin binding domain using different fusion proteins. Fusion protein from the 1.4-kb cDNA (amino acids 860-1261, Fus.1), 1-kb (amino acids 860-1210, Fus.2), and 0.4-kb cDNA (amino acids 1210-1261, Fus.3) were tested for their ability to bind calmodulin. A, diagrammatic representation of the cDNA parts that were expressed in E. coli. Open bars represent the coding region in the cDNA and solid lines represent the 3`-untranslated region. B, Coomassie-stained SDS-polyacrylamide gel showing insoluble protein fraction from uninduced (U) and induced (I) cultures containing the fusion constructs. The arrowheads indicate the fusion protein. C, binding of calmodulin to fusion protein. Insoluble protein fractions from uninduced and induced cultures of the three constructs were electrophoresed as in B, transferred to a nitrocellulose membrane, and probed with 60 nM biotinylated calmodulin. Calmodulin binding to fusion protein was detected with Vectastain ABC-horseradish peroxidase as described by Fordham-Skelton et al.(50) . Calcineurin (P), a known calmodulin-binding protein, was used as a positive control. D, binding of the fusion protein from the 1.4-kb cDNA (Fus.1) to calmodulin-Sepharose. The E. coli expressed protein was solubilized and passed through a calmodulin-Sepharose column, and the bound fraction was eluted as described under ``Experimental Procedures.'' The eluted fraction was separated on duplicate denaturing gels. One gel (lane 1) was stained with Coomassie Blue, and the second gel was blotted onto a nitrocellulose membrane and probed with biotinylated calmodulin (lane 3) as described above. Lane 2 represents calcineurin probed with biotinylated calmodulin.



More than 34 kinesin heavy chain proteins have been characterized at the molecular and biochemical level from phylogenetically divergent organisms(41) . However, none of them was shown to be the target of calmodulin. Matthies et al.(63) tested bovine brain light and heavy chains of kinesin for their ability to bind calmodulin and found that the heavy chain does not bind to calmodulin, whereas the light chain showed calmodulin binding. These results raise the possibility that kinesin heavy chains that bind to calmodulin are unique to plants, or such proteins are yet to be discovered in animals. Recently, we have isolated a calmodulin-binding protein cDNA from developing potato tubers that showed significant sequence similarity with kinesin heavy chain motor domain. (^2)Furthermore, the calmodulin binding domain in Arabidopsis is highly conserved in potato kinesin-like calmodulin-binding protein, whereas this region is not present in any of the animal kinesin heavy chains or kinesin-like proteins. Hence, it is likely that calmodulin-binding proteins that share homology with the kinesin heavy chain motor domain are widely distributed in plants and are involved in kinesin heavy chain driven motor functions.

A Synthetic Peptide Corresponding to COOH Terminus Region of KCBP Binds to Calmodulin

Calmodulin-binding studies with fusion proteins have shown that calmodulin binding is located in a 52-amino acid stretch in the COOH terminus of KCBP. To further narrow down the region involved in calmodulin binding, a 23-amino acid long peptide (see Fig. 2) which contains typical features of calmodulin binding domains was synthesized and used for binding studies. As shown in Fig. 6, the synthetic peptide, like the Fus.3 protein, bound to calmodulin, indicating that this region is involved in calmodulin binding (Fig. 6). To test if the binding of peptide to calmodulin is calcium-dependent and to determine the stoichiometry of the calmodulin-peptide complex, we performed binding studies in solution using the synthetic peptide and calmodulin in the presence of calcium or EGTA. The binding of synthetic peptide to calmodulin was judged by gel mobility shift assay in polyacrylamide gels containing 4 M urea(55) . Urea dissociates low affinity and nonspecific complexes and allows high affinity complexes to remain. In the presence of 1 mM calcium, synthetic peptide retarded the mobility of calmodulin, indicating the formation of a complex between the peptide and calmodulin (Fig. 7A). No change in calmodulin mobility was observed in the presence of EGTA (Fig. 7B), suggesting the requirement of calcium to form a calmodulin-peptide complex. At a molar ratio of 1:1 about 50% of calmodulin showed a mobility shift (Fig. 7A, lane 2). At a molar ratio of 2:1 (peptide:calmodulin) all of the calmodulin migrated as a complex, and the band corresponding to free calmodulin disappeared (Fig. 7A, lane 3), indicating that the approximate stoichiometry of peptide to calmodulin is 2:1. A further increase in peptide concentration did not affect the mobility of calmodulin (Fig. 7A, lane 4). Similar results were reported with other calmodulin-binding peptides and calcium/calmodulin-regulated enzymes from animals(55, 64, 65, 66) . Furthermore, gel mobility shift assays suggest that the peptide binds to calmodulin with very high affinity and forms a tight complex that is not dissociated, even in the presence of 4 M urea. The peptides that bind to calmodulin with a dissociation constant of less than 100 nM can remain as a stable complex with calmodulin only in the presence of 4 M urea(55) . To test if the binding of peptide to calmodulin occurs at physiological levels of calcium, binding studies were performed in the presence of 1 µM calcium. As shown in Fig. 7C, the mobility of calmodulin was retarded in the presence of synthetic peptide and 1 µM calcium chloride, suggesting that the binding of the peptide to calmodulin occurs at physiological calcium concentration.


