Antibodies of the immunoglobulin (Ig)E isotype sensitize target cells expressing the class-specific Fc receptors for antigen-induced mediator release, by binding through residues located in the Fc portion of the molecule(1, 2) . The potent pharmacologically active substances that are released in response to this stimulus cause the clinical symptoms of allergy. Strategies that block the initial sensitization of target cells with antigen-specific IgE have been explored following the demonstration that human (h) ()myeloma IgE-derived Fc fragments generated by proteolytic cleavage with papain(1, 2) , which produces peptides comprising h-chain residues 1-226 and 227-547, can competitively inhibit the binding of IgE to cells expressing high affinity receptor (FcRI)(1, 2) , whereas cleavage products of pepsin digestion, which generates fragments spanning residues 1-338, 339-349, and 350-547 (3) do not inhibit binding. This observation initiated the quest for progressively smaller peptides as potential IgE antagonists (reviewed in (4) ). In early studies, the inhibition of passive cutaneous anaphylaxis in human skin was used to assess the FcRI-blocking activity of proteolytic fragments or recombinant IgE-derived peptides expressed in Escherichia coli(1, 5, 6) . This led to the proposal that sequences N- and C-terminal to Val contribute structures necessary for FcRI interaction(6) . More recent studies aimed at the identification of the receptor binding site(s) employed chimeric human/mouse IgE antibodies, / chimeras, site-specific mutagenesis, anti-IgE antibodies, or IgE-derived peptides(7, 8, 9, 10, 11, 12, 13, 14, 15) . They indicate that the site(s) in IgE that interact(s) with the Fc receptors depend(s) on structures associated with residues located in the C3 domain, although C4 involvement has also been invoked(11, 12) . Furthermore, it has been suggested that IgE/FcRI interaction is mediated primarily by electrostatic interactions (14) and dependent on the entire C3 in its native conformation(10) , while the C4 domains are essential for the maintenance of the active conformation of the C3 domain(7, 16) . Our earlier investigations showed that while IgE/FcRII interaction is critically dependent on C4 or its homologue C3(16) , it is possible to delete the entire C4 domain and more than 60% of residues in C3 and still maintain the FcRI-blocking capacity of the recombinant -chain fragment(6, 17) .

Based on our demonstration of the parallel nature of the inter--chain disulfide bonds in hIgE(18) , we developed a structural model that predicts that an exposed and probably flexible segment connects the globular portions of the C2 and C3 domains(18, 19) . Subsequently, Gould et al.(20, 21) claimed that the N-terminal 11 residues in C3, which are included in this segment, are essential for FcRI binding. This proposal relied on studies where the biological activity of recombinant -chain fragments was tested by blocking the binding of ragweed-specific IgE to mast cells in the skin of the senior investigator conducting the study(6) . When the fallibility of the passive cutaneous anaphylaxis reaction in assessing the biological activity of recombinant IgE-derived fragments emerged (17, 22) , we re-assessed the biological activity of these and additional truncated fragments using our recently developed receptor binding assay, which allowed us to study direct binding of IgE-derived ligands to rat (r) basophilic leukemia cells (RBL-2/2/C) transfected with the -chain of hFcRI(23) .

In the present investigation we describe the capacity of a series of overlapping N- and C-terminally truncated and chimeric /-chain derived fragments, expressed as glutathione S-transferase (GST) fusion proteins in E. coli to bind directly to and block the binding of hIgE to RBL-2/2/C cells. We show that the peptide sequence spanning amino acid residues Pro-Ser is common to all recombinant -chain fragments capable of binding to FcRI. Deletion of this sequence is associated with a complete loss of receptor recognition, confirming earlier observation by others that grafting the homologous sequence from IgG1 into hIgE reduces FcRI binding by 97%(14) . Replacing this sequence in hIgE by the homologous rat sequence maintains binding to hFcRI, but there is a loss of hFcRII interaction, confirming earlier observations by others that rodent IgE recognizes only hFcRI but not hFcRII(10) . Since recombinant GST-chain fusion proteins containing this sequence do not block IgE/FcRI interaction, we conclude that sequences N- or C-terminal to this core peptide are essential for the provision of additional structural scaffolding in order to generate a receptor binding conformation. Viewed in the context of our model structure for IgE(18, 19) , this core peptide has been computed to form a loop proximal to the interface between the C3/4 domains that is homologous to the site in rodent IgG involved in the binding to the groove formed by the 1 and 2 domains of the neonatal FcRn(24) . Interestingly, as for IgG/FcRn interaction, we also observe two pH optima at pH 6.4 and 7.4 for hIgE/FcRI interaction. While N- or C-terminal truncation has little effect on the association rate, deletion of C-terminal sequences increases the rate of dissociation several hundred-fold and reduces receptor occupancy at pH 6.4. The slow dissociation of IgE from FcRI therefore may be due, at least in part, to the stabilization of the interaction by His residues in the C-terminal region of the ligand.

