JBC Focus on PI3-Kinase with Echelon

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boudreaux, J. M.
Right arrow Articles by Towler, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boudreaux, J. M.
Right arrow Articles by Towler, D. A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 271, Number 13, Issue of March 29, 1996 pp. 7508-7515
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
Synergistic Induction of Osteocalcin Gene Expression
IDENTIFICATION OF A BIPARTITE ELEMENT CONFERRING FIBROBLAST GROWTH FACTOR 2 AND CYCLIC AMP RESPONSIVENESS IN THE RAT OSTEOCALCIN PROMOTER (*)

(Received for publication, October 20, 1995; and in revised form, January 23, 1996)

Jeanne M. Boudreaux (1),  Dwight A. Towler (2) (3)(§)

From the  (1)Departments of Pediatrics, (2)Medicine, and (3)Molecular Biology and Pharmacology, Washington University School of Medicine, St. Louis, Missouri 63110

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Fibroblast growth factors (FGFs) are important regulators of calvarial osteoblast growth and differentiation. We have studied the regulation of the osteoblast-specific gene osteocalcin (OC) by FGF2 in phenotypically immature MC3T3-E1 calvarial osteoblastic cells. FGF2 markedly induces OC mRNA accumulation in MC3T3-E1 cells in the presence of forskolin (FSK). Similarly, OC promoter activity (luciferase reporter) is up-regulated 6-10-fold by FGF2/FSK or by FGF2/8-bromo cyclic AMP. Half-maximal induction of OC promoter activity occurs at 1 nM FGF2. By 5` deletion analysis and dinucleotide point mutations, we map one component of this FGF2/FSK response to a GCAGTCA motif in the region -144 to -138 relative to the OC transcription initiation site. The OC promoter region -154 to -90 confers FGF2/FSK responsiveness on the Rous sarcoma virus minimal promoter. By 3` and internal deletion analyses, the region between -90 to -99 is also found to be necessary for FGF2/FSK synergy (encodes a PuGGTCA motif previously identified as a component of FSK induction). A DNA binding activity that recognizes the region -148 to -125 of the rat OC promoter is induced in crude nuclear extracts from MC3T3-E1 cells treated with FGF2 or FGF2/FSK. This binding activity is sequence-specific and does not recognize the TCAGTCA DNA cognate of AP1. Members of the ATF, Fos, and Jun family are not immunologically detected in this inducible DNA binding activity. However, transient co-expression of ATF3 but not ATF2 selectively attenuates the FGF2 component of induction. Thus, a novel FGF2-regulated DNA-protein interaction in the OC promoter participates in the transcriptional control of OC expression by FGF and cyclic AMP in MC3T3-E1 calvarial osteoblasts.

INTRODUCTION

FGF (^1)family members control osteoblast gene expression in a biphasic fashion, dependent upon the stage of osteoblast maturation(1, 2, 3, 4, 5, 6) . Dominant mutations in FGF receptor -1 and FGF receptor -2 give rise to abnormal skeletal phenotypes, including craniosynostosis characterized by accelerated intramembranous calvarial bone formation in the cranial sutures(7, 8, 9, 10) . However, virtually nothing is known of the transcriptional mechanisms whereby FGF regulates expression of the osteoblast phenotype. Using fetal calf calvarial bone cells, Gospodarowicz and co-workers (1) demonstrated that FGF2 (basic FGF) stimulates osteoblast proliferation and the production of osteocalcin, a bone-specific protein(11, 12, 13) . Recent in vivo studies using rats have shown that intravenous FGF2 stimulates bone formation and mineralization(3, 4) . Similarly, FGF2 potentiates expression of the osteoblast phenotype (including osteocalcin production) in a subset of immature, preosteoblastic stromal cells known as colony-forming cells(5, 6) ; by contrast, phenotypically more mature osteoblast cluster-forming cells do not respond to FGF2 in this way. Studies using phenotypically mature, ROS 17/2.8 osteosarcoma cells (2, 14) reveal that FGF can act to globally suppress features of the differentiated osteoblast via a pertussis toxin-sensitive G protein(2) . Whether FGF2 signaling is influenced by sarcomatous transformation has not been systematically examined; however, a novel oncogenic guanine nucleotide exchange factor, ost, has been isolated from ROS 17/2.8, suggesting that G protein signaling may be altered in this cellular background(15) .

MC3T3-E1 cells are a phenotypically immature, mouse calvarial osteoblast cell line cloned from spontaneously immortalized calvarial cells selected by the 3T3 passaging protocol(16) . MC3T3-E1 cultures sequentially elaborate osteoblast phenotypic markers(16, 17, 18) , closely mimicking results obtained with cultures of primary calvarial osteoblasts (reviewed in (19) ). The osteoblast-specific phenotypic marker, osteocalcin (OC), is initially expressed at low levels and then up-regulated with time in culture and ascorbic acid(17, 18) . MC3T3-E1 cells respond to FGF2 (20) and like normal calvarial osteoblasts(7, 8, 9) express mRNAs for FGF receptors -1 and -2. (^2)Previously, we have shown that the osteoblast-specific rat OC promoter is active in MC3T3-E1 cells (21, 22, 23) . Thus, the MC3T3-E1 cell culture model provides a readily manipulable system for studying how hormonal signals, including FGF2, interact with the calvarial osteoblast transcriptional machinery assembled by the OC promoter.

In this work, we show that FGF2 up-regulates OC mRNA accumulation and OC promoter activity in phenotypically immature MC3T3-E1 cultures in the presence of cyclic AMP. We map one component of this novel FGF2-dependent response to a GCAGTCA motif at nucleotides -144 to -138 in the osteoblast-specific (19, 21, 24) proximal promoter region of rat OC. A DNA binding activity that recognizes this region of the rat OC promoter is up-regulated in crude nuclear extracts from MC3T3-E1 cells treated with FGF2 or FGF2/FSK. By internal deletion analysis in the context of the homologous OC promoter and 3` deletion analysis in the context of a heterologous minimal promoter, we show that a second region, -90 to -99, previously defined as a component of cyclic AMP responsiveness(23) , is necessary for FGF2/FSK induction. Intriguingly, FGF2 induction of the OC promoter is selectively inhibited by ATF3, a transcriptional repressor (25) involved in FGF-dependent up-regulation of proenkephalin gene expression(26) . Thus, a novel FGF2-regulated DNA-protein interaction in the OC promoter participates in the transcriptional control of OC expression in MC3T3-E1 calvarial osteoblasts.