Figure 6: Binding of a 23-amino acid-long synthetic peptide (amino acids corresponding to 1218-1240) to calmodulin. A, One hundred ng (lane 1), 500 ng (lane 2), and 1 µg (lane 3) of the 0.4-kb fusion protein (T), synthetic peptide (M), or bovine serum albumin (B) was applied to a nitrocellulose membrane and probed with biotinylated calmodulin. B, predicted alpha-helical wheel diagram of amino acids 1218-1231. Positively charged and negatively charged amino acids are denoted with + and - superscripts, respectively. Hydrophobic amino acids are circled.




Figure 7: Analysis of calmodulin binding to a synthetic peptide by electrophoretic mobility shift in polyacrylamide gel containing 4 M urea. A and B, calmodulin (221 pmol) was incubated with increasing concentrations of synthetic peptide in the presence of 4 M urea, 100 mM Tris-HCl, pH 8.0, and 1 mM CaCl(2) (A) or 5 mM EGTA (B), and the reaction mixtures were analyzed on urea containing gels. Lane 1, calmodulin alone; lane 2, calmodulin plus synthetic peptide (1:1); lane 3, calmodulin plus synthetic peptide (1:2); lane 4, calmodulin plus synthetic peptide (1:3). Numbers in parentheses indicate calmodulin to peptide molar ratios. C and D, calmodulin (166 pmol) was incubated with increasing concentrations of synthetic peptide as above in the presence of either 1 µM CaCl(2) (C) or 5 mM EGTA (D) and analyzed on urea containing gels. Lane 1, calmodulin alone; lanes 2-8, different molar ratios of synthetic peptide to calmodulin; lane 2, 0.1:1; lane 3, 0.2:1; lane 4, 0.4:1; lane 5, 0.6:1; lane 6, 0.8:1; lane 7, 1:1; lane 8, 2:1.



The binding of a peptide to calmodulin can also be monitored by fluorescence spectroscopy if the peptide contains a tryptophan residue which is not present in calmodulin. The binding of a tryptophan-containing peptide to calmodulin has been shown to shift the fluorescence spectrum and often change the intensity of fluorescence (55, 67, 68, 69) . Since the synthetic peptide used in our studies contains a tryptophan residue, we tested if the fluorescence properties are altered in the presence of calmodulin. As shown in Fig. 8, the synthetic peptide showed a shift in fluorescence spectra and an increase in the fluorescence intensity in the presence of calmodulin. The wavelength of the emission maximum decreased from 342 to 330 nm.


Figure 8: Fluorescence emission spectrum of synthetic peptide in the presence(- - - - -) or absence (-) of calmodulin. The concentration of peptide and calmodulin was 166 pmol in a buffer containing 5 mM Tris-HCl, pH 7.3, 0.5 mM CaCl(2). The excitation wavelength was 290 nm, and the bandwidth for excitation and emission was 5 nm.



Expression of KCBP

To determine the size of the transcript and the expression of KCBP, RNA from flowers, leaves, roots, and suspension cultures was probed with the largest cDNA. A single transcript of about 4 kb was found to hybridize with the cDNA (Fig. 9). Although the gene is expressed in all the tissues tested, flowers had the highest level of expression. These results were further confirmed by reverse transcription-PCR using the primers that amplify a unique 3` region of the gene and a constitutively expressed gene (data not shown).

KCBP Is Coded by a Single Gene

Southern analysis revealed a single hybridizing band with different restriction enzyme digestions, indicating that KCBP is encoded by a single gene (Fig. 10). Low stringency washes did not yield any additional bands, suggesting that the KCBP gene does not cross hybridize with other kinesin-like genes from Arabidopsis. Consistent with this finding, comparison of the nucleotide sequence of the KCBP gene with three kinesin-like genes that are recently isolated from Arabidopsis does not show significant sequence identity (48) . Furthermore, recently published kinesin heavy chains from Arabidopsis are smaller in size and lack carboxyl-terminal extension that we determined to be a calmodulin binding domain in KCBP. These results suggest that the KCBP is a new member of the kinesin-like proteins.


Figure 10: Southern blot analysis of genomic DNA. Five µg of genomic DNA were digested with different restriction enzymes: B, BamHI; E, EcoRI; H, HindIII; E-H, EcoRI and HindIII; E-B, EcoRI and BamHI; H-B, HindIII and BamHI. The digested DNA was electrophoresed through a 0.8% agarose gel, transferred onto a Hybond N membrane, and probed with P-labeled, 1.4-kb cDNA which contains the coding region for the motor domain and the calmodulin binding domain. Molecular mass markers are shown on the left in kilobase pairs.