EXPERIMENTAL PROCEDURES

Gene Constructs and Site-specific Mutagenesis

For the construction of the chimeric h/r IgE molecule we employed the -chain expression plasmids pSV-Vh/r(18) . A construct where the sequences known to be essential for hFcR1 interaction had been replaced by the homologous rat sequence encoding residues 341-356 was also generated by overlap extension PCR(25) . The template for PCR was a 3.4-kilobase pair IgE C1-4 genomic DNA cassette cloned into the BamHI site in pUC19 (pH). A 719-base pair fragment coding essentially for C2-3 was generated by PCR.

This involved two rounds of PCR and four primers, two external (5` BglII, CGTGAAGATCTTACAGTCGTC; 3` NcoI, CCTGCCCATGGCTCACCG) and two internal primers (5` h-r16, CCTCGACCTGTATGAAAATGGGACTCCCAAACTTACCTGTCTGGTGGTGGACCTG; 3` h-r16, CCATTTTCATACAGGTCGAGGGGACTGGGTGGGATTAGGTAGGCGCTCACCCCTCT).

For each PCR, reaction mixtures contained 200 ng of template, 2 µg of each primer, 1 mM dNTPs, 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl in 100 µl, and following a hot start 1 unit of Taq polymerase was added. An initial denaturation cycle at 96 °C for 6 min, 64 °C for 2 min, 72 °C for 1 min 30 s was followed by 30 cycles at 94 °C for 1 min 30 s, 64 °C for 1 min 30 s, 72 °C for 1 min 30 s. The resultant 719-base pair fragment was cloned into pH using BglII and NcoI sites to give a chimeric C1-4 cassette, which was subcloned, using the BamHI sites, into the mammalian expression vector pSV-V(18) . The orientation of this cassette was checked by PCR.

The identity of all gene constructs was confirmed by sequencing the DNA of both strands.

Gene Expression

The chimeric pSV-V construct was linearized using PvuI and electroporated into the J558L plasmacytoma cell line(18) . J558L cells were cultured in Dulbecco's modified Eagle's medium (10% fetal calf serum, penicillin/streptomycin, gentamicin) and selection medium (Dulbecco's modified Eagle's medium, 10% fetal calf serum, penicillin/streptomycin, gentamicin, mycophenolic acid, xanthine, and hypoxanthine) was added 48 h after electroporation(18) . High secreting clones were selected by enzyme-linked immunosorbent assay.

Purification of Recombinant GST-chain Fusion Proteins from E. coli Cell Pellets

Gel Electrophoresis and Immunoblotting

Ligand Binding Studies and Cell Culture

The conditions for maintenance of RBL-2H3 cell lines transfected with the -chain of hFcRI (RBL-2/2/C) have been described(23) . RBL-2/2/C clones were plated into 48-well plates at an initial plating density of 10 cells/well and incubated with 10M dexamethazone for 24 h at 37 °C. In preliminary experiments, RBL-2/2/C cells were incubated with increasing concentrations of I-labeled ligands (0.1-7.5 µg/ml) to determine the minimum saturation concentrations for FcRI binding. The proportion of molecules capable of binding to FcRI was 78-91% for I-labeled h and h/r IgE V, while the bindable portion of the I-labeled GST-(226-547), GST-(326-547), GST-(340-547), and GST-(226-354) was 41, 56, 53, and 27%, respectively. The number of rFc molecules bound per cell was calculated on the basis that GST-(326-547) and GST-(340-547) are dimers, while GST-(226-354) is a monomer.

Nonspecific binding was determined using a 50-100-fold molar excess of nonlabeled hIgE over I-hIgE, and the same amount of GST was used as a negative control. The binding of recombinant proteins to FcRI was determined indirectly, after correcting for nonspecific binding (7-17%), by calculating the percentage of inhibition of I-IgE binding to cells. To measure the inhibition (IC) of I-IgE binding to RBL-2/2/C or the 8866 lymphoblastoid cell line (18) by native and chimeric h/r IgE V and recombinant -chain fragments, cells were preincubated with increasing concentrations (10-10M) of each of the unlabeled peptides in 125 µl of binding buffer or, as control, binding buffer alone at 22 °C for 1 h, before the addition of 50 µl of binding buffer containing I-hIgE (1 nM). After 45 min, the cells were washed twice with 0.5 ml of ice-cold binding buffer and lysed with 0.5 ml of lysis buffer (0.5 M NaOH, 1% Triton X-100). Samples (0.25 ml) were removed and counted for 5 min on a LKB1277 -counter.

