![]()
|
|
||||||||
(Received for publication, October 19, 1995; and in revised form, January 17, 1996)
From the
CD36 is a cell surface glycoprotein composed of a single polypeptide chain, which interacts with thrombospondin, collagens type I and IV, oxidized low density lipoprotein, fatty acids, anionic phospholipids, and erythrocytes parasitized with Plasmodium falciparum. Its expression is restricted to a few cell types, including monocyte/macrophages. In these cells, CD36 is involved in phagocytosis of apoptotic cells, and foam cell formation by uptake of oxidized low density lipoprotein. To study the molecular mechanisms that control the transcription of the CD36 gene in monocytic cells we have isolated and analyzed the CD36 promoter. Transient expression experiments of 5`-deletion fragments of the CD36 promoter coupled to luciferase demonstrated that as few as 158 base pairs upstream from the transcription initiation site were sufficient to direct the monocyte-specific transcription of the reporter gene. Within the above region, the fragment spanning nucleotides -158 to -90 was required for optimal transcription in monocytic cells. Biochemical analysis of the region -158/-90 revealed a binding site for transcription factors of the polyomavirus enhancer-binding protein 2/core-binding factor (PEBP2/CBF) family at position -103. Disruption of the PEBP2/CBF site markedly diminished the CD36 promoter activity, indicating an essential role of the PEBP2/CBF factors in the constitutive transcription of the CD36 gene. The involvement of members of the PEBP2/CBF family in chromosome translocations associated with acute myeloid leukemia, and in the transcriptional regulation of the myeloid-specific genes encoding for myeloperoxidase, elastase, and the colony-stimulating factor receptor, highlights the relevance of the regulation of the CD36 gene promoter in monocytic cells by members of the PEBP2/CBF family.
CD36 is a plasma membrane glycoprotein constituted by a single 88-kDa polypeptide chain (Greenwalt et al., 1992). It is a member of a family of proteins, which includes CLA-1 and LIMPII (Vega et al., 1991; Calvo and Vega, 1993; Calvo et al. 1995). CD36 binds to a large variety of ligands: thrombospondin (Ash et al., 1987; Silverstein et al., 1992), collagens type I (Tandon et al., 1989) and IV (Ash et al., 1993), fatty acids (Abumrad et al., 1993), oxidized low density lipoprotein (Endemann et al., 1993), anionic phospholipids (Rigotti et al., 1995), and Plasmodium falciparum-infected erythrocytes (Barnwell et al., 1985; Oquendo et al., 1989). CD36 is present on monocyte/macrophages, platelets, microvascular endothelium, adipocytes, mammary epithelial cells, and erythroblasts (Barnwell et al., 1985; Oquendo et al., 1989; Kieffer et al., 1989; Greenwalt et al., 1992; van Schravendijk et al., 1992; Swerlick et al., 1992; Abumrad et al., 1993; Greenwalt et al., 1995).
On the basis of its broad
ligand-binding specificity, CD36 is considered as a scavenger receptor
(Endemann et al. 1993; Acton et al., 1994; Nicholson et al., 1995). Scavenger receptors are primarily expressed on
macrophages and participate in cell clearance of damaged cellular
components and cells and foreign substances such as chemical compounds
and pathogens (Krieger and Herz, 1994). In this respect, CD36 expressed
in monocyte/macrophage cells cooperates with the
![]()
![]()
![]()
vitronectin receptor in the
recognition and subsequent phagocytic clearance of apoptotic cells
(including neutrophils, T lymphocytes, and eosinophils) migrated to
inflamed areas (Savill et al., 1992; Ren et al.,
1995). In addition, CD36 expressed on macrophages infiltrated in
damaged endothelium participates in the macrophage uptake of locally
formed oxidized low density lipoprotein, thus contributing to foam cell
formation and atherosclerosis development (Endemann et al.,
1993; Nicholson et al., 1995).
In vivo regulation
of CD36 expression in monocytes may be a complex process resulting from
the coordinated interplay between multiple soluble factors and cell
surface adhesion molecules. Thus, CD36 expression is dramatically
increased on monocytes upon their interaction with activated
endothelium and by treatment of monocytes with macrophage
colony-stimulating factor or interleukin-4 (Huh et al., 1995).