DISCUSSION

We isolated a full-length cDNA encoding a calmodulin-binding protein (KCBP) using a protein-protein interaction-based screening. Several approaches have been used to demonstrate that the cDNA-encoded protein binds to calmodulin with high affinity in a calcium-dependent manner. Studies with S-labeled and biotinylated calmodulin show that KCBP binds to calmodulin in a calcium-dependent manner ( Fig. 1and Fig. 5). This was further confirmed by calmodulin column chromatography (Fig. 5). Calmodulin-binding studies with truncated proteins and a synthetic peptide have shown that the calmodulin binding domain is located in the carboxyl-terminal end next to the motor domain. Binding of calmodulin to synthetic peptide in solution and analysis of calmodulin-peptide complex by mobility shift assay on urea containing gels indicate that the peptide has high affinity to calmodulin (Fig. 7). The binding of synthetic peptide to calmodulin occurred at 1 µM calcium (Fig. 7C). We used 59 nM of biotinylated calmodulin for screening the libraries and 18 nM for S-labeled calmodulin to confirm the isolated clones. This concentration of calmodulin is well within the physiological levels of calmodulin in plant cells(70) . Furthermore, the concentration of calmodulin used in our studies is similar or lower as compared to other calmodulin-binding studies(22, 24, 25, 71, 72, 73) . The fact that the screening of about 800,000 plaques resulted in isolation of only two different cDNAs also suggests the specificity of the probe. These results clearly show that the binding of KCBP to calmodulin occurs at physiological levels of calmodulin and calcium and raise an interesting possibility that calcium and calmodulin may be involved in regulating the function of KCBP.

The sequence similarity between the motor domain of kinesin heavy chain and KCBP suggests that the KCBP is a member of the kinesin superfamily of proteins. Structural analysis indicates that it, like most other kinesins and kinesin-like proteins, contains a coiled-coil region and a globular tail. However, the KCBP is a new member of kinesin-like proteins since none of the known kinesin heavy chains contains a calmodulin binding domain. Several lines of evidence suggest that the presence of a motor domain and a calmodulin binding domain on the isolated clone is not due to cloning artifact, but is derived from a single gene. Polymerase chain reaction amplification of first strand cDNA with one primer corresponding to the motor domain and the other primer to the calmodulin binding domain produced a single amplified product of expected size (data not shown). Southern blotting with a cDNA probe containing the coding region for both motor and calmodulin binding domains showed a single band (Fig. 10). We isolated genomic clones in which motor and calmodulin binding domains are contiguous. (^3)Screening of two different cDNA libraries has yielded the cDNAs that are identical and contained both the kinesin motor domain and calmodulin binding domain. Finally, a homolog of KCBP has been isolated from potato, which, like KCBP, contains both motor and calmodulin binding domains.^3

Phylogenetic analysis of motor regions of all the known kinesins indicates that they fall into five distinct groups that are likely to play different roles in basic cellular processes(41) . Only one of these five groups contains the motor region in the carboxyl-terminal region, whereas the remaining four have their motor regions located in the amino-terminal regions(41) . All of the kinesins that have motor domain in the amino-terminal region perform plus end-directed movement along microtubules, whereas the kinesins with the motor domain in the carboxyl-terminal end perform minus end-directed movement(41, 74, 75) . The presence of the motor domain in the carboxyl-terminal end of the KCBP suggests that it may be involved in minus end-directed translocation processes. In vitro motility assays with purified E. coli-expressed protein should help determine its motor activity as well as the direction of translocation.

Three cDNAs (KatA, KatB, and KatC) encoding kinesin-like proteins have been isolated from Arabidopsis(47, 48) . The predicted amino acid sequence from these cDNAs is less than 800 amino acids, and the COOH-terminal half of the protein showed strong sequence similarity to the motor domain of kinesins and kinesin-like proteins. So far, these are the only kinesin-like proteins that have been characterized from plants. The cDNA that we isolated from Arabidopsis encodes a much longer protein (KCBP, 1261 amino acids) and contains a calmodulin binding region that is absent in KatA, KatB, and KatC, suggesting that the KCBP is distinct from the previously reported kinesin-like proteins from the same system. Virtually nothing is known about the kinesin-driven motor functions in plants. A number of events during cell division in plants involve movement of a variety of subcellular structures. These include reorientation of microtubules, distribution of chromosomes, and targeted deposition of vesicles containing the cell wall material during cytokinesis(76) . Calcium and calmodulin are implicated in some of these aspects of cell division that involve subcellular movement. The high level of calmodulin in meristematic tissues and growing regions of plants (8, 9, 19) suggests its involvement in some events in cell division. Furthermore, immunofluorescence and immunogold staining studies have shown that calmodulin is localized to mitotic apparatus, especially microtubule converging centers and kinetochore microtubules (12) . The distribution of calcium is also found to be the same as that of calmodulin(12) . Based on these results it was suggested that calcium and calmodulin are involved in chromosome movement. Movement of vesicles during phragmoplast formation, a process unique to plants, may also be carried out by calcium-regulated microtubule motor proteins, since calcium and microtubules are implicated in the transport of vesicles to the cell plate during cytokinesis in plants(77, 78) . It is likely that microtubule motor proteins such as kinesins that are regulated by calcium and calmodulin are involved in the movement of subcellular structures in plants. The finding that KCBP, a putative microtubule motor protein, is a calmodulin-binding protein and is highly expressed in dividing cells suggests that it may be involved in the movement of subcellular structures that is regulated by calcium and calmodulin. In summary, we have isolated a novel gene encoding a calmodulin-binding protein that has significant sequence similarity with the motor-domain of kinesin heavy chain and kinesin heavy chain-like proteins. The presence of a calmodulin binding domain and a motor domain in KCBP suggests a role for calcium and calmodulin in at least some of the microtubule-based motor functions. The availability of the KCBP cDNA will allow us to express the protein to study its motor activity and the role of calcium and calmodulin in kinesin driven motor functions.