The kinetics of association between RBL-2/2/C cells and I-labeled h and h/r chimera, GST-(226-547), GST-(326-547), GST-(340-547) (2 µg/ml, in binding buffer), and GST-(226-354) (0.7 µg/ml, in binding buffer) were measured at 22 °C during the first 300 s of incubation at pH 7.4. Rate constants were calculated on the basis that GST-(226-547), GST-(326-547), and GST-(340-547) are dimers, while GST-(226-354) is a monomer. The forward rate constant (k) was calculated as V/C R, where V represents the initial rate of binding, and C and R represent the concentration of ligand and receptor number (130,000 h-chains/cell(23) ). To determine the dissociation rate constant (k), cells were preincubated for 1 h at 22 °C with 125 µl of the following I-labeled ligands: h and rat IgE, the h/r chimera, GST-(226-547), GST-(326-547), GST-(340-547), and GST-(226-354/7) (ligand concentration as for the determination of k). Cells were washed twice with 0.5 ml of binding buffer before 125 µl binding buffer containing a 50-fold molar excess of unlabeled hIgE or binding buffer was added. At t and after 15-, 30-, 60-, 120-, and 180-min intervals, the cells were washed twice with 0.5 ml of ice-cold binding buffer, solubilized in 0.5 ml of lysis buffer (0.5 M NaOH, 1% Triton X-100), and 0.25-ml samples were assayed for cell-bound I.

The pH optimum for the binding of I-labeled hIgE and the GST-chain fragments to FcRI was determined by incubating RBL-2/2/C cells (23) in 48-well plates with 100 µl of 50 mM phosphate-buffered saline containing 0.2% BSA (pH range 5.9-8.1) for 10 min at 37 °C before adding 50 µl of 2 µg/ml I-hIgE or 0.7 µg/ml of the I-GST-chain fragments. Cells were incubated for 30 min, and the excess protein was removed by washing with saline containing 0.2% BSA before measurement of cell-bound label. Results were corrected for nonspecific binding.

Potassium Iodide Titrations

RESULTS AND DISCUSSION

In the present study, we focused on the identification of the site(s) that determine the interaction of hIgE with its cellular receptors. The strategies employed for the expression of an overlapping family of chimeric GSTh-chain fusion proteins are outlined in Fig. 1. Panel A summarizes the receptor-binding capacities of the GSTh-chain fusion proteins, that of a chimeric / peptide, and that of a chimeric h/r IgE molecule. The assignment of biological activities is based on (i) competition and (ii) direct binding studies detailed in Fig. 2and Table 1. In Fig. 1, panels C and D show the electrophoretic mobilities of C- and N-terminally truncated recombinant GSTh-chain fusion proteins immunoprecipitated with a rabbit anti-GST antiserum, followed by PAGE analysis under nonreducing conditions and immunoblotting with a horseradish peroxidase-labeled rabbit anti-IgE serum. As shown in Fig. 1, C-terminal truncation yields a number of -chain peptides for each construct. As judged by PAGE (Fig. 1C) and column chromatography (data not shown), approximately one-third of the peptides in each set corresponds to the full-length fusion peptide as a monomeric fragment. None of these fragments show any propensity to dimerize, although biologically inactive polymeric aggregates form at concentrations >1.3 mg/ml. A set of identical fragments is observed following analysis under reducing conditions (data not shown). Most of the smaller -chain fragments represent proteolytic cleavage fragments that are recognized by monoclonal antibodies specific for the C2 domain. ()In contrast, deletion of N-terminal sequences gives rise to two -chain fragments and their apparent molecular weight under nonreducing (Fig. 1D) and reducing conditions (data not shown) indicates that they correspond, in almost equal quantities, to monomeric and dimeric GSTh-chain fusion proteins.