Moreover, CD36 expression varies in some myeloproliferative disorders
(Clezardin et al., 1985) and is induced during the
differentiation of promonocytes to monocytes and macrophages (Edelman et al., 1986). Up-regulation of CD36 may increase macrophage
clearance of apoptotic cells and facilitate monocyte migration through
the endothelial barrier, enhancing oxidized low density lipoprotein
uptake and monocyte-extracellular matrix interactions. On the contrary,
treatment with lipopolysaccharide or -interferon results in
down-regulation of CD36 mRNA (Huh et al., 1995).
Despite
the existence of a substantial amount of data regarding CD36
expression, little information is available on the mechanisms
underlying its transcriptional regulation. We have recently delineated
the structural organization of the CD36 gene, which revealed the
presence of a TATA box located 28 base pairs upstream from the
transcription initiation site (Armesilla and Vega, 1994). To define the
CD36 gene regions, and to identify the transcription factors important
for the expression of CD36 in monocyte/macrophage cells, we have
isolated and characterized the 5`-flanking region of the human CD36
gene. Our data demonstrate that the transcription of the CD36 gene in
monocytic cell lines is mainly controlled by its proximal promoter
region and that transcription factors belonging to the polyomavirus
enhancer-binding protein 2/core-binding factor (PEBP2/CBF) (
)family play a major role in the transcriptional regulation
of the CD36 gene.
U937, Mono Mac 6, Jurkat, and K562 cells were
transfected by electroporation. 20 10
U937 or Mono
Mac 6 cells were electroporated in 500 µl of RPMI 1640 medium.
Electroporation parameters were set at 2950 microfarads, 100 V, and a
resistance of 186 ohms. 20 10
K562 cells were
electroporated like U937 cells with the electric parameters set up to
400 V, 600 microfarads, and 13 ohms. Jurkat cells were electroporated
in 250 µl of OPTI-MEM medium (Life Technologies, Inc.) supplemented
with 10% fetal calf serum with the following electroporation
parameters: 1700 microfarads, 126 V, and a resistance of 72 ohms. For
all electroporation experiments, the cells were incubated a 4 °C
for 20 min prior to and after the electric shock. For each
electroporation experiment 40 µg of the luciferase-reporter vector
and 15 µg of the
-galactosidase reference plasmid
pCMV-
gal were used.
HeLa cells were transfected by lipofection
as follows. 5 10
cells were incubated in 60-mm
tissue culture plates with 3 ml of OPTI-MEM medium containing 15 µg
of Lipofectin (Life Technologies, Inc.), 5 µg of luciferase
reporter vector, and 1.5 µg of pCMV-
gal vector. After 16 h,
the transfection mixture was replaced by culture medium, where cells
were maintained for 36-48 h.
Luciferase and
-galactosidase activities were measured 15 h after transfection
for all cells except HeLa, according to Pahl et al.(1991) and
Promega published procedures. For HeLa cells those activities were
determined 36-48 h posttransfection. Luciferase activities were
normalized for transfection efficiency to the
-galactosidase
levels provided by the cotransfected internal standard vector
pCMV-
gal. Reported data represented the mean from several
independent experiments.
For EMSA experiments double-stranded oligonucleotides
were P-labeled using avian myeloblastosis virus reverse
transcriptase. 0.5 ng of probe at a specific activity of about 10
cpm/µg were incubated for 15 min at 4 °C with 2-6
µg of nuclear extracts in 20 µl containing 28 mM EDTA,
15 mM KCl, 6 mM MgCl
, 7 mM HEPES
(pH 7.9 at 4 °C), 7% glycerol, 1 mM dithiothreitol, 2.5
µg of poly(dI-dC), and 1 µg of acetylated DNase-free bovine
serum albumin. For competition assays, unlabeled oligonucleotides were
added to the nuclear extracts at a 50-fold molar excess 15 min before
the addition of the radiolabeled probe. When required, antibodies were
added to the nuclear extracts 15 min prior to the addition of the
radioactive probe. Two µl and 1 µl of the antibodies
-AML1
(Meyers et al., 1993) and R3034 (kindly provided by Dr. N. A.