FOOTNOTES

*
This work was supported by a grant from the Colorado Agricultural Experiment Station (Project No. 702) (to A. S. N. R.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. The nucleotide sequence(s) reported in this paper has been submitted to the GenBank(TM)/EMBL Data Bank with accession number(s) L40358 [GenBank]

§
To whom correspondence should be addressed. Tel.: 970-491-5773; Fax: 970-491-0649; reddy{at}lamar.colostate.edu.

(^1)
The abbreviations used are: IPTG, isopropyl-1-thio-beta-D-galactopyranoside; ABCbulletHRP, avidin DH-biotinylated horseradish peroxidase H complex; KCBP, kinesin-like calmodulin-binding protein; kb, kilobase pair(s).

(^2)
A. S. N. Reddy, S. B. Narasimhulu, F. Safadi, and M. Golovkin, unpublished data.

(^3)
A. S. N. Reddy, S. B. Narasimhulu, F. Safadi, and M. Golovkin, unpublished results.


ACKNOWLEDGEMENTS

We thank D. M. Watterson, Vanderbilt University, Nashville, TN, for the pVUCH-1 clone; Andrei Lupas for providing a computer program to predict coiled coils from protein sequences; Martin Rechsteiner and Keith Johnson for the PESTFIND program; the Arabidopsis Biological Resource Center at Ohio State University for providing the cDNA libraries; Robert Wells and John Wadell for their help in fluorescence spectroscopy measurements; Joan Herbers for allowing us to use the scanner; and P. Bedinger, S. Stack, D. Mykles, T. Wilson, B. Reeves, W. Wright, I. Day, and Jonathan Bowser for critical reading of the manuscript. Comparison of the nucleotide and protein sequence with sequences in the data bases was performed at National Center for Biotechnology Information using the BLAST network service.