Figure 1: Gene constructs, expression products, and mapping of receptor binding regions in human IgE. Recombinant -chain gene fragments were subcloned into the multiple cloning site (MCS) of the bacterial expression plasmids pGEX-3X and pGEX-KG (25) and expressed in E. coli(6, 18) . The -chain expression plasmids pSV-Vh/r were employed for the construction of mutant and chimeric IgE molecules and expressed in the J558L myeloma cell line(18) . Panels A and B summarize the ability of the truncated, chimeric, and mutant -chain variants to bind to FcRI expressed on RBL-2H3.1 and RBL-2/2/C cells (23, 27) and to FcRII expressed on the 8866 lymphoblastoid cell line(18) . Initial screening for biological activity was determined by assessing the capacity of GST-chain fusion proteins to inhibit the binding of I-labeled hIgE (1 nM) to the receptors. The degree of inhibition effected by nonbinders was identical, within limits of experimental error, to that observed with GST, which was included as a negative control (see Fig. 2). Purification of truncated recombinant GST-chain fusion proteins and mutant and chimeric IgE molecules was carried out as described (see ``Experimental Procedures''). Ligands were labeled with I for direct binding studies (see Table 1). Nonbinders showed no binding above background even at concentrations above 10M. Panels C and D show GST-chain fusion proteins that were immunoprecipitated with a rabbit anti-GST serum, followed by SDS-PAGE (12%) separation under nonreducing conditions and immunoblotting with a horseradish peroxidase-labeled rabbit anti-human IgE serum. Panel C, lanes 1-6, GST-(226-547), GST-(226-361), GST-(226-357), GST-(226-354), GST-(226-352), GST-(226-340). Panel D, lanes 1-6, GST-(326-547), GST-(340-547), GST-(343-547), GST-(345-547), GST-(350-547), GST-(226-440)-C3. +, receptor binding; -, loss of receptor binding; n.d., not determined.

Figure 2: Percentage of inhibition of I-hIgE binding to RBL-2/2/C cells by native and recombinant hIgE-derived -chain fragments. To measure the inhibition (IC) of 1I-hIgE to RBL-2/2/C cells by native IgE and recombinant -chain fragments, cells were preincubated at 22 °C for 1 h with increasing concentrations (10-10M) of each of the unlabeled GST fusion peptides in 125 µl of binding buffer or, as a negative control, GST or binding buffer. I-hIgE was then added (1 nM). After 45 min, the cells were washed twice with 0.5 ml of binding buffer and lysed in the same volume of lysis buffer, and aliquots were removed for -counting. The IC values for GST-(226-547) and GST-(226-357) (data not shown) were identical to those observed for hIgE () and GST-(226-354) (). GST-(226-340) () and GST-(355-547) (), where the sequence common to all fragments that can engage FcRI has been deleted by either the N- or C-terminal truncation, show inhibition levels similar to that obtained with GST () and all other fragments classified as nonbinders in Fig. 1. , GST-(340-547); , GST-(440-547). Data shown represent the means of at least three separate experiments carried out in duplicate.

The present investigation confirms our previous observations, which show that only those peptides that contain C4 or the homologous C3 domain can engage both FcRI and FcRII(6, 16) , while C-terminal truncation of the -chain results in elimination of binding to FcRII. As summarized in Fig. 1A, sequences common to all fragments capable of binding to FcR1 comprise residues Pro-Ser in the C3 domain. Further deletion from either the C- or N-terminal end beyond these residues is associated with a loss of FcRI binding. As shown in Fig. 2and Table 1, GST-(340-547) and GST-(226-354), which comprise the core peptide, inhibit the binding of hIgE with an IC in the nanomolar range. In contrast, blocking of IgE/FcRI interaction by the GST control, GST-(226-340), GST-(355-547), and GST-(440-547) is identical and cannot be detected even above micromolar concentrations. These results confirm observation by others who find that recombinant IgE-derived fragments comprising residues 355-547 do not block hIgE binding to hFcRI (11) and that substitution of residues 346-353 by the homologous sequence from IgG1 reduces binding of the chimera to background levels(14) .

As shown in our model structure of hIgE-Fc (Fig. 3) (18) , this sequence forms a loop that is homologous to the loop in rIgG shown to bind to the neonatal FcRn(24) . A further similarity emerged when we investigated the pH dependence of the binding of hIgE to FcRI. As shown in Fig. 4two pH optima are observed for the binding of hIgE to FcR1, and occupancy of the receptor is almost twice as high at pH 6.4 as at pH 7.4. Although the significance of this is not known, it is tempting to speculate that hIgE has evolved the lower pH optimum as a result of its physiological importance in the fight against parasitic infestations in the lumen of the intestine at acid pH.

Figure 3: Drawing of the -carbon trace of a model structure (18, 19) for hIgE with various fragments and domains indicated. The light chains are drawn with thin lines and the heavy chains with thick lines, one thicker than the other. The interchain Cys at position 328 is labeled. The 11-amino acid segment 343-353, which is common to all IgE-derived peptides that bind to FcRI, is drawn with bigger circles and wide, empty bonds in both heavy chains.