EXPERIMENTAL PROCEDURES

Cell Culture and Reagents

MC3T3-E1 mouse calvarial osteoblasts (16, 17, 18) were grown as described previously (22, 23) using cells between passages 5 and 12 from our frozen stocks. Molecular biology reagents were obtained from Promega (Madison, WI) and Fisher. Synthetic oligonucleotides were obtained from the Washington University Protein and Nucleic Acid Chemistry Laboratory and Life Technologies, Inc. Radionuclides were obtained from Amersham Corp. Protein was determined by the Pierce BCA assay after precipitation and resolubilization of protein(27) .

Reverse Transcription-Polymerase Chain Reaction Analyses

Semi-quantitative reverse transcription-PCR analysis was carried out following the protocol of Estus and co-workers(28) . MC3T3-E1 cells were plated at a density of 150,000 cells/cm^2 in 15-cm diameter tissue culture dishes. 24 h later, cells were refed with 25 ml of fresh complete medium containing either vehicles (vehicles were Me(2)SO for FSK and 1 mg/ml bovine serum albumin in phosphate-buffered saline for FGF2), 10 µM FSK, 6 nM FGF2, or 10 µM FSK and 6 nM FGF2 and then cultured for an additional 18 h. Total RNA was subsequently isolated from confluent monolayers of MC3T3-E1 cells as described(29) . 2 µg of total RNA was reverse transcribed with avian myeloblastosis virus reverse transcriptase (Promega) per the manufacturer's recommendations using 0.5 µg of random hexanucleotides primers in a reaction volume of 16 µl. 1 µl of this cDNA was used for PCR (17 cycles of 94 °C times 30 s, 55 °C times 45 s, and 72 °C times 60 s) with a Perkin-Elmer 9600 Thermal Cycler in the presence of [alpha-P]dCTP(28) . After separation of the reaction products on 4-20% gradient polyacrylamide gels (Novex, San Diego, CA), gels were dried and autoradiographed. Oligonucleotide pairs used for PCR analysis of cDNA are: OCN1, AAGTCCCACACAGCAGCTTG; OCN2, AGCCGAGCTGCCAGAGTTTG (osteocalcin; (13) ); COL1A1, TCTCCACTCTTCTAGTTCCT; COL1A2, TTGGGTCATTTCCACATGC (type I alpha 1 collagen; (30) ); GAPD1, ACTTTGTCAAGCTCATTTCC; and GAPD2, TGCAGCGAACTTTATTGATG (glyceraldehyde phosphate dehydrogenase; (30) ). PCR fragments are 368, 269, and 267 base pairs for OC, collagen, and GAPD, respectively. Amplimer pairs anneal in regions encoded by separate exons.

OC Promoter-Luciferase Reporter Constructs

The synthesis of the various 5` rat OC promoter deletion constructs has been described in detail(21) . The rat OC gene accession number is J04500 (NCBI 205863). Oligonucleotide directed mutagenesis by PCR was utilized to introduce the dinucleotide substitutions. Deletion of the region -112 to -93 in the homologous promoter context of 154 OCLUC was achieved by ligating the PCR fragment -154 to -113 into the KpnI site of 92 OCLUC(21) . PCR-generated 3` OC promoter deletion constructs were cloned into the KpnI-MluI sites of RSVLUC(23) . All constructs were sequenced as described (21) to verify insert identity. The construct 795 BSPLUC has been previously described(22) . The pCG-ATF2 and pCG-ATF3 expression constructs were the kind gift of B. Chen and T. Hai(25) .

Cellular Transfection and Luciferase Assays

MC3T3-E1 cells were transfected as previously detailed(21, 22, 23) ; typically, 1 µg of total plasmid DNA was used per well (7.5 µg/ml DNA in 0.2 mg/ml diethylaminoethyl-dextran; 12-well cluster dish; 150,000 cells/cm^2). After a 2-day period following the Me(2)SO shock, transfected cells were switched to complete culture medium containing either vehicles (see above), 10 µM FSK, 6 nM FGF2, or both FSK and FGF2. After treatment for 18 h, cellular luciferase activity was measured as previously detailed (21, 22, 23) using a Berthold AutoLumat 953 luminometer (EG & G Instruments, Oak Ridge, TN). The data are presented as the mean (± standard deviation) luciferase activity of three independent transfections, verified in multiple (two to six) independent experiments. Transfection efficiencies were routinely monitored as described previously (21) with pGL2-Promoter (Promega).

Electrophoretic Mobility Gel Shift Assays

MC3T3-E1 cells were plated at a density of 150,000 cells/cm^2 in 15-cm diameter tissue culture dishes. 24 h later, cells were refed with 25 ml of fresh complete medium containing either vehicles (see above), 10 µM FSK, 6 nM FGF2, or 10 µM FSK and 6 nM FGF2 and cultured for an additional 18 h. Nuclear extracts and gel shift assays were carried out as described previously (21, 23) except that 1 nM okadaic acid and 10 mM sodium orthovanadate were added to inhibit phosphoprotein phosphatases. Synthetic oligonucleotides used for gel shift analyses were: FRE-A, CCTGCAGTCACCAACCACAGCAT (rat OC -146 to -125); FRE-B, GGATGCTGTGGTTGGTGACTGCA; AP1-A, GGCTTGATGAGTCAGCC; AP1-B, CCGGCTGACTCATCAAG. The appropriate oligonucleotide pairs were annealed and end-labeled with [alpha-P]dCTP and the Klenow fragment of DNA polymerase I. Oligonucleotides thyroid hormone response element palindrome (23) and rOC Box (PPE3; (21) and (23) ) were prepared as previously detailed. In supershift assays, crude nuclear extracts were preincubated on ice with 1 µl of the indicated antibody prior to binding and electrophoresis. The alpha-Fos (K-25), alpha-Jun (D), ATF2, and ATF3 (antibodies 10 µg/µl) were obtained from Santa Cruz Biotech (Santa Cruz, CA). Other polyclonal ATF1, ATF2, and ATF4 antibody reagents were the kind gift of Dr. T. Hai and B. Chen (Ohio State University).

RESULTS

FGF2 and FSK Synergistically Up-regulate OC mRNA Accumulation

Previously, we demonstrated that FSK or 8-bromo cyclic AMP could up-regulate OC in MC3T3-E1 calvarial osteoblasts(23) . Because FGF2 potentiates OC secretion from bovine calvarial cells(1) , we wished to assess whether FGF2- and FSK-dependent signals interact in MC3T3-E1 cells. As shown in Fig. 1, the combination of FGF2 and FSK markedly up-regulates OC mRNA accumulation in MC3T3-E1 cells. This effect is specific, because the mRNA for GAPD is not affected. As previously observed in MC3T3-E1 cells(20) , FGF2 markedly suppresses COL1A1 mRNA accumulation, either in the presence or the absence of FSK. Thus, as observed with bovine calvarial cultures, FGF2 can potentiate OC expression in MC3T3-E1 cells. However, the effect in MC3T3-E1 cells is enhanced upon co-treatment with FSK.