REFERENCES

  1. Roberts, D. M., and Harmon, A. (1992) Annu. Rev. Plant Physiol. Plant Mol. Biol. 43, 375-414 [CrossRef]
  2. Poovaiah, B. W., and Reddy, A. S. N. (1993) CRC Crit. Rev. Plant Sci. 12, 185-211 [Medline] [Order article via Infotrieve]
  3. Gilroy, S., and Trewavas, T. (1994) BioEssays. 16, 677-682 [CrossRef]
  4. Bowler, C., and Chua, N.-H. (1994) Plant Cell 6, 1529-1541 [CrossRef][Medline] [Order article via Infotrieve]
  5. Roberts, D. M., Lukas, T. J., and Watterson, D. M. (1986) CRC Crit. Rev. Plant Sci. 4, 311-339
  6. Jena, P. K., Reddy, A. S. N., and Poovaiah, B. W. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 3644-3649 [Abstract/Free Full Text]
  7. Braam, J., and Davis, R. W. (1990) Cell 60, 357-364 [CrossRef][Medline] [Order article via Infotrieve]
  8. Muto, S., and Miyachi, S. (1984) Z. Pflanzenphysiol. 114, 421-431
  9. Allan, E., and Trewavas, A. J. (1985) Plant Physiol. 165, 493-501
  10. Dauwalder, M., Roux, S. J., and Hardison, L. (1986) Planta 168, 461-470 [CrossRef][Medline] [Order article via Infotrieve]
  11. Perera, I. Y., and Zielinski, E. (1992) Plant Mol. Biol. 19, 649-664 [CrossRef][Medline] [Order article via Infotrieve]
  12. Vantard, M., Lambert, A. M., Mey, J. D., Picquot, P., and Van Eldik, L. J. (1985) J. Cell Biol. 101, 488-499 [Abstract/Free Full Text]
  13. Wick, S. M., Muto, S., and Duniec, J. (1985) Protoplasma 126, 198-206 [CrossRef]
  14. Stinemetz, C. L., Kuzmanoff, K. M., Evans, M. L., and Jarrett, H. W. (1987) Plant Physiol. 84, 1337-1342 [Abstract/Free Full Text]
  15. Cyr, R. J. (1991) J. Cell Sci. 100, 311-317 [Abstract/Free Full Text]
  16. O'Neil, K. T., and DeGrado, W. F. (1990) Trends Biochem. Sci. 15, 59-64 [CrossRef][Medline] [Order article via Infotrieve]
  17. Corneliussen, B., Holm, M., Waltersson, Y., Onions, J., Hallberg, B., Thornell, A., and Grundstrom, T. (1994) Nature 368, 760-764 [CrossRef][Medline] [Order article via Infotrieve]
  18. Ling, V., and Assmann, S. M. (1992) Plant Physiol. 100, 970-978 [Abstract/Free Full Text]
  19. Oh, S.-H., Steiner, H.-Y., Dougall, D. K., and Roberts, D. M. (1992) Arch. Biochem. Biophy. 297, 28-34 [CrossRef][Medline] [Order article via Infotrieve]
  20. Kobayashi, H., and Fukuda, H. (1994) Planta 194, 388-394
  21. Watillon, B., Kettmann, R., Boxus, P., and Burny, A. (1993) Plant Physiol. 101, 1381-1384 [Abstract]
  22. Baum, G., Chen, Y., Arazi, T., Takatsuji, H., and Fromm, H. (1993) J. Biol. Chem. 268, 19610-19617 [Abstract/Free Full Text]
  23. Bethke, P. C., and Jones, R. L. (1994) Plant Cell 6, 277-285 [Abstract]
  24. Ling, V., Snedden, W. A., Shelp, B. J., and Assmann, S. M. (1994) Plant Cell 6, 1135-1143 [Abstract]
  25. Durso, N. A., and Cyr, R. J. (1994) Plant Cell 6, 893-905 [Abstract]
  26. Patil, S., Takezawa, D., and Poovaiah, B. W. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 4897-4901 [Abstract/Free Full Text]
  27. Reddy, A. S. N., Takezawa, D., Fromm, H., and Poovaiah, B. W. (1993) Plant Sci. 94, 109-117 [CrossRef]
  28. Lu, Y., and Harrington, H. M. (1994) Plant Physiol. Biochem. 32, 413-422
  29. Pereira, A., and Goldstein, L. S. B. (1994) in Microtubules (Hyams, J. S., and Lloyd, C. W., eds) Vol. 13, pp. 269-284, Wiley-Liss, New York
  30. Bloom, G. S., and Endow, S. A. (1994) Protein Profile 1, 1059-1116 [Medline] [Order article via Infotrieve]
  31. Vallee, R. B., and Shpetner, H. S. (1990) Annu. Rev. Biochem. 59, 909-932 [CrossRef][Medline] [Order article via Infotrieve]
  32. Sawin, K. E., and Endow, S. A. (1993) BioEssays 15, 399-407 [CrossRef][Medline] [Order article via Infotrieve]
  33. Vernos, I., Raats, J., Hirano, T., Heasman, J., Karsenti, E., and Wylie, C. (1995) Cell 81, 117-127 [CrossRef][Medline] [Order article via Infotrieve]
  34. Vernos, I., and Karsenti, E. (1995) Trends Cell Biol. 5, 297-301 [CrossRef][Medline] [Order article via Infotrieve]
  35. Vale, R. D., Reese, T. S., and Sheetz, M. P. (1985) Cell 42, 39-50 [CrossRef][Medline] [Order article via Infotrieve]
  36. Vale, R. D., and Goldstein, L. S. B. (1990) Cell 60, 883-885 [CrossRef][Medline] [Order article via Infotrieve]
  37. Scholey, J. M., Heuser, J., Yang, J. T., and Goldstein, L. S. B. (1989) Nature 338, 355-357 [CrossRef][Medline] [Order article via Infotrieve]
  38. Yang, J. T., Saxton, W. M., Stewart, R. J., Raff, E. C., and Goldstein, L. S. B. (1990) Science 249, 42-47 [Abstract/Free Full Text]
  39. Yang, J. T., Laymon, R. A., and Goldstein, L. S. B. (1989) Cell 56, 879-889 [CrossRef][Medline] [Order article via Infotrieve]
  40. Hirokawa, N., Pfister, K., Yorifuji, H., Wagner, M., Brady, S., and Bloom, G. (1989) Cell 56, 867-878 [CrossRef][Medline] [Order article via Infotrieve]
  41. Goodson, H. V., Kang, S. J., and Endow, S. A. (1994) J. Cell Sci. 107, 1875-1884 [Abstract]
  42. Nangaku, M., Sato-Yoshitake, Y., Okada, Y., Noda, Y., Takemura, R., Yamazaki, H., and Hirokawa, N. (1994) Cell 79, 1209-1220 [CrossRef][Medline] [Order article via Infotrieve]
  43. Okada, Y., Yamazaki, H., Sekine-Aizawa, Y., and Hirokawa, N. (1995) Cell 81, 769-780 [CrossRef][Medline] [Order article via Infotrieve]