Figure 4: pH profile for the binding of native IgE and recombinant IgE-derived peptides to RBL-2/2/C cells. h-chain-transfected RBL-2/2/C clones were distributed into 48-well plates at 10 cells/well and incubated with 10M dexamethazone for 24 h at 37 °C. Prior to the assay cells were washed twice with 0.5 ml of saline containing 0.4% BSA and preincubated with 125 µl of 50 mM phosphate-buffered saline containing 0.4% BSA (pH range 5.9-8.1) for 10 min at 37 °C before adding 50 µl of 2 µg of I-labeled IgE (), 0.7 µg of GST-(340-547) (), and GST-(226-354) (&cjs3409;). Cells were incubated for 30 min, after which unbound ligand was removed by washing with binding buffer before measurement of cell-bound label. Results were corrected for nonspecific binding. (Data shown represent the means of two determinations carried out in duplicate)

Data summarized in Table 1show that N- or C-terminal truncation has a negligible effect on the rate of association of biologically active -chain fragments with FcRI. In contrast, the rate of dissociation increases several hundred-fold following the deletion of residues from the C-terminal end, and, as shown in Fig. 3, this is associated with a concomitant decrease in receptor occupancy at pH 6.4. Taken together, these data suggest that His residues in the C-terminal region of the IgE molecule make a contribution toward the maintenance of the high affinity interaction between IgE and FcRI since this is largely determined by the slow rate of dissociation of the ligand from the receptor.

Results obtained in the current study differ in one significant respect from those in our previous investigation(6) , where the FcRI-blocking capacity of IgE-derived fragments was evaluated by the senior investigator, who performed passive cutaneous anaphylaxis tests in his own skin. Employing a well defined cellular assay system(23) , we demonstrate here that N-terminal IgE sequences can be deleted beyond residue 340 without any significant effect on the kinetics of ligand/receptor interaction. Our data show that the essential determinant for hIgE/FcRI recognition depends on a consecutive sequence comprising 11 amino acids computed to form a loop at the interface between the C3 and C4 domain(18) . In accord with others(7, 8, 9, 10) , our observations exclude any direct contribution of C4-specific residues as proposed by Stanworth et al.(12) . Our results confirm and extend those made by Nissim et al.(8, 9, 10) , who demonstrated that the receptor binding site in IgE is located in the C3 domain. They differ from the claims of Hamburger (29) and Gould et al.(20, 21) , who propose, respectively, that residues 330-334 and 329-340 in the switch region between C2 and C3 are essential for IgE/FcRI binding. As the results of our study clearly demonstrate, these sequences can be deleted without any major influence on the kinetics of hIgE/FcRI interaction.

It is interesting to note that the active core sequence identified by us corresponds closely to the hIgE-derived peptide generated by Nio et al.(15) , who report its capability to block the binding of antigen-specific IgE to cells expressing FcRI at concentrations in the mM range(15) .

Although the results of our study indicate that fragments containing the C2 domain show an increased susceptibility to proteolysis (Fig. 1C), the inclusion of the protease inhibitor phenylmethylsulfonyl fluoride during the isolation procedure facilitates the purification of peptides that engage FcRI/II. Using our published method, others have been unable to generate h-chain fragments in E. coli that retain FcRI-binding capacity and have attributed this failure to folding problems(11) . At least one other laboratory has expressed -chain fragments in E. coli which are biologically active(30) .

Based on the outcome of FcRI binding studies with chimeric and mutant hIgE molecules, Presta and co-workers (14) proposed that six amino acid residues located in three loops, C-D, E-F, and F-G, computed to form the outer ridge on the most exposed side of the C3 domain, are involved in receptor binding primarily by electrostatic interactions(14) . These conclusions were based on the observation that replacement of these residues reduced the binding of variant molecules to FcRI relative to native hIgE. We disagree with their conclusion in view of the fact that most of the mutations at Arg (408), Ser (411), Lys (415), Glu (452), Arg (465), and Met (469) (Presta et al.(14) numbering scheme in parentheses), which affect IgE/FcRI interaction to a greater or lesser extent, are invariably due to replacements by residues of opposite charge or by a Pro, changes which could cause structural rearrangements. In contrast, more conservative substitutions of these residues either have little effect or cause an apparent enhancement of binding ((14) , Table 1). Our own study shows that e.g. a single point mutation involving Cys, which by itself is not required for either FcRI or FcRII binding(18) , can have a dramatic effect on the conformation of the IgE molecule. Its substitution by Met, but not Ser, destroys binding to both receptors(18) . When we compared the intrinsic fluorescence of Trp residues in the native and IgE Met molecule, we found that on average native IgE has 41% of its Trp residues exposed to solvent, while IgE Met was found to have only 22% of Trp residues exposed, although both molecules were recognized by a conformation-dependent monoclonal antibody directed against the C2 domain. This observation shows that the substitution of a single amino acid that is not involved in receptor recognition can induce a significant deformation in structure and profoundly affect ligand/receptor association.