Figure 1: FGF2 and FSK synergistically up-regulate OC mRNA accumulation in phenotypically immature MC3T3-E1 calvarial osteoblasts. MC3T3-E1 cells were cultured as described under ``Experimental Procedures,'' treated for 18 h with vehicles, 10 µM FSK, 6 nM FGF2, or both, and total RNA was harvested(29) . Messenger RNA levels for OC, COL1A1, and GAPD were assessed using a semiquantitative reverse transcription-PCR technique as previously detailed (28) and as outlined in the text. Note that the combination of FGF2 and FSK up-regulates OC mRNA levels but not GAPD levels. Note also that this regulatory effect and interaction is selective, because suppression of COL1A1 by FGF2 (20) occurs either in the presence (lane 4) or the absence (lane 3) of FSK. CON, control.


FGF2 and FSK Synergistically Up-regulate Rat OC Promoter Activity

We wished to assess whether FGF2 and FSK could synergistically activate the OC promoter. MC3T3-E1 cells were transfected with the rat OC promoter-luciferase reporter construct 1050 OCLUC (contains the region -1050 to 32 of the OC promoter; 21), allowed to recover 2 days, and then treated with vehicles, 10 µM FSK, 6 nM FGF2, or both (FGF2/FSK) for 18 h. Cell extracts were subsequently prepared and analyzed for luciferase activity. As shown in Fig. 2, the combination of FGF2 and FSK synergistically up-regulates OC promoter activity. Synergistic induction is also observed with FGF2/8-bromo cyclic AMP (not shown). The effect is specific for the OC promoter, because the proximal rat BSP promoter (795 BSPLUC) is not up-regulated but is actually suppressed (Fig. 2). In the presence of 10 µM FSK, the FGF2 dose response reveals half-maximal induction of the OC promoter with 1 nM FGF2 (Fig. 3). Thus, FGF2/FSK synergistically and specifically up-regulates OC promoter activity in MC3T3-E1 cells.

Figure 2: FGF2 and FSK synergistically up-regulate OC promoter activity. MC3T3-E1 cells were transfected with 1050 OCLUC and 795 BSPLUC as described under ``Experimental Procedures.'' After a 2-day recovery, cells were treated for 18 h with vehicles, 10 µM FSK, 0.3 nM FGF2, or both as indicated. Extracts were subsequently prepared and analyzed for luciferase activity as described previously(21, 22, 23) . Note that the combination of FGF2 and FSK synergistically up-regulates the rat OC promoter. Note also that this effect is promoter-specific, because the BSP promoter is suppressed not synergistically activated. The FSK effect can be mimicked by 0.2 mM 8-bromo cyclic AMP ( (23) and not shown).


Figure 3: FGF2 induction of the OC promoter in the presence of 10 µM FSK. Note that half-maximal induction of OC promoter activity by FGF2 occurs at 1 nM. FSK by itself induces promoter activity 2.5-fold via an element located between -121 and -74(23) .


A GCAGTCA Motif at -144 to -138 in the Rat OC Promoter Participates in the Transcriptional Response to FGF2

Using a series of 5` deletion constructs prepared as previously detailed(21) , we mapped the FGF2/FSK interaction to a region between -154 and -138 relative to the transcription initiation site (Fig. 4). A series of dinucleotide substitutions were made within this region within the context of the -154 to 32 homologous rat OC promoter (154 OCMUT series). As shown in Fig. 5, substitutions upstream (154 OCMUT#1-#2) or downstream (154 OCMUT#6-#7) of the region -144 to -138 have little effect on FGF2/FSK induction. By contrast, the GCAGTCA to AAAGTCA alteration seen in 154 OCMUT#4 decreases FGF2/FSK induction by approximately 50%. Furthermore, the GCAGTCA to GCATTTA substitution in 154 OCMUT#5 completely abrogates the FGF2/FSK synergistic induction (without affecting the FSK response), consistent with the results obtained from the 5` deletion analyses (compare 154 OCLUC with 138 OCLUC; Fig. 4). Introduction of the TTAGTCA motif, an AP1 cognate, at this position (154 OCMUT#3) results in a variant partially inducible by FGF2 alone (2-fold) and subsequently more responsive FGF2/FSK. Thus, the intact GCAGTCA motif in the region -144 to -138 is necessary for the FGF2 component of FGF2/FSK induction of rat OC promoter activity.

Figure 4: The synergistic induction of basal OC promoter activity is dependent upon a motif located between -154 and -138 relative to transcription initiation. A series of rat OC promoter 5` deletion constructs with luciferase reporter were transfected into MC3T3-E1 cells and examined for induction in the presence of FSK (10 µM) and FGF2 (1.5 nM) as described in the legend to Fig. 2. Note that synergistic induction is markedly attenuated upon deletion of the region -154 to -138.


Figure 5: An intact GCAGTCA motif at -144 to -138 in the OC promoter is necessary for synergistic induction by FGF2/FSK. A series of dinucleotide substitutions were made within context of the homologous -154 to 32 OC promoter fragment (154 OCLUC). Note that substitutions upstream (154 OCMUT#1-#2) or downstream (154 OCMUT#6-#7) of the region -144 to -138 had little effect on FGF2/FSK induction. By contrast, note also that the GCAGTCA to AAAGTCA alteration seen in 154OCMUT#4 decreased FGF2/FSK induction by 50%. Furthermore, the GCAGTCA to GCATTTA substitution in 154 OCMUT#5 completely abrogates the FGF2/FSK synergistic induction without affecting the FSK response, consistent with the results obtained from the 5` deletion analyses (see Fig. 4). Introduction of the TTAGTCA motif for AP1 at this position (154 OCMUT#3) results in a variant partially inducible by FGF2 alone (2-fold) and subsequently more responsive FGF2/FSK. See text for details.