  44. Endow, S. A., Kang, S. J., Satterwhite, L. L., Rose, M. D., Skeen, V. P., and Salmon, E. D. (1994) EMBO J. 13, 2708-2713 [Medline] [Order article via Infotrieve]
  45. Noda, Y., Sato-Yoshitake, R., Knodo, S., Nangaku, M., and Hirokawa, N. (1995) J. Cell Biol. 129, 157-167 [Abstract/Free Full Text]
  46. Tiezzi, A., Moscatelli, A., Cai, G., Bartalesi, A. and Cresti, M. (1992) Cell Motil. Cytoskeleton 21, 132-137 [CrossRef][Medline] [Order article via Infotrieve]
  47. Mitsui, H., Yamaguchi-Shinozaki, K., Shinozaki, K., Nishikawa, K., and Takahashi, H. (1993) Mol. Gen. Genet. 238, 362-368 [CrossRef][Medline] [Order article via Infotrieve]
  48. Mitsui, H., Nakatani, K., Yamaguchi-Shinozaki, K., Shinozaki, K., Nishikawa, K., and Takahashi, H. (1994) Plant Mol. Biol. 25, 865-876 [CrossRef][Medline] [Order article via Infotrieve]
  49. Reddy, A. S. N., Safadi, F., Beyette, J., and Mykles, D. L. (1994) Biochem. Biophys. Res. Commun. 199, 1089-1095 [CrossRef][Medline] [Order article via Infotrieve]
  50. Fordham-Skelton, A. P., Safadi, F., Golovkin, M., and Reddy, A. S. N. (1994) Plant Mol. Biol. Reptr. 12, 355-363
  51. Sambrook, J., Fritsch, F. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  52. Lukas, T. J., Craig, T. A., Roberts, D. M., and Watterson, D. M. (1987) in Proceedings of the Fifth International Symposium on Calcium Binding Proteins in Health and Disease , (Norman, A. W., Vanaman, T. C., and Means, A. R., eds) pp. 533-543, Academic Press, New York
  53. Sikela, J. M., and Hahn, W. E. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 3038-3042 [Abstract/Free Full Text]
  54. Kieber, J. J., Rothenberg, M., Roman, G., Feldmann, K. A., and Ecker, J. R. (1993) Cell 72, 427-441 [CrossRef][Medline] [Order article via Infotrieve]
  55. Erickson-Vitanen, S., and DeGrado, W. F. (1987) Methods Enzymol. 139, 455-478 [Medline] [Order article via Infotrieve]
  56. Laemmli, U. K. (1970) Nature 227, 680-685 [CrossRef][Medline] [Order article via Infotrieve]
  57. Kozak, M. (1991) J. Biol. Chem. 266, 19867-19870 [Free Full Text]
  58. Walther, Z., Vashishtha, M., and Hall, J. L. (1994) J. Cell Biol. 126, 175-188 [Abstract/Free Full Text]
  59. Lupas, A., Van Dyke, M., and Stock, J. (1991) Science 252, 1162-1164 [Free Full Text]
  60. Rogers, S., Wells, R., and Rechsteiner, M. (1986) Science 234, 364-368 [Abstract/Free Full Text]
  61. Rechsteiner, M. (1990) Semin. Cell Biol. 1, 433-440 [Medline] [Order article via Infotrieve]
  62. Dingwall, C., and Laskey, R. A. (1991) Trends Biochem. Sci. 16, 478-481 [CrossRef][Medline] [Order article via Infotrieve]
  63. Matthies, H., Miller, R. J., and Palfrey, H. C. (1993) J. Biol. Chem. 268, 11176-11187 [Abstract/Free Full Text]
  64. Hanley, R. M., Means, A. R., Kemp, B. E., and Shenolikar, S. (1988) Biochem. Biophys. Res. Commun. 152, 122-128 [CrossRef][Medline] [Order article via Infotrieve]
  65. Dasgupta, M., Honeycutt, T., and Blumentahl, D. K. (1989) J. Biol. Chem. 264, 17156-17163 [Abstract/Free Full Text]
  66. Stevenson, M. A., and Calderwood, S. K. (1990) Mol. Cell. Biol. 10, 1234-1238 [Abstract/Free Full Text]
  67. Malencik, D. A., and Anderson, A. R. (1983) Biochem. Biophys. Res. Commun. 114, 50-56 [CrossRef][Medline] [Order article via Infotrieve]
  68. Malencik, D. A., and Anderson, A. R. (1984) Biochemistry 23, 2420-2428 [CrossRef][Medline] [Order article via Infotrieve]
  69. Lukas, T. J., Burgess, W. H., Prednergast, F. G., Lau, W., and Watterson, D. M. (1986) Biochemistry 25, 1458-1463 [CrossRef][Medline] [Order article via Infotrieve]
  70. Marm é , D., and Dieter, P. (1983) in Calcium and Cell Function (Cheung, W. Y., ed) Vol. IV, pp. 263-273, Academic Press, New York
  71. Stirling, D. A., Petrie, A., Pulford, D. J., Paterson, D. T. W., and Stark, M. J. R. (1992) Mol. Microbiol. 6, 703-713 [CrossRef][Medline] [Order article via Infotrieve]
  72. Walker, R. G., Hudspeth, A. J., and Gillespie, P. G. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 2807-2811 [Abstract/Free Full Text]
  73. Stirling, D. A., Welch, K. A., and Stark, M. J. R. (1994) EMBO J. 13, 4329-4342 [Medline] [Order article via Infotrieve]
  74. Walker, R. A., Salmon, E. D., and Endow, S. A. (1990) Nature 347, 780-782 [CrossRef][Medline] [Order article via Infotrieve]
  75. McDonald, H. B., Stewart, R. J., and Goldstein, L. S. B. (1990) Cell 63, 1159-1165 [CrossRef][Medline] [Order article via Infotrieve]
  76. Lloyd, C. W. (ed) (1991) The Cytoskeletal Basis of Plant Growth and Form , Academic Press, New York
  77. Seagull, R. W. (1989) CRC Crit. Rev. Plant Sci. 8, 131-167
  78. Goddard, R. H., Wick, S. M., Silflow, C. D., and Snustad, D. P. (1994) Plant Physiol. 104, 1-6 [Medline] [Order article via Infotrieve]
  79. Reddy, A. S. N., Safadi, F., Narasimhulu, S. B., Golovkin, M., and Hu, X (1995) in Proceedings of the 6th International Conference on Arabidopsis Research , p. 407
  80. Meluh, P. B., and Rose, M. D. (1990) Cell 60, 1029-1041 [CrossRef][Medline] [Order article via Infotrieve]
  81. Endow, S. A., Henikoff, S., and Soler-Niedziela, L. (1990) Nature 345, 81-83 [CrossRef][Medline] [Order article via Infotrieve]