Presta et al.(14) have also claimed that the grafting of loops C-D, E-F, and F-G and the inter-C2/3 switch region into hIgG (which they refer to as IgGEL), conferred FcRI binding to hIgG. Their own data, however, on the binding of variant IgE do not support this interpretation. It is important to point out that their chimeric IgGEL construct still retains the endogenous IgG loop A-B sequence, which when grafted into hIgE ((14) , Table 1, variant 1) effected a 97% decrease in binding. This represents a greater reduction in activity than any other loop replacements described in their study. Data in their Fig. 3, which is interpreted by them to support their claim that the IgGEL chimera can recognize FcR1, demonstrate the opposite since they show that when CHO 3D10 cells are incubated with IgGEL at a concentration of 1 µg/ml, less than 2% of cells become labeled. Since these are the criteria that they applied for the assignment of the receptor binding activity of all other chimeric and mutant IgE molecules described in their investigation ((14) , Table 1), we conclude that IgGEL has the same affinity for FcRI as variant 1, which is less active than any other chimera or mutant reported in their study. Although Fig. 3of their paper (14) appears to suggest 40% binding at 20 µg/ml IgGEL, there is no evidence for saturation, and the slope of the line is indicative of nonspecific binding.

In our opinion, the data of Presta et al. provide compelling evidence that the A-B loop in hIgE comprises the essential structural determinant for IgE/FcRI interaction because the only difference between their variant 1 and native hIgE is that in variant 1 the core sequence, which we have shown to be common to all hIgE fragments that can engage hFcR1, is replaced by the IgG1 homologue.

As our study shows, sequences N- or C-terminal to this core peptide are necessary to provide structural scaffolding for the maintenance of a receptor binding conformation since the core peptide alone cannot engage the receptor. Deletion of C-terminal, but not N-terminal, sequences diminishes receptor occupancy at pH 6.4 and increases the dissociation of the ligand from the receptor. We conclude that residues, including His, in the C-terminal domain make an important contribution toward the maintenance of the high affinity of interaction between IgE and FcRI.

Although human and rodent IgE are highly homologous, rodent IgE can engage only hFcRI but not hFcRII(10) . In contrast, hIgE cannot bind to either of the rodent receptors. The structural basis for this phenomenon is unknown. In the current study we have replaced the human A loop by the rat homologue and find that the chimera still recognizes hFcRI. This graft, however, does not confer binding to rFcRI, indicating that conformational determinants outside the A loop in hIgE inhibit recognition of rFcRI. The fact that this replacement destroys the binding of hIgE to hFcRII indicates exquisite species specificity and suggests that residues in this motif contribute to the binding to both receptors. Nissim et al.(10) have demonstrated that the species specificity for recognition of FcRII by murine and hIgE is contained in the C3 domain and proposed that part of the binding energy for hFcRII interaction is contributed by amino acid residues between 346 and 356.

At present, limited structural information is available regarding the interaction between IgE and its receptors. Unlike IgG/FcRn interaction, where the ligand can engage two receptors, IgE molecules bind to FcRI in a 1:1 stoichiometry, although bilateral symmetrical protection to proteolysis has been observed when rodent IgE is complexed to the -chain(24, 31, 32) . This has been explained in terms of a bent conformation of IgE(33) , where the second -chain becomes inaccessible to an additional copy of the receptor, or to antibodies directed against epitopes in IgE that become masked following receptor engagement. There is little evidence for a beneficial role for IgE antibodies except in parasitic diseases, and such epitopes may therefore have an application as immunogens for the therapy of IgE-mediated allergies, since naturally occurring and monoclonal antibodies (33, 34, 35, 36) have been described that block the binding of IgE to cells expressing FcR1 but do not trigger mediator release. An improved understanding of the docking of hIgE to its receptors will provide the structural information needed for the rational design of such immunogens. The identification of the binding site constitutes a major step in this direction.

FOOTNOTES

*

This work was supported in part by the Science and Engineering Research Council/Biotechnology Directorate, the Department of Trade and Industry in collaboration with EURO/DPC LTD, the National Asthma Campaign, the European Union, and NATO. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§

To whom correspondence and reprint requests should be addressed: Tel.: 44-114-2824375; Fax: 44-114-2795495; B.Helm{at}Sheffield.ac.uk.

¶

Recipient of a Biotechnology and Biological Sciences Research Council studentship.

**

Recipient of a Medical Research Council studentship.

§§

Supported by a DPC/European Research Institute Special Fellowship. Present address: Dept. of Biochemistry and Genetics, University of Newcastle-upon-Tyne, NE2, 4HH, United Kingdom.

¶¶

Present address: Dept. of Biochemistry, University of Nottingham, NG7 2UH, United Kingdom.