The OC Promoter Fragment -154 to -90 Can Confer FGF2/FSK Responsiveness to a Heterologous Minimal Promoter

The region -144 to -138 is necessary for the FGF2/FSK response as shown above by deletion analysis and point mutagenesis. However, three tandem copies of the sequence CTGCAGTCAC (rat OC -146 to -137) are insufficient to reconstitute the response when placed upstream of the RSV minimal promoter (not shown). Recently, we have shown that FSK can modestly induce the OC promoter via the rat osteocalcin cyclic AMP response region -121 to -74 (23) dependent upon two PuGGTCA (TGACCPy) hexamer motifs (see Fig. 11). Therefore, we wished to assess whether this downstream element participated in the FGF/FSK induction. As shown in Fig. 6, the OC promoter fragments -154 to -74 (Fig. 6A) or -154 to -90 (Fig. 6B) confer FGF2/FSK induction on the heterologous RSV minimal promoter. Deletion of the region -74 to -111 (OC (-199 to -74) RSVLUC versus OC (-199 to -112) RSVLUC; Fig. 6A) or -90 to -99 ((-154 to -90) OC RSVLUC versus (-154 to -100) OC RSVLUC; Fig. 6B) completely abrogates FGF2/FSK induction. RSVLUC alone is inactive as a promoter (TATA box only; (23) ). Similarly, deletion of the region -112 to -93 within the homologous promoter context, 154 [Delta -112 to -93] OCLUC, completely abrogates FGF2/FSK induction (Fig. 6B). Thus, in toto, the rat OC promoter region -154 to -90 is necessary and sufficient for the FGF2/FSK response. This response is dependent upon the newly defined GCAGTCA motif at -144 to -138 and a downstream element between -99 and -90, encoding a GGGTCA motif (bottom strand) involved with cyclic AMP responsiveness ( (23) and Fig. 11).

Figure 11: Regulatory elements in the proximal rat OC promoter. Numbering is relative to the start site of transcription. Hex A and Hex B refer to the hexamer motifs (TGACCPy on top strand, PuGGTCA on bottom strand) of the cyclic AMP response region(23) . See text for details and references.


Figure 6: The OC promoter fragment -154 to -90 can confer FGF2/FSK responsiveness to the RSV heterologous minimal promoter fragment. A, rat OC promoter fragments -154 to -74, -199 to -74, -199 to -112, -154 to -90, and -154 to -100 were placed in native orientation upstream of the inactive ( (21) and data not shown) RSVLUC minimal promoter fragment -51 to 35. These constructs were transfected into MC3T3-E1 cells, and cultures were subsequently treated with vehicles, 10 µM FSK, 6 nM FGF2, or both as described in the text. As shown, the OC promoter fragment -154 to -74 confers FGF2/FSK responsiveness to the RSVLUC minimal promoter. Deletion of the OC promoter region -74 to -111 in the context of a larger OC promoter fragment completely abrogates the FGF2/FSK response (-199 to -74 versus -199 to -112). B, the smaller OC fragment -154 to -90 also confers FGF2/FSK responsiveness to the RSVLUC minimal promoter. Deletion of the 10-base pair region between -90 and -99, inclusive, completely abrogates the FGF2/FSK response (-154 to -90 versus -154 to -100). Internal deletion of the overlapping region -112 to -93 in the homologous promoter context as in 154 (Delta-112 to -93) OCLUC also abrogates FGF2/FSK induction. See Fig. 11for OC promoter sequence.


Co-expression of ATF3 Inhibits FGF2 Synergy with FSK in Activation of the Rat OC Promoter

Comb and co-workers (26) have shown that ATF3 and c-Jun participate in the synergistic induction of the proenkephalin promoter by FGF2 and FSK in SK-N-MC neuroblastoma cells. To assess whether ATF3 participates in the FGF2/FSK induction of the OC promoter, pCG-ATF3 eukaryotic expression construct was co-transfected with 154 OCLUC in MC3T3-E1 cells, followed by treatment with vehicles, FSK, FGF2, or FGF2/FSK. As shown in Fig. 7, co-expression of ATF3 does not potentiate but rather attenuates FGF2/FSK induction of the OC promoter (consistent with its role as a transcriptional repressor; (25) ) without altering the FSK response. By contrast, co-expression of pCG-ATF2 has no effect on induction (Fig. 7). Thus, ATF3 is not participating in the synergistic up-regulation of the OC promoter by FGF2/FSK in MC3T3-E1 cells; rather it acts as a transcriptional inhibitor.

Figure 7: ATF3 attenuates FGF2/FSK but not FSK induction of the OC promoter. The OC promoter construct 154 OCLUC (5.5 µg/ml) was co-transfected with empty expression vector (CONTROL), pCG-ATF2, or pCG-ATF3 (1.8 µg/ml) as indicated. After a 2-day recovery period, cells were treated for 18 h with vehicles, 10 µM FSK, 6 nM FGF2, or FGF2/FSK and subsequently analyzed for luciferase activity. Note that ATF3 attenuates FGF2/FSK induction but not FSK induction of the OC promoter. Note also that ATF2 did not inhibit promoter induction.


FGF2 and FGF2/FSK Up-regulate a DNA Binding Activity in Nuclear Extracts That Recognizes the Rat OC Promoter Region -146 to -125

To assess the DNA-protein interactions occurring in this region of the rat OC promoter, crude nuclear extracts were prepared from MC3T3-E1 cells treated with vehicle, 10 µM FSK, 6 nM FGF2, or FGF2/FSK as described under ``Experimental Procedures.'' Electrophoretic mobility gel shift assays were then carried out using radiolabeled duplex oligonucleotide encoding the rat OC promoter region -146 to -125 (FRE oligo) encompassing the element described by deletion and mutagenesis to be participating in the FGF2/FSK response. As shown in Fig. 8, a DNA binding activity is up-regulated in nuclear extracts of cells treated with FGF2 (lane 4) or FGF2/FSK (lane 5). A smaller increase in FRE binding activity is also observed by treatment with FSK alone (lane 3). By contrast, both unregulated (constitutive) and inducible DNA binding activities are present in these same extracts, which recognize the homeodomain cognate OCTA 26 (not shown and (21) ). AP1 binding activity is also up-regulated (lanes 7-10); however, the FRE DNA-protein complex and the AP1 DNA-protein complex do not co-migrate. Moreover, unlabeled AP1 cognate does not compete for factor binding to the rat OC FRE oligo (Fig. 9A, lanes 5 and 6). Unlabeled FRE cognate (rat OC -146 to -125; Fig. 9A, lane 3) and the concatamerized sequence CTGCAGTCAC (rat OC -146 to -137; not shown) compete for MC3T3-E1 nuclear factor binding to the FRE oligo. However, the thyroid hormone response element palindrome (half-site AGGTCA) does not compete for binding (Fig. 9B; lanes 5-7). Interestingly, the rat OC BOX, which contains the motif GGGGTCA at -92 to -98 (bottom strand) does compete weakly for FRE binding activity when present in 50-fold molar excess (Fig. 9B, lane 10). Thus, FGF2 and FGF2/FSK up-regulates a specific DNA-protein interaction in the rat OC promoter region conferring FGF2/FSK transcriptional responses.