©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
M. V. Vinogradova, G. G. Malanina, A. S. N. Reddy, and R. J. Fletterick
Structure of the complex of a mitotic kinesin with its calcium binding regulator
PNAS, May 19, 2009; 106(20): 8175 - 8179.
[Abstract] [Full Text] [PDF]


Home page
ANN BOT (LOND)Home page
L. Guo, C.-M. K. Ho, Z. Kong, Y.-R. J. Lee, Q. Qian, and B. Liu
Evaluating the microtubule cytoskeleton and its interacting proteins in monocots by mining the rice genome
Ann. Bot., February 1, 2009; 103(3): 387 - 402.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
X. Zhang, P. H. Grey, S. Krishnakumar, and D. G. Oppenheimer
The IRREGULAR TRICHOME BRANCH loci regulate trichome elongation in Arabidopsis
Plant Cell Physiol., September 1, 2005; 46(9): 1549 - 1560.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
S. E. Abdel-Ghany, I. S. Day, M. P. Simmons, P. Kugrens, and A. S.N. Reddy
Origin and Evolution of Kinesin-Like Calmodulin-Binding Protein
Plant Physiology, July 1, 2005; 138(3): 1711 - 1722.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
M. Oka, Y. Yanagawa, T. Asada, A. Yoneda, S. Hasezawa, T. Sato, and H. Nakagawa
Inhibition of Proteasome by MG-132 Treatment Causes Extra Phragmoplast Formation and Cortical Microtubule Disorganization during M/G1 Transition in Synchronized Tobacco Cells
Plant Cell Physiol., November 15, 2004; 45(11): 1623 - 1632.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Yang, S. Chaudhuri, L. Yang, Y. Chen, and B. W. Poovaiah
Calcium/Calmodulin Up-regulates a Cytoplasmic Receptor-like Kinase in Plants
J. Biol. Chem., October 8, 2004; 279(41): 42552 - 42559.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. V. Vinogradova, V. S. Reddy, A. S. N. Reddy, E. P. Sablin, and R. J. Fletterick
Crystal Structure of Kinesin Regulated by Ca2+-Calmodulin
J. Biol. Chem., May 28, 2004; 279(22): 23504 - 23509.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
V. S. Reddy, I. S. Day, T. Thomas, and A. S. N. Reddy
KIC, a Novel Ca2+ Binding Protein with One EF-Hand Motif, Interacts with a Microtubule Motor Protein and Regulates Trichome Morphogenesis
PLANT CELL, January 1, 2004; 16(1): 185 - 200.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. L. Preuss, D. P. Delmer, and B. Liu
The Cotton Kinesin-Like Calmodulin-Binding Protein Associates with Cortical Microtubules in Cotton Fibers
Plant Physiology, May 1, 2003; 132(1): 154 - 160.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
C. Chen, A. Marcus, W. Li, Y. Hu, J.-P. V. Calzada, U. Grossniklaus, R. J. Cyr, and H. Ma
The Arabidopsis ATK1 gene is required for spindle morphogenesis in male meiosis
Development, March 7, 2003; 129(10): 2401 - 2409.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. S. Reddy and A. S. N. Reddy
The Calmodulin-binding Domain from a Plant Kinesin Functions as a Modular Domain in Conferring Ca2+-Calmodulin Regulation to Animal Plus- and Minus-end Kinesins
J. Biol. Chem., December 6, 2002; 277(50): 48058 - 48065.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. S. Reddy, G. S. Ali, and A. S. N. Reddy
Genes Encoding Calmodulin-binding Proteins in the Arabidopsis Genome
J. Biol. Chem., March 15, 2002; 277(12): 9840 - 9852.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. S. N. Reddy, I. S. Day, S. B. Narasimhulu, F. Safadi, V. S. Reddy, M. Golovkin, and M. J. Harnly
Isolation and Characterization of a Novel Calmodulin-binding Protein from Potato
J. Biol. Chem., February 1, 2002; 277(6): 4206 - 4214.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Z. Yang, C.-h. Xia, E. A. Roberts, K. Bush, S. K. Nigam, and L. S. B. Goldstein
Molecular Cloning and Functional Analysis of Mouse C-Terminal Kinesin Motor KifC3
Mol. Cell. Biol., February 1, 2001; 21(3): 765 - 770.
[Abstract] [Full Text]