A

Requests for reagents used in the current study should be addressed to A. P. M. Wilson, EURO/DPC LTD, Llanberis, Gwynedd LL55 4EL, United Kingdom. Penny_Wilson{at}euro2.ccmail.compuserve.com.

()

The abbreviations used are: h, human; r, rat; GST, glutathione S-transferase; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis; BSA, bovine serum albumin.

()

B. Helm, unpublished observations.

REFERENCES

1. Stanworth, D. R., Humphrey, J. H., Bennich, H., Johannson, S. G. O. (1968) Lancet 2, 17-19 [CrossRef][Medline] [Order article via Infotrieve]
2. Ishizaka, K., Ishizaka, T., Lee, E. H. (1970) Immunochemistry 7, 687-702 [CrossRef][Medline] [Order article via Infotrieve]
3. Lindstrøm-Bahr, H. (1974) Human Immunoglobulin E Structural Studies on the Epsilon Chain ND, Ph.D. thesis, University of Uppsala
4. Helm, B. A., Ling, Y., Rhodes, N., and Padlan, E. A. (1992) Progress in Allergy and Clinical Immunology 2, 589-599
5. Geha, R., Helm, B. A., and Gould, H. J. (1985) Nature 315, 577-579 [CrossRef][Medline] [Order article via Infotrieve]
6. Helm, B. A., Marsh, P., Vercelli, D., Padlan, E. A., Gould, H., and Geha, R. (1988) Nature 331, 180-183 [CrossRef][Medline] [Order article via Infotrieve]
7. Weetall, M., Shopes, B., Holowka, D., and Baird, B. (1990) J. Immunol. 145, 3849-3854 [Abstract]
8. Nissim, A., Jouvin, H. H., and Eshhar, Z. (1991) EMBO J. 10, 101-109 [Medline] [Order article via Infotrieve]
9. Nissim, A., and Eshhar, Z. (1992) Mol. Immunol. 29, 1065-1072 [CrossRef][Medline] [Order article via Infotrieve]
10. Nissim, A., Schwarzbaum, S., Siraganian, R., and Eshhar, Z. (1993) J. Immunol. 150, 1365-1374 [Abstract]
11. Basu, M., Hakimi, J., Dharm., E., Kondas, J. A., Tsien, W-H., Pilson, R., Lin, P., Gilfillan, A., Haring, P., Braswell, E. H., Nettelton, M., and Kochan, J. (1993) J. Biol. Chem. 268, 13118-13127 [Abstract/Free Full Text]
12. Stanworth, D. R., Jones, V. M., Lewin, I., and Nayyar, S. (1990) Lancet 336, 1279-1283 [CrossRef][Medline] [Order article via Infotrieve]
13. Robertson, M. W., and Liu, F. T. (1988) Mol. Immunol. 25, 103-107 [CrossRef][Medline] [Order article via Infotrieve]
14. Presta, L., Shields, R., O'Connell, L., Lahr, S., Porter, J., Gorman, C., and Jardieu, P. (1994) J. Biol. Chem. 269, 26368-26373 [Abstract/Free Full Text]
15. Nio, N., Seguro, K., Aryoshi, Y., Nakanishi, K., Kita, A., Ishi, K., and Nakamura, H. (1989) Peptide Chemistry 2, 203-206
16. Vercelli, D., Helm, B., Marsh, P., Padlan, E., Geha, R., and Gould H. (1989) Nature 338, 649-652 [CrossRef][Medline] [Order article via Infotrieve]
17. Helm, B. A., Kebo, D., Vercelli, D., Glovsky. M. M., Gould., H. J., Ishizaka, K., Geha, R., and Ishizaka, T. (1989) Proc. Natl. Acad. Sci. U. S. A. 186, 9465-9469
18. Helm, B. A., Ling, Y., Teale, C., Padlan, E. A., and Brüggemann, M. (1991) Eur. J. Immunol. 21, 1543-1548 [Medline] [Order article via Infotrieve]
19. Padlan, E. A., and Helm, B. A. (1993) Biochem Soc. Trans. 21, 963-967 [Medline] [Order article via Infotrieve]
20. Beavil, A. J., Beavil, R., Chan, C., Cook, J. P., Gould, H. J., Henry, A. J., Owens, R. J., Shi, J., Sutton, B. J., and Young, R. (1993) Biochem. Soc. Trans. 21, 968-972 [Medline] [Order article via Infotrieve]
21. Sutton, B. J., and Gould, H. J. (1993) Nature 366, 421-428 [CrossRef][Medline] [Order article via Infotrieve]
22. Marsh, P., Helm, B. A., and Gould, H. J. (1988) IgE in Allergic Inflammation (Johansson, S. G. O., ed) Pharmacia Allergy Research Foundation, pp. 26-31, Uppsala, Sweden
23. Wilson, A. P., Pullar, C., Camp, A., and Helm, B. A. (1993) Eur. J. Immunol. 23, 240-244 [Medline] [Order article via Infotrieve]
24. Burmeister, W. P., Huber, A. H., and Bjorkman, P. J. (1994) Nature 372, 379-384 [CrossRef][Medline] [Order article via Infotrieve]
25. Ho, S. N., Hunt, H. D., Horton, M. R., Pullen, J. K., Pease, L. R., (1989) Gene (Amst.) 52, 2940-2948
26. Guan, K. L., and Dixon, J. E. (1991) Anal. Biochem. 192, 262-267 [CrossRef][Medline] [Order article via Infotrieve]
27. Bingham, B. R., Monk, P., and Helm, B. (1994) J. Biol. Chem. 269, 19300-19306 [Abstract/Free Full Text]
28. Lehrer, S. S., and Leavis, P. C. (1978) Methods Enzymol. 49, 222-226 [Medline] [Order article via Infotrieve]
29. Hamburger, R. N. (1975) Science 189, 389-391 [Abstract/Free Full Text]
30. Liu, F. T., Albrandt, K. A., Bry, C. G., and Ishizaka, T. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 5361-5365
31. Yagi, S., Yanagida, M., Tanida, I., Hasegawa, A., Okumura, K., and Ra, C. (1994) Eur. J. Biochem. 220, 593-598 [Medline] [Order article via Infotrieve]
32. Perez-Montfort, R., and Metzger, H. (1982) Mol. Immunol. 19, 1113-1125 [CrossRef][Medline] [Order article via Infotrieve]
33. Zheng, Y., Shopes, R., Holowka, D., and Baird, B. (1991) Biochemistry 30, 9125-9132 [CrossRef][Medline] [Order article via Infotrieve]
34. Kitani, S., Kraft, D., Fischler, C., Mergenhagen, S. E., and Siraganian, R. (1988) J. Immunol. 140, 2585-2588 [Abstract]
35. Presta, L. G., Lahr, S. J., Shields, R. L., Porter, J. P., Gorman, C. M., Fendly, B. M., and Jardieu, P. M. (1993) J. Immunol. 151, 2632-2637
36. Vogel, M., Miescher, S., Biaggi, C., and Stadler, B. M. (1994) Eur. J. Immunol. 24, 1200-1207 [Medline] [Order article via Infotrieve]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				S. J. Demarest, J. Hopp, J. Chung, K. Hathaway, E. Mertsching, X. Cao, J. George, K. Miatkowski, M. J. LaBarre, M. Shields, et al. An Intermediate pH Unfolding Transition Abrogates the Ability of IgE to Interact with Its High Affinity Receptor Fc{epsilon}RI{alpha} J. Biol. Chem., October 13, 2006; 281(41): 30755 - 30767. [Abstract] [Full Text] [PDF]