Figure 8: FGF2 and FGF2/FSK up-regulate a DNA binding activity in nuclear extracts that recognize the rat OC promoter region -146 to -125. MC3T3-E1 cells were cultured as described under ``Experimental Procedures'' and treated with vehicles, 10 µM FSK, 6 nM FGF2, or both for 18 h. Crude nuclear extracts were prepared and analyzed for DNA binding proteins by gel shift assays as detailed in the text. Lanes 1 and 6, no nuclear extract (control, CON). Lanes 2-5 and 7-10, 5 µg of nuclear extract/reaction. In the absence of nuclear extract, no DNA-protein complexes are observed (lanes 1 and 6). Note that FGF2 (lane 3) and FGF2/FSK (lane 4) markedly increase binding to the rat OC promoter region -146 to -125 (FRE oligo); a smaller increase is noted with FSK treatment alone (lane 2). AP1 binding activity is significantly up-regulated by FSK, FGF2, or the combination (lanes 7-10). Note, however, that the FRE DNA-protein complex and the AP1 DNA-protein complex do not co-migrate (arrows).


Figure 9: The FGF2-inducible DNA binding activity recognizing the rat OC promoter fragment -146 to -125 does not recognize the AP1 or thyroid hormone response element palindrome DNA cognates. The specificity of the FGF2 inducible DNA-protein interaction observed in Fig. 8was examined by binding competition with excess unlabeled DNA cognates as described previously(21, 22, 23) . A, lane 1, no nuclear extract; lanes 2-6, 6 µg of nuclear extract/binding reaction from FGF2-treated MC3T3-E1 cells. In the absence of nuclear extract, no gel shift is observed (lane 1). The addition of 30-fold molar excess of unlabeled FRE OC promoter oligo inhibited binding to the homologous labeled FRE fragment (lane 3). However, 30-fold (lane 5) and 90-fold (lane 6) molar excess of unlabeled AP1 cognate did not compete for binding the FGF2 inducible factor (Fig. 8) to the OC FRE promoter fragment. The radiolabeled FRE oligo concentration was 1.5 times 10M. B, lane 1, no nuclear extract; lanes 2-10, 6 µg of nuclear extract per tube from MC3T3-E1 cells treated with FGF2. Note that 50-fold molar excess of thyroid hormone response element palindrome (with sequence AGGTCA) could not compete for binding (lane 7). By contrast, 50-fold excess of the unlabeled rOC BOX (with sequence GGGGTCA) weakly competes for binding (lane 10) to a lesser degree than that observed with the homologous unlabeled FRE oligo (with sequence GCAGTCA; lane 4).


The DNA-Protein Complex Assembling on the OC Promoter Region -146 to -125 Does Not Contain Common Fos, Jun, or ATF Family Members

The similarity of the GCAGTCA motif to DNA cognates for a number of leucine zipper transcription factors of the ATF, Fos, and Jun families prompted us to assess whether one of these known factors might be present in the DNA-protein complex binding to the FRE oligo. Antibodies recognizing conserved domains of c-Fos, Fos-B, Fra-1, and Fra-2 (alpha-Fos) and c-Jun, Jun-B, and Jun-D (alpha-Jun) did not supershift or disrupt the complex assembling on the FRE oligo (Fig. 10A). By contrast, these same antibodies could supershift and partially disrupt the DNA-protein complex assembling on the AP1 element (31) known to bind Fos-Jun family members (Fig. 10B). No immunologic evidence of ATF1, ATF2, ATF3, ATF4 (Fig. 10A), or CREB (not shown) could be found in the complex binding the FRE oligo. Thus, the DNA-protein complex assembling on the FRE oligo does not contain common Fos, Jun, or ATF family members.

Figure 10: The DNA-protein complex assembling on the OC promoter region -146 to -125 does not contain common Fos, Jun, or ATF family members. Nuclear extracts from MC3T3-E1 cells were preincubated with antibodies to Fos, Jun, or ATF family members as described under ``Experimental Procedures'' before proceeding to gel shift assays. Lane 1, no nuclear extract. Lanes 2- 10, 6 µg/reaction of nuclear extract from MC3T3-E1 cells treated for 18 h with FGF2. A, DNA-protein complexes assembling on the OC promoter fragment -146 to -124 (FRE). Note that none of the antibody treatments indicated disrupted or supershifted the FRE oligo DNA-protein complex. B, DNA-protein complexes assembling on the AP1 DNA cognate. Note that the anti-Fos (lane 3) and anti-Jun (lane 4) antibodies partially supershifted (lanes 3 and 4) and disrupted (lane 3) the DNA-protein complex binding to the AP1 element.


DISCUSSION

Previously, we identified a cyclic AMP response region (-121 to -74) in the proximal osteocalcin promoter ( (23) and Fig. 11). We now describe a novel element participating in a FGF2 transcriptional response, which cooperates with cyclic AMP to synergistically induce OC expression and which binds a DNA complex up-regulated in cells treated with FGF2 or FGF2/FSK. To our knowledge, this is the second promoter element shown to be synergistically activated by FGF2/FSK. Tan et al.(26) recently described a proenkephalin promoter element stimulated by FGF/FSK via ATF3 and c-Jun. However, the inducible MC3T3-E1 protein complex assembling on the rat OC promoter does not contain ATF3 or c-Jun. Moreover, co-expression of ATF3 inhibits FGF2/FSK induction of the OC promoter, consistent with the recently defined role for ATF3 as a transcriptional repressor(25) . Thus, the character of the OC promoter FGF2/FSK response differs from that of the proenkephalin promoter(26) .

The sequence of the FRE and the observation that ATF3 inhibits induction introduces the notion that a known or novel member of the leucine zipper family (32, 33) may be regulating the OC promoter via this element. The similarity of the GCAGTCA FRE motif to the TPyAGTCA AP1 motif prompted us to carefully examine whether common members of the Fos and Jun family were present in the DNA-protein complex assembling on the OC FRE. Alteration of the OC promoter FRE to fit the AP1 consensus does enhance FGF2/FSK induction but also results in basal induction by FGF2 in the absence of FSK, a response not noted with the native OC promoter. Three sets of data strongly suggest that the FGF-inducible DNA-protein interaction at the native OC FRE does not contain AP1 factors: (i) The complex assembling on the OC FRE does not recognize the classic AP1 cognate. (ii) The complex assembling on the OC FRE does not supershift with alpha-Fos or alpha-Jun antibodies, whereas the complex assembling on the AP1 element does supershift with these same reagents. (iii) Tetradecanoyl phorbol acetate, which activates AP1 via protein kinase C, cannot replace FGF2 in the synergistic interaction with FSK. (^3)Moreover, Stein and Lian (19) have shown that AP1 activity suppresses the OC promoter during osteoblast proliferation(19) ; this also suggests that AP1 is unlikely to be directly participating in OC promoter induction via the FRE.

The capacity of FGF2 and FSK to synergistically activate OC expression and promoter activity in MC3T3-E1 cells is intriguing. In fibroblasts (33) and osteosarcoma cells(34) , cyclic AMP inhibits mitogen-activated protein kinase activation at the level of Raf-1 interaction with Ras (33) . FGF2 does activate mitogen-activated protein kinase(34, 35) . However, it was recently shown that FGF2 elaborates unique signals that suppress the myogenic differentiation program of MM14 cells; independent activation of the mitogen-activated protein kinase cascade by platelet-derived growth factor is not sufficient to suppress MM14 skeletal muscle gene expression(35) . Similarly, preliminary studies show that epidermal growth factor does not synergize with FSK to up-regulate OC in MC3T3-E1 osteoblasts.^3 Taken together, these observations introduce the notion that FGF receptors may initiate intracellular signal cascades in calvarial osteoblasts that are overlapping yet distinct from those of other mitogen receptor tyrosine kinases, a notion to be directly examined in future studies of MC3T3-E1 gene regulation.

The precise mechanisms whereby FGF2 and FSK synergize to up-regulate OC promoter activity remain to be detailed. Possibilities include independent regulation of protein DNA interactions at the the FRE and cyclic AMP response region (23) or regulation of obligate protein-protein interactions between factors bound to these elements. Consistent with both mechanisms, FGF2/FSK induction requires the two elements encompassed by the OC promoter fragment -154 to -90. By both 5` deletion analysis and point mutagenesis in the context of the native OC promoter, we directly demonstrate that the region -144 to -138 is necessary for the FGF2/FSK response. However, it is not solely sufficient for this response; three tandem copies of the sequence CTGCAGTCAC (-146 to -137) cannot reconstitute the response when placed upstream of the RSV minimal promoter, even though it readily competes for nuclear factor binding to the FRE oligo. We and others have mapped important basal regulatory elements both upstream and downstream of the OC FGF response element (19-24, 38-42; Fig. 11). Furthermore, Ducy and Karsenty (24) have functionally defined an element contiguous to the FRE that plays an important role in the cell type specificity of the proximal mouse and rat OC promoters(19, 21, 24, 42) . However, the FGF-responsive element is distinct from this element, because mutations that destroy factor binding to this element (24, 42) do not disrupt FGF2/FSK synergy. The interplay between tissue-specific and stimulus-specific OC promoter elements remains to be detailed. Regardless of the mechanism, in MC3T3-E1 cells the OC promoter is functionally acting as a coincidence detector, responding to bipartite inductive signals elaborated by FGF2 and FSK. The precise nature of this response will require identification and characterization of the proteinaceous factors binding hormonally responsive regions of the OC promoter and should provide a more detailed understanding of how FGF-elaborated signals impact osteogenesis in development and disease(5, 7, 8, 9) .

Finally, Schedlich et al.(43) recently described a FGF response element in the human OC promoter. The element they describe differs from the rat OC FRE in several aspects: (i) The human OC element is inducible by FGF2 alone. (ii) The human OC element resembles an NF-1 DNA cognate. (iii) The human OC element maps to a distal upstream promoter fragment, near the vitamin D response element. Moreover, their studies (43) were carried out in phenotypically mature, transformed ROS17/2.8 osteosarcoma cells, where the endogenous OC mRNA expression is down-regulated by FGF(2) . Future studies will be necessary to systematically examine the influences of sarcomatous cellular backgrounds and the different stages of osteoblast maturation upon the regulation of these elements by FGF2.

FOOTNOTES

*
This work was supported by the Department of Medicine, Washington University School of Medicine. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank(TM)/EMBL Data Bank with accession number(s) J04500[GenBank].

§
To whom all correspondence should be addressed: Washington University School of Medicine, Dept. of Molecular Biology and Pharmacology, Box 8103, 660 South Euclid, St. Louis, MO 63110. Tel.: 314-362-9925; Fax: 314-362-7058; dtowler{at}pharmdec.wustl.edu.

(^1)
The abbreviations used are: FGF, fibroblast growth factor; OC, osteocalcin; FSK, forskolin; LUC, luciferase; PCR, polymerase chain reaction; FRE, FGF response element; RSV, Rous sarcoma virus; GAPD, glyceraldehyde phosphate dehydrogenase; COL1A1, type I collagen alpha 1; BSP, bone sialoprotein; Pu, purine; Py, pyrimidine.

(^2)
D. A. Towler, unpublished observations.

(^3)
J. M. Boudreaux and D. A. Towler, unpublished observations.

ACKNOWLEDGEMENTS

We thank Drs. Tsonwin Hai and Ben Chen generously providing the pCG-ATF2 and pCG-ATF3 expression constructs and the ATF1, ATF3, and ATF4 polyclonal antibodies. We also thank T. Latifi for technical assistance. We thank Drs. S. Klahr, J. Gordon, G. Rodan, and L. Avioli for their encouragement and support.

REFERENCES

  1. Globus, R. K., Patterson-Buckendahl, P., and Gospodarowicz, D. (1988) Endocrinology 123, 98-105 [Abstract]
  2. Rodan, S. B., Wesolowski, G., Yoon, K., and Rodan, G. A. (1989) J. Biol. Chem. 264, 19934-19941 [Abstract/Free Full Text]
  3. Nagai, H., Miyajima, H., Tsukuda, R., Taketomi, S., Mizoguchi, J., and Kato, K. (1993) Growth Factors 9, 73-80 [Medline] [Order article via Infotrieve]
  4. Nakamura, T., Hanada, K.-M., Tamura, M., Shibanushi, T., Nigi, H., Tagawa, M., Fukumoto, S., and Matsumoto, T. (1995) Endocrinology 136, 1276-1284 [Abstract]
  5. Long, M. M., Robinson, J. A., Ashcraft, E. A., and Mann, K. G. (1995) J. Clin. Invest. 95, 881-887
  6. Pitaru, S., Kotex-Emeth, S., Noff, D., Kaffuler, S., and Savion, N. (1993) J. Bone Miner. Res. 8, 919-929 [Medline] [Order article via Infotrieve]
  7. Muenke, M., Schell, U., Hehr, A., Robin, N. H., Losken, H. W., Schinzel, A., Pulleyn, L. J., Rutland, P., Reardon, W., Malcolm, S., and Winter, R. M. (1994) Nat. Genet. 8, 269-274 [CrossRef][Medline] [Order article via Infotrieve]
  8. Reardon, W., Winter, R. M., Rutland, P., Pulleyn, L. J., Jones, B. M., and Malcolm, S. (1994) Nat. Genet. 8, 98-103 [CrossRef][Medline] [Order article via Infotrieve]
  9. Jabs, E. W., Li, X., Scott, A. F., Meyers, G., Chen, W., Eccles, M., Mao, J., Charnas, L. R., Jackson, C. E., and Jaye, M. (1994) Nat. Genet. 8, 275-279 [CrossRef][Medline] [Order article via Infotrieve]
  10. Cohen, M. M., Jr. (199) Am. J. Med. Genet. 47, 581-616 [CrossRef][Medline] [Order article via Infotrieve]
  11. Gehron Robey, P., Fedarko, N. S., Hefferan, T. E., Bianco, P., Vetter, U. K., Grzesik, W., Friedenstein, A., Van Der Pluijm, G., Mintz, K. P., Young, M. F., Kerr, J. M., Ibaraki, K., and Heegaard, A.-M. (1993) J. Bone Miner. Res. 8, (suppl.) 483-487
  12. Rodan, G. A., and Noda, M. (1991) Crit. Rev. Eukaryotic. Gene Expression 1, 85-98 [Medline] [Order article via Infotrieve]
  13. Desbois, C., Hogue, D. A., and Karsenty, G. (1994) J. Biol. Chem. 269, 1183-1190 [Abstract/Free Full Text]
  14. Majeska, R. J., Rodan, S. B., and Rodan, G. A. (1980) Endocrinology 107, 1494-1503 [Abstract]
  15. Horii, Y., Beeler, J. F., Sakaguchi, K., Tachibana, M., and Miki, T. (1994) EMBO J. 13, 4776-4786 [Medline] [Order article via Infotrieve]
  16. Sudo, H., Kodama, H., Amagai, Y., Yamamoto, S., and Kasai, S. (1983) J. Cell Biol. 96, 191-198 [Abstract/Free Full Text]
  17. Franchesi, R. T., and Iyer, B. S. (1992) J. Bone Miner. Res. 7, 235-246 [Medline] [Order article via Infotrieve]
  18. Franchesi, R. T., Iyer, B. S., and Cui, Y. (1994) J. Bone Miner. Res. 9, 843-854 [Medline] [Order article via Infotrieve]
  19. Stein, G. S., and Lian, J. B. (1993) Endocr. Rev. 14, 424-442 [CrossRef][Medline] [Order article via Infotrieve]
  20. Hurley, M. M., Abreu, C., Harrison, J. R., Lichtler, A. C., Raisz, L. G., and Kream, B. E. (1993) J. Biol. Chem. 268, 5588-5593 [Abstract/Free Full Text]
  21. Towler, D. A., Bennett, C. D., and Rodan, G. A. (1994) Mol. Endocrinol. 8, 614-624 [Abstract]
  22. Towler, D. A., Rutledge, S. J., and Rodan, G. A. (1994) Mol. Endocrinol. 8, 1484-1493 [Abstract]
  23. Towler, D. A., and Rodan, G. A. (1995) Endocrinology 136, 1089-1096 [Abstract]
  24. Ducy, P., and Karsenty, G. (1995) Mol. Cell. Biol. 15, 1858-1869 [Abstract]
  25. Chen, B. P. C., Liang, G., Whelan, J., and Hai, T. (1994) J. Biol. Chem. 269, 15819-15826 [Abstract/Free Full Text]
  26. Tan, Y., Low, K. G., Boccia, C., Grossman, J., and Comb, M. J. (1994) Mol. Cell. Biol. 14, 7546-7556 [Abstract/Free Full Text]
  27. Peterson, G. L. (1977) Anal. Biochem. 83, 346-356 [CrossRef][Medline] [Order article via Infotrieve]
  28. Estus, S., Zaks, W. J., Freeman, R. S., Gruda, M., Bravo, R., and Johnson, E. M. (1994) J. Cell Biol. 127, 1717-1727 [Abstract/Free Full Text]
  29. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159 [Medline] [Order article via Infotrieve]
  30. Tong, H.-S., Sakai, D. D., Sims, S. M., Dixon, S. J., Yamin, M., Goldring, S. R., Snead, M. L., and Minkin, C. (1994) J. Bone Miner. Res. 9, 577-585 [Medline] [Order article via Infotrieve]
  31. Lee, W., Mitchel, P., and Tjian, R. (1987) Cell 49, 741-752 [CrossRef][Medline] [Order article via Infotrieve]
  32. Landschulz, W. H., Johnson, P. F., and McKnight, S. L. (1988) Science 240, 1759-1764 [Abstract/Free Full Text]
  33. Hafner, S., Adler, H. S., Mischak, H., Janosch, P., Heideker, G., Wolfman, A., Pippig, S., Lohse, M., Ueffing, M., and Kolch, W. (1994) Mol. Cell. Biol. 14, 6696-6703 [Abstract/Free Full Text]
  34. Verheijen, M. H. G., and Defize, L. H. K. (1995) Endocrinology 136, 3331-3337 [Abstract]
  35. Kudla, A. J., John, M. L., Bowen-Pope, D. F., Rainish, B., and Olwin, B. B. (1995) Mol. Cell. Biol. 15, 3238-3246 [Abstract]
  36. Deleted in proof
  37. Deleted in proof
  38. Demay, M. D., Roth, D. A., and Kronenberg, H. M. (1989) J. Biol. Chem. 264, 2279-2282 [Abstract/Free Full Text]
  39. Hoffman, H. M., Catron, K. M., van Wijnen, A. J., McCabe, L. R., Lian, J. B., Stein, G. S., and Stein, J. L. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 12887-12891 [Abstract/Free Full Text]
  40. Tamura, M., and Noda, M. (1994) J. Cell Biol. 126, 773-782 [Abstract/Free Full Text]
  41. Frenkel, B., Montecino, M., Stein, J. L., Lian, J. B., and Stein, J. B. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 10923-10927 [Abstract/Free Full Text]
  42. Merriman, H. L., van Wijnen, A. J., Hiebert, S., Bidwell, J. P., Fey, E., Lian, J., Stein, J., and Stein, G. S. (1995) Biochemistry 34, 13125-13132 [CrossRef][Medline] [Order article via Infotrieve]
  43. Schedlich, L. J., Flanagan, J. L., Crofts, L. A., Gillies, S. A., Goldberg, D., Morrison, N. A., and Eisman, J. A. (1994) J. Bone Miner. Res. 9, 143-152 [Medline] [Order article via Infotrieve]
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
S.-L. Cheng, J.-S. Shao, J. Cai, O. L. Sierra, and D. A. Towler
Msx2 Exerts Bone Anabolism via Canonical Wnt Signaling
J. Biol. Chem., July 18, 2008; 283(29): 20505 - 20522.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
S. Yu, R. T. Franceschi, M. Luo, X. Zhang, D. Jiang, Y. Lai, Y. Jiang, J. Zhang, and G. Xiao
Parathyroid Hormone Increases Activating Transcription Factor 4 Expression and Activity in Osteoblasts: Requirement for Osteocalcin Gene Expression
Endocrinology, April 1, 2008; 149(4): 1960 - 1968.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. Bandyopadhyay, Y. Wang, R. Zhan, S. K. Pai, M. Watabe, M. Iiizumi, E. Furuta, S. Mohinta, W. Liu, S. Hirota, et al.
The Tumor Metastasis Suppressor Gene Drg-1 Down-regulates the Expression of Activating Transcription Factor 3 in Prostate Cancer
Cancer Res., December 15, 2006; 66(24): 11983 - 11990.
[Abstract] [Full Text] [PDF]

Home page
 J Mol EndocrinolHome page
C. S. Shin, M. J. Jeon, J.-Y. Yang, S.-J. Her, D. Kim, S. W. Kim, and S. Y. Kim
CCAAT/enhancer-binding protein {delta} activates the Runx2-mediated transcription of mouse osteocalcin II promoter.
J. Mol. Endocrinol., June 1, 2006; 36(3): 531 - 546.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
W.-C. Huang, Z. Xie, H. Konaka, J. Sodek, H. E. Zhau, and L. W.K. Chung
Human Osteocalcin and Bone Sialoprotein Mediating Osteomimicry of Prostate Cancer Cells: Role of cAMP-Dependent Protein Kinase A Signaling Pathway
Cancer Res., March 15, 2005; 65(6): 2303 - 2313.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
J. P. Stains and R. Civitelli
Gap Junctions Regulate Extracellular Signal-regulated Kinase Signaling to Affect Gene Transcription
Mol. Biol. Cell, January 1, 2005; 16(1): 64 - 72.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Qiao, P. Shapiro, R. Kumar, and A. Passaniti
Insulin-like Growth Factor-1 Regulates Endogenous RUNX2 Activity in Endothelial Cells through a Phosphatidylinositol 3-Kinase/ERK-dependent and Akt-independent Signaling Pathway
J. Biol. Chem., October 8, 2004; 279(41): 42709 - 42718.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Sevilla, C. R. Santos, F. M. Vega, and P. A. Lazo
Human Vaccinia-related Kinase 1 (VRK1) Activates the ATF2 Transcriptional Activity by Novel Phosphorylation on Thr-73 and Ser-62 and Cooperates with JNK
J. Biol. Chem., June 25, 2004; 279(26): 27458 - 27465.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. Jiang, R. T. Franceschi, H. Boules, and G. Xiao
Parathyroid Hormone Induction of the Osteocalcin Gene: REQUIREMENT FOR AN OSTEOBLAST-SPECIFIC ELEMENT 1 SEQUENCE IN THE PROMOTER AND INVOLVEMENT OF MULTIPLE SIGNALING PATHWAYS
J. Biol. Chem., February 13, 2004; 279(7): 5329 - 5337.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Bidder, J.-S. Shao, N. Charlton-Kachigian, A. P. Loewy, C. F. Semenkovich, and D. A. Towler
Osteopontin Transcription in Aortic Vascular Smooth Muscle Cells Is Controlled by Glucose-regulated Upstream Stimulatory Factor and Activator Protein-1 Activities
J. Biol. Chem., November 8, 2002; 277(46): 44485 - 44496.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
B. K. Yeh, A. V. Eliseenkova, A. N. Plotnikov, D. Green, J. Pinnell, T. Polat, A. Gritli-Linde, R. J. Linhardt, and M. Mohammadi
Structural Basis for Activation of Fibroblast Growth Factor Signaling by Sucrose Octasulfate
Mol. Cell. Biol., October 15, 2002; 22(20): 7184 - 7192.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. M. Willis, A. P. Loewy, N. Charlton-Kachigian, J.-S. Shao, D. M. Ornitz, and D. A. Towler
Regulation of Osteocalcin Gene Expression by a Novel Ku Antigen Transcription Factor Complex
J. Biol. Chem., September 27, 2002; 277(40): 37280 - 37291.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
G. Xiao, D. Jiang, R. Gopalakrishnan, and R. T. Franceschi
Fibroblast Growth Factor 2 Induction of the Osteocalcin Gene Requires MAPK Activity and Phosphorylation of the Osteoblast Transcription Factor, Cbfa1/Runx2
J. Biol. Chem., September 20, 2002; 277(39): 36181 - 36187.
[Abstract] [Full Text] [PDF]

Home page
 Genes Dev.Home page
D. M. Ornitz and P. J. Marie
FGF signaling pathways in endochondral and intramembranous bone development and human genetic disease
Genes & Dev., June 15, 2002; 16(12): 1446 - 1465.
[Full Text] [PDF]

Home page
 Genes Dev.Home page
N. Ohbayashi, M. Shibayama, Y. Kurotaki, M. Imanishi, T. Fujimori, N. Itoh, and S. Takada
FGF18 is required for normal cell proliferation and differentiation during osteogenesis and chondrogenesis
Genes & Dev., April 1, 2002; 16(7): 870 - 879.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
G. Boguslawski, L. V. Hale, X.-P. Yu, R. R. Miles, J. E. Onyia, R. F. Santerre, and S. Chandrasekhar
Activation of Osteocalcin Transcription Involves Interaction of Protein Kinase A- and Protein Kinase C-dependent Pathways
J. Biol. Chem., January 14, 2000; 275(2): 999 - 1006.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. B. Rich, M. R. Fontanilla, M. Nugent, and J. A. Foster
Basic Fibroblast Growth Factor Decreases Elastin Gene Transcription through an AP1/cAMP-response Element Hybrid Site in the Distal Promoter
J. Biol. Chem., November 19, 1999; 274(47): 33433 - 33439.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. G. McEwen, R. P. Green, M. C. Naski, D. A. Towler, and D. M. Ornitz
Fibroblast Growth Factor Receptor 3 Gene Transcription Is Suppressed by Cyclic Adenosine 3',5'-Monophosphate. IDENTIFICATION OF A CHONDROCYTIC REGULATORY ELEMENT
J. Biol. Chem., October 22, 1999; 274(43): 30934 - 30942.
[Abstract] [Full Text] [PDF]