Home page
Plant CellHome page
J. W. Vos, F. Safadi, A. S. N. Reddy, and P. K. Hepler
The Kinesin-like Calmodulin Binding Protein Is Differentially Involved in Cell Division
PLANT CELL, June 1, 2000; 12(6): 979 - 990.
[Abstract] [Full Text]


Home page
Plant Physiol.Home page
E. Yokota, S. Muto, and T. Shimmen
Calcium-Calmodulin Suppresses the Filamentous Actin-Binding Activity of a 135-Kilodalton Actin-Bundling Protein Isolated from Lily Pollen Tubes
Plant Physiology, June 1, 2000; 123(2): 645 - 654.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
I. S. Day, C. Miller, M. Golovkin, and A. S. N. Reddy
Interaction of a Kinesin-like Calmodulin-binding Protein with a Protein Kinase
J. Biol. Chem., April 28, 2000; 275(18): 13737 - 13745.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
J. Mathur and N.-H. Chua
Microtubule Stabilization Leads to Growth Reorientation in Arabidopsis Trichomes
PLANT CELL, April 1, 2000; 12(4): 465 - 478.
[Abstract] [Full Text]


Home page
J. Cell Sci.Home page
J. Berg, B. Derfler, C. Pennisi, D. Corey, and R. Cheney
Myosin-X, a novel myosin with pleckstrin homology domains, associates with regions of dynamic actin
J. Cell Sci., January 10, 2000; 113(19): 3439 - 3451.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
M. Golovkin and A. S. N. Reddy
An SC35-like Protein and a Novel Serine/Arginine-rich Protein Interact with Arabidopsis U1-70K Protein
J. Biol. Chem., December 17, 1999; 274(51): 36428 - 36438.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. S. Reddy, F. Safadi, R. E. Zielinski, and A. S. N. Reddy
Interaction of a Kinesin-like Protein with Calmodulin Isoforms from Arabidopsis
J. Biol. Chem., October 29, 1999; 274(44): 31727 - 31733.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
S Krishnakumar and D. Oppenheimer
Extragenic suppressors of the arabidopsis zwi-3 mutation identify new genes that function in trichome branch formation and pollen tube growth
Development, January 6, 1999; 126(14): 3079 - 3088.
[Abstract] [PDF]


Home page
Plant CellHome page
M. Golovkin and A. S. N. Reddy
The Plant U1 Small Nuclear Ribonucleoprotein Particle 70K Protein Interacts with Two Novel Serine/Arginine –Rich Proteins
PLANT CELL, October 1, 1998; 10(10): 1637 - 1648.
[Abstract] [Full Text]


Home page
Plant CellHome page
S. B. Narasimhulu and A. S. N. Reddy
Characterization of Microtubule Binding Domains in the Arabidopsis Kinesin-like Calmodulin Binding Protein
PLANT CELL, June 1, 1998; 10(6): 957 - 966.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. C. Schuurink, S. F. Shartzer, A. Fath, and R. L. Jones
Characterization of a calmodulin-binding transporter from the plasma membrane of barley aleurone
PNAS, February 17, 1998; 95(4): 1944 - 1949.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. G. Oppenheimer, M. A. Pollock, J. Vacik, D. B. Szymanski, B. Ericson, K. Feldmann, and M. D. Marks
Essential role of a kinesin-like protein in Arabidopsis trichome morphogenesis
PNAS, June 10, 1997; 94(12): 6261 - 6266.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Song, M. Golovkin, A. S. N. Reddy, and S. A. Endow
In vitro motility of AtKCBP, a calmodulin-binding kinesin protein of Arabidopsis
PNAS, January 7, 1997; 94(1): 322 - 327.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Safadi, V. S. Reddy, and A. S. N. Reddy
A Pollen-specific Novel Calmodulin-binding Protein with Tetratricopeptide Repeats
J. Biol. Chem., November 3, 2000; 275(45): 35457 - 35470.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Kussel-Andermann, A. El-Amraoui, S. Safieddine, J.-P. Hardelin, S. Nouaille, J. Camonis, and C. Petit
Unconventional Myosin VIIA Is a Novel A-kinase-anchoring Protein
J. Biol. Chem., September 15, 2000; 275(38): 29654 - 29659.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reddy, A. S. N.
Right arrow Articles by Hu, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reddy, A. S. N.
Right arrow Articles by Hu, X.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1996 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement