JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Armesilla, A. L.
Right arrow Articles by Vega, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Armesilla, A. L.
Right arrow Articles by Vega, M. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 271, Number 13, Issue of March 29, 1996 pp. 7781-7787
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
Structural and Functional Characterization of the Human CD36 Gene Promoter
IDENTIFICATION OF A PROXIMAL PEBP2/CBF SITE (*)

(Received for publication, October 19, 1995; and in revised form, January 17, 1996)

Angel L. Armesilla (1)(§) Dominica Calvo (1)(§) Miguel A. Vega (¶)

From the Hospital de la Princesa, C/Diego de León 62, Madrid 28006, Spain andInstituto de Parasitología y Biomedicina López-Neyra, Consejo Superior de Investigaciones Científicas, C/Ventanilla 11, Granada 18001, Spain

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

CD36 is a cell surface glycoprotein composed of a single polypeptide chain, which interacts with thrombospondin, collagens type I and IV, oxidized low density lipoprotein, fatty acids, anionic phospholipids, and erythrocytes parasitized with Plasmodium falciparum. Its expression is restricted to a few cell types, including monocyte/macrophages. In these cells, CD36 is involved in phagocytosis of apoptotic cells, and foam cell formation by uptake of oxidized low density lipoprotein. To study the molecular mechanisms that control the transcription of the CD36 gene in monocytic cells we have isolated and analyzed the CD36 promoter. Transient expression experiments of 5`-deletion fragments of the CD36 promoter coupled to luciferase demonstrated that as few as 158 base pairs upstream from the transcription initiation site were sufficient to direct the monocyte-specific transcription of the reporter gene. Within the above region, the fragment spanning nucleotides -158 to -90 was required for optimal transcription in monocytic cells. Biochemical analysis of the region -158/-90 revealed a binding site for transcription factors of the polyomavirus enhancer-binding protein 2/core-binding factor (PEBP2/CBF) family at position -103. Disruption of the PEBP2/CBF site markedly diminished the CD36 promoter activity, indicating an essential role of the PEBP2/CBF factors in the constitutive transcription of the CD36 gene. The involvement of members of the PEBP2/CBF family in chromosome translocations associated with acute myeloid leukemia, and in the transcriptional regulation of the myeloid-specific genes encoding for myeloperoxidase, elastase, and the colony-stimulating factor receptor, highlights the relevance of the regulation of the CD36 gene promoter in monocytic cells by members of the PEBP2/CBF family.


INTRODUCTION

CD36 is a plasma membrane glycoprotein constituted by a single 88-kDa polypeptide chain (Greenwalt et al., 1992). It is a member of a family of proteins, which includes CLA-1 and LIMPII (Vega et al., 1991; Calvo and Vega, 1993; Calvo et al. 1995). CD36 binds to a large variety of ligands: thrombospondin (Ash et al., 1987; Silverstein et al., 1992), collagens type I (Tandon et al., 1989) and IV (Ash et al., 1993), fatty acids (Abumrad et al., 1993), oxidized low density lipoprotein (Endemann et al., 1993), anionic phospholipids (Rigotti et al., 1995), and Plasmodium falciparum-infected erythrocytes (Barnwell et al., 1985; Oquendo et al., 1989). CD36 is present on monocyte/macrophages, platelets, microvascular endothelium, adipocytes, mammary epithelial cells, and erythroblasts (Barnwell et al., 1985; Oquendo et al., 1989; Kieffer et al., 1989; Greenwalt et al., 1992; van Schravendijk et al., 1992; Swerlick et al., 1992; Abumrad et al., 1993; Greenwalt et al., 1995).

On the basis of its broad ligand-binding specificity, CD36 is considered as a scavenger receptor (Endemann et al. 1993; Acton et al., 1994; Nicholson et al., 1995). Scavenger receptors are primarily expressed on macrophages and participate in cell clearance of damaged cellular components