Speck) were used, respectively. Binding reactions were electrophoresed
at 15 V/cm on 4-5% polyacrylamide gels in 0.4 TBE (45
mM Tris base, 45 mM boric acid, 1 mM EDTA)
at 4 °C. Gels were dried and exposed to Kodak XAR film. The
sequence of the oligonucleotides used for EMSA is shown in the figure
legends.
To examine the promoter activity of the 5`-flanking region of the CD36 gene and to identify potential cis-acting regulatory elements essential for its constitutive transcriptional activity, a series of deletion fragments of the region 5`-upstream from the TATA box of the CD36 gene (in the range from -2.8 kilobase pairs to -38 bp) was generated and coupled to the luciferase reporter vector pGL2-Basic. Plasmids were transfected in several cell lines, and the luciferase activity directed by each construct was measured as described under ``Experimental Procedures.''
CD36 deletion promoter constructs yielded between 40- and 80-fold higher luciferase activities than the pGL2-Basic promoterless construct in Mono Mac 6 and U937 cells (Fig. 1, A and C), while they only reached a maximum of 14 times in Jurkat and K562 cells (Fig. 1, B and D), demonstrating that 1) the 5`-upstream region of the CD36 gene possesses promoter activity and 2) the reporter luciferase gene under the control of the CD36 promoter is more efficiently transcribed in the CD36-expressing monocytic cell lines Mono Mac 6 and U937 than in the non-CD36-expressing cell lines Jurkat and K562. In this regard, the promoter activities of the CD36 constructs in Mono Mac 6 and U937 cells were higher than or comparable with the activity directed by vector pGL2-Promoter (Promega) (which contains the SV40 promoter), while they were significantly lower in the cell lines Jurkat and K562 (Fig. 1, A-D). Taken together, these observations indicate that the activity of the CD36 promoter correlates with the expression levels of CD36 and suggests that the promoter contains regulatory elements that contribute to the tissue-specific expression of this gene in monocytic cell lines.
Figure 1: Deletion analysis of CD36 promoter. A panel of CD36 promoter deletion constructs coupled to the reported luciferase gene were transiently transfected into the cell lines Mono Mac 6, U937, Jurkat, and K562, as described under ``Experimental Procedures.'' Promoter activity of each construct was expressed as -fold activity above the background activity conferred by the promoterless control plasmid pGL2-Basic, corrected for transfection efficiency (Böttinger et al., 1994). Number enclosed in parenthesis in charts B and D denote the relative luciferase activities yielded by the pGL2-promoter construct (which contains the SV40 promoter).
As shown in Fig. 1A, comparable luciferase activities were obtained
after transfection of constructs having 5` ends ranging from -2.8
kilobase pairs to -158 bp in Mono Mac 6 cells, indicating that
the region -158/+43 retains most of the promoter activity (Fig. 1A). Data obtained with U937 cells further
supported this finding (Fig. 1C).
Nevertheless, our experiments did not rule out the possibility
that other regions located upstream from position -158 may play
important positive or negative regulatory roles, which might have
remained hidden by mutual compensatory effects. A further deletion
extending to -90 bp resulted in a 70% reduction of the basal
promoter activity in both Mono Mac 6 and U937 cells, dropping the
activity to the levels found out in the CD36-negative cell lines Jurkat
and K562 (Fig. 1, A-D). These results point out
the presence of strong positive regulatory elements within the region
-158/-90, which are required for the efficient
transcription of the CD36 gene in monocytic cell lines. Deletion to
-38 bp (a construct that still preserved an intact TATA box)
abrogated promoter activity, indicating the presence of regulatory
elements in the region -90/-38 necessary for the basal
transcription of the CD36 gene.
To evaluate the functional significance of the putative PEBP2 site, the core PEBP2 binding site within the pCD36-158-luc construct was mutated from ACCACA to AAGCTT (originating the construct pCD36-158(m-102/-98)-luc). When these constructs were transfected in Mono Mac 6 and U937 cells, the promoter activity directed by the mutant construct pCD36-158(m-102/-98)-luc was 30% of the activity obtained by the wild type construct pCD36-158-luc (Fig. 2). By contrast, comparable activities were yielded by both the mutant and wild type constructs in HeLa cells, an observation consistent with the low levels of PEBP2/CBF factors detected in this cell line (Fig. 3). In Jurkat cells, the mutant also decreased the low promoter activity directed by the wild type construct. This observation, in agreement with the presence of PEBP2/CBF factors in this cell line ( Fig. 3and Fig. 4), suggests that the PEBP2/CBF site by itself does not confer the tissue specificity of the CD36 gene in monocytic cells. Interestingly, the level of reduction in promoter activity in monocytic cells when the PEBP2/CBF site was mutated was similar to the decrease in promoter activity observed when the activity directed by the pCD36-90-luc construct (which does not contain the PEBP2 site) was compared with the activity yielded by the pCD36-158-luc construct (which does contain the PEBP2 site) (Fig. 1, A and C). These results demonstrate the importance of the region -102/-98 for the constitutive transcription of the CD36 gene.
Figure 2: Mutation of site -102/-98 severely impairs the activity of the CD36 promoter. CD36 promoter wild type construct pCD36-158-luc (represented as 158wt) and mutant construct pCD36-158(m-102/-98)-luc (represented as 158mut) were transiently transfected in Mono Mac 6, U937, Jurkat, and HeLa cells. For each cell line assayed, promoter activities were represented as indicated for Fig. 1.
Figure 3: Binding of CD36 promoter region -110/-91 to nuclear extracts from several cell lines. Radiolabeled double-stranded CD36 promoter -110/-91 oligonucleotide, GCAACAAACCACACACTGGG, was incubated with nuclear extracts from cell lines lines of different origin (Mono Mac 6, U937, and THP-1, monocytic; JY, B lymphoblastoid; Jurkat, T cell leukemia; HeLa, epitheloid carcinoma).
Figure 4:
CD36 promoter contains a PEBP2/CBF site at
region -103/-98. A, radiolabeled double-stranded
CD36 promoter -110/-91 oligonucleotide was incubated with
nuclear extracts from cell lines THP-1 and Jurkat. Prior to adding the
radiolabeled oligonucleotide, nuclear extracts were incubated with a
50-fold molar excess of the following cold double-stranded
oligonucleotides: -110/-91, to demonstrate specificity of
complexes; -110/-91 mut (GCAACAAAAGCTTCACTGGG), to assay
the effect of positions -102/-98 in the binding; and AML1
cons. (GGATATCTGTGGTAAGCA), an oligonucletide containing a PEBP2/CBF
consensus site from the Moloney murine leukemia virus enhancer, to
assay the molecular nature of the complexes bound to oligonucleotide
-110/-91. -, no inhibitor added. B, nuclear
extracts from cell lines THP-1 and Jurkat were incubated with
radiolabeled double-stranded oligonucleotide -110/-91,
without(-) or with a prior incubation with a 50-fold molar excess
of cold oligonucleotide -110/-91, rabbit preimmune sera (PI), or AML1-specific antisera
-AML1 or R3034. The last lane shows the effect of the antisera
-AML1 on the
labeled double-stranded oligonucleotide -110/-91 in the
absence of nuclear extract.
Binding of radiolabeled oligonucleotide -110/-91 to nuclear extracts from THP-1 and Jurkat cells gave rise to several complexes whose formation was completely prevented by a 50-fold excess of the same unlabeled oligonucleotide, demonstrating their specificity (Fig. 4A). An oligonucleotide containing a consensus core for the PEBP2/CBF site (designated as AML1 cons.) and derived from the Moloney virus enhancer (Wang and Speck, 1992) competed the binding of all complexes to the oligonucleotide -110/-91, indicating that the sequence ACCACA was responsible for the appearance of the observed complexes (Fig. 4A). This observation was confirmed by the absence of inhibition by a mutant oligonucleotide (-110/-91 mut), which spanned the -110/-91 region and contained a cluster of mutations identical to those generated in the mutant construct pCD36-158(m-102/-98)-luc (Fig. 4A). These data indicate that the decrease of transcriptional activity in this mutant is due to the loss of its capability to interact with the factors bound to the PEBP2/CBF site (nucleotides -103/-98).