				I. Sayers, J. E. M. Housden, A. C. Spivey, and B. A. Helm The Importance of Lys-352 of Human Immunoglobulin E in Fc{epsilon}RII/CD23 Recognition J. Biol. Chem., August 20, 2004; 279(34): 35320 - 35325. [Abstract] [Full Text] [PDF]

				H. A. Sampson Anaphylaxis and Emergency Treatment Pediatrics, June 1, 2003; 111(6): 1601 - 1608. [Abstract] [Full Text] [PDF]

				M. P. Rudolf2 3, A. W. Zuercher2 4, A. Nechansky, C. Ruf, M. Vogel, S. M. Miescher, B. M. Stadler, and F. Kricek Molecular Basis for Nonanaphylactogenicity of a Monoclonal Anti-IgE Antibody J. Immunol., July 15, 2000; 165(2): 813 - 819. [Abstract] [Full Text] [PDF]

				R. J. Pleass, J. I. Dunlop, C. M. Anderson, and J. M. Woof Identification of Residues in the CH2/CH3 Domain Interface of IgA Essential for Interaction with the Human Fcalpha Receptor (Fcalpha R) CD89 J. Biol. Chem., August 13, 1999; 274(33): 23508 - 23514. [Abstract] [Full Text] [PDF]

				M. D. Hulett, R. I. Brinkworth, I. F. C. McKenzie, and P. M. Hogarth Fine Structure Analysis of Interaction of Fcepsilon RI with IgE J. Biol. Chem., May 7, 1999; 274(19): 13345 - 13352. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Helm, B. A. Articles by Wilson, A. P. M. Search for Related Content PubMed PubMed Citation Articles by Helm, B. A. Articles by Wilson, A. P. M. Social Bookmarking                      What's this?