To identify the molecular nature
of the complexes observed, nuclear extracts obtained from THP-1 and
Jurkat were independently incubated with two distinct antibodies
specific for AML1 factors before the addition of the labeled
oligonucleotide -110/-91. As shown in Fig. 4B, the
-AML1 antisera, raised against the
N-terminal region of the AML1
subunit (Meyers et al.,
1993), induced specific supershift in only a fraction of the complexes
(as negative control see last lane showing the binding of the
probe to the antibody). Identical results have been obtained by several
investigators (Meyers et al., 1993; Nuchprayoon et
al., 1994; Zhang et al., 1994). Moreover, the rabbit
polyclonal antibody R3034 raised against the DNA-binding domain of
AML1, but not a preimmune rabbit serum, prevented the formation of most
of the complexes. Given the high degree of amino acid sequence
similarity within the regions used to generate both the
-AML1 and
the R3034 antisera, between the different members constituting the
PEBP2/CBF family, it is conceivable that both antisera react with
several members of the PEBP2/CBF transcription family (Levanon et
al., 1994). Finally, a similar set of experiments was carried out
using extracts isolated from peripheral blood monocytes (Fig. 5). As expected, PEBP2/CBF transcription factors present
in monocytes bind in vitro to the CD36 promoter, therefore
allowing us to extend the conclusions to normal (nontransformed)
monocytes. Altogether, these findings demonstrate that factors
belonging to the PEBP2/CBF family bind to the region
-103/-98 of the CD36 promoter and regulate its functional
activity .
Figure 5: Nuclear extracts from peripheral blood monocytes contain PEBP2/CBF factors that bind to the CD36 promoter PEBP2/CBF site. Radiolabeled double-stranded CD36 promoter -110/-91 oligonucleotide was incubated with nuclear extracts from THP-1 cells and from peripheral blood monocytes. Prior to adding the radiolabeled oligonucleotide, nuclear extracts from monocytes were incubated with a 50-fold molar excess of the cold double-stranded oligonucleotides -110/-91, -110/-91 mut, and AML1 cons. (see Fig. 4legend for details) or with rabbit preimmune sera (PI) or AML1-specific antisera R3034. -, no inhibitor added.
In this report we have examined the transcriptional regulation of the CD36 gene in monocytic cell lines. Deletion analysis has revealed 1) that the CD36 promoter contributes to its monocytic-specific expression, and 2) that most of the promoter activity is contained within the -158/+43 region, which encompasses the subregion -158/-90 required for the efficient transcription of the gene in monocytic cells. We have also shown that within the above region members of the PEBP2/CBF family of transcription factors bind to nucleotides -103/-98. Moreover, mutation of the PEBP2 site severely impaired the expression of a reporter gene under the control of the CD36 promoter, outlining the significant contribution of the PEBP2/CBF site to the transcriptional activity of the CD36 gene.
PEBP2/CBF are
heterodimeric DNA-binding proteins. They were initially identified as
factors interacting with the polyomavirus enhancer core site (Wang and
Speck, 1992). They are constituted by an
subunit, which binds to
the DNA consensus sequence ACCACA (Meyers et al., 1993) and
harbors a transactivation domain, and a
subunit, which enhances
the DNA-binding affinity of the
subunit through heterodimer
formation (Ogawa et al., 1993a; Wang et al., 1993).
While the
subunit is encoded by a single gene, the
subunits
are encoded by three genes, designated as PEBP2
A, PEBP2
B, and
PEBP2
C in mouse and AML3, AML1, and AML2 in human, respectively
(Bae et al., 1994, 1995; Levanon et al., 1994). The
subunits share a 128-amino acid region known as the runt domain,
first found (and hence its name) in the Drosophila melanogaster segmentation gene, runt (Kania et al., 1990;
Kagoshima et al., 1993). This domain is required for
DNA binding and heterodimerization (Ogawa et al., 1993b).
Alternatively spliced forms for the
subunits (Ogawa et
al., 1993b, Bae et al., 1994, Levanon et al.,
1994) and the
subunit (Ogawa et al. 1993a, Wang et
al., 1993) have been described. The relevance in gene regulation
of the different protein forms is at present unknown (Bae et
al., 1994).
On the basis of the cellular distribution, one
should expect to find transcripts corresponding to all of the three AML
subunits in monocytic cell lines (Levanon et al., 1994).
Nevertheless, identification of the
subunits, which interact with
the CD36 promoter must await generation of specific reagents for each
subunit.
So far, only a few genes have been shown to be regulated by the PEBP2/CBF transcription factors. Gene expression of the myeloid genes encoding murine neutrophil elastase, myeloperoxidase (Suzow and Friedman, 1993; Nuchprayoon et al., 1994), and human colony-stimulating factor receptor (Zhang et al., 1994) is controlled by PEBP2/CBF transcription factors. Functional sites for PEBP2/CBF factors have been also described in the enhancers of T cell receptor genes (Gottschalk and Leiden, 1990; Redondo et al., 1992) and in the enhancers of murine leukemia viruses (Wang and Speck, 1992).
Like the murine myeloid genes neutrophil elastase,
myeloperoxidase (Nuchprayoon et al., 1994), and the T cell
receptor
enhancer (Giese et al., 1995), trans-activation
experiments carried out in HeLa cells with vector pEF-BOS
B1 (which
drives the expression of the
B chain) did not enhance the activity
of the pCD36-158-luc construct,
suggesting the
requirement of other factors for the transcriptional activation
mediated by PEBP2/CBF. In this respect, reconstitution of the T cell
receptor
enhancer activity in nonlymphoid cells required the
assembly of a stereospecific complex constituted by the transcription
factors PEBP2/CBF, Ets-1, and the lymphoid-specific high-mobility group
protein LEF-1 (Giese et al., 1995). That the mutation of the
PEBP2 site abolished most of the transcriptional activity does not
imply that other sites for transcription factors might not be required
for efficient transcription of the CD36 gene. Transcription factors
Ets-1, Ets-2 (Wotton et al., 1994), and Myb
(Hernández-Munain and Krangel, 1994, 1995) are
known to synergize with PEBP2/CBF factors. Meyer et al.(1995),
on the basis of the functional studies of PEBP2/CBF sites in several
promoters, have outlined the conclusion that the PEBP2/CBF factors are
necessary but not sufficient for tissue-specific activity. Our data on
the PEBP2/CBF site in the CD36 promoter support this statement.
The
human AML1 gene is involved in translocations t(8;21)(q22;q22) and
t(3;21) (q26,q22) (reviewed by Nucifora and Rowley(1995)) and accounts
for 12% of all forms of acute myeloid leukemia (Miyoshi et
al., 1993). In addition, the human PEBP2/CBF
gene undergoes
an inversion (inv(16)(p13q22)), also associated with a particular
subtype of acute myeloid leukemia (Liu et al., 1993). The
short transcript form of AML1 (designated as AML1a), which lacks the
transactivation domain, as well as the fusion proteins resulting as a
consequence of the translocations dominantly suppress transcriptional
activation by presumably interfering with binding of transactivating
PEBP2/CBF forms (Meyers et al., 1995). Through this mechanism
the PEBP2/CBF forms lacking transactivation capacity inhibit myeloid
differentiation and may cause leukemia (Tanaka et al., 1995).
All of these studies highlight the importance of the AML1 gene in
myeloid cell growth and/or differentiation, and strengthen its proposed
role in the regulation of CD36 gene expression in monocytic cell lines.
Little information is available on the factors and molecular events
that regulate the expression and functional activity of the PEBP2/CBF
genes. Dr. Ito and co-workers (Lu et al., 1995) have recently
discovered that the
subunit of PEBP2/CBF is mainly found in the
cytoplasm, from where it translocates to the nucleus and binds to the
chain, thus increasing binding affinity of the
subunit for
the DNA. Molecular events that dictate such a unique regulatory
mechansim are so far unknown, but they are likely to be crucial in
regulating the transcriptional activity of the PEBP2 transcription
factors, and the genes under their control. It would therefore be
rational to investigate whether changes in the expression and in the
transcriptional activity of PEBP2 factors occur under conditions that
modulate the RNA expression levels of CD36, such as interaction of
monocytes with E-selectin, interleukin-4, lipopolysaccharide, and
-interferon (Huh et al., 1995).
Interestingly, the
high levels of CD36 expression found in immature erythrocytes (Edelman et al., 1986) may be a consequence of the expression of
PEBP2/CBF
B chain detected in this type of cells (Satake et
al., 1995). Nevertheless, the expression of CD36 in a variety of
different tissues makes conceivable the existence of distinct
regulatory mechanisms on each tissue type. In this respect, expression
of CD36 in murine B cells (although so far not detected in human B
cells) has been shown to be dependent on the transcription factor Oct-2
(König et al., 1995), a factor not found
in all cell types where CD36 is expressed.
We are currently analyzing the transcription factors governing the basal promoter activity found downstream from position -90. Preliminary experiments indicate that a Sp1 site close to the TATA box could possibly account for this activity.
The characterization of the CD36 gene promoter provided in this report establishes the molecular basis to further dissect the promoter in activating conditions, such as those existing in the microenvironments where monocytes are found when participating in foam cell formation and clearance of apoptotic cells.
This article has been cited by other articles:
![]() |
L. Qiao, C. Zou, P. Shao, J. Schaack, P. F. Johnson, and J. Shao Transcriptional Regulation of Fatty Acid Translocase/CD36 Expression by CCAAT/Enhancer-binding Protein {alpha} J. Biol. Chem., April 4, 2008; 283(14): 8788 - 8795. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Puig-Kroger, A. Dominguez-Soto, L. Martinez-Munoz, D. Serrano-Gomez, M. Lopez-Bravo, E. Sierra-Filardi, E. Fernandez-Ruiz, N. Ruiz-Velasco, C. Ardavin, Y. Groner, et al. RUNX3 Negatively Regulates CD36 Expression in Myeloid Cell Lines J. Immunol., August 15, 2006; 177(4): 2107 - 2114. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tonks, L. Pearn, A. J. Tonks, L. Pearce, T. Hoy, S. Phillips, J. Fisher, J. R. Downing, A. K. Burnett, and R. L. Darley The AML1-ETO fusion gene promotes extensive self-renewal of human primary erythroid cells Blood, January 15, 2003; 101(2): 624 - 632. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Zaidi, A. J. Sullivan, A. J. van Wijnen, J. L. Stein, G. S. Stein, and J. B. Lian Integration of Runx and Smad regulatory signals at transcriptionally active subnuclear sites PNAS, June 11, 2002; 99(12): 8048 - 8053. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Shore, W. Dietrich, and L. M. Corcoran Oct-2 regulates CD36 gene expression via a consensus octamer, which excludes the co-activator OBF-1 Nucleic Acids Res., April 15, 2002; 30(8): 1767 - 1773. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Zingg, R. Ricciarelli, E. Andorno, and A. Azzi Novel 5' Exon of Scavenger Receptor CD36 Is Expressed in Cultured Human Vascular Smooth Muscle Cells and Atherosclerotic Plaques Arterioscler. Thromb. Vasc. Biol., March 1, 2002; 22(3): 412 - 417. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ricciarelli, J.-M. Zingg, and A. Azzi Vitamin E Reduces the Uptake of Oxidized LDL by Inhibiting CD36 Scavenger Receptor Expression in Cultured Aortic Smooth Muscle Cells Circulation, July 4, 2000; 102(1): 82 - 87. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Han, D. P. Hajjar, J. M. Tauras, and A. C. Nicholson Cellular cholesterol regulates expression of the macrophage type B scavenger receptor, CD36 J. Lipid Res., May 1, 1999; 40(5): 830 - 838. [Abstract] [Full Text] |
||||
![]() |
N. Hrboticky, G. Draude, G. Hapfelmeier, R. Lorenz, and P. C. Weber Lovastatin Decreases the Receptor-Mediated Degradation of Acetylated and Oxidized LDLs in Human Blood Monocytes During the Early Stage of Differentiation Into Macrophages Arterioscler. Thromb. Vasc. Biol., May 1, 1999; 19(5): 1267 - 1275. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Han, D. P. Hajjar, M. Febbraio, and A. C. Nicholson Native and Modified Low Density Lipoproteins Increase the Functional Expression of the Macrophage Class B Scavenger Receptor, CD36 J. Biol. Chem., August 22, 1997; 272(34): 21654 - 21659. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gutierrez, A. Javed, D. K. Tennant, M. van Rees, M. Montecino, G. S. Stein, J. L. Stein, and J. B. Lian CCAAT/Enhancer-binding Proteins (C/EBP) beta and delta Activate Osteocalcin Gene Transcription and Synergize with Runx2 at the C/EBP Element to Regulate Bone-specific Expression J. Biol. Chem., January 4, 2002; 277(2): 1316 - 1323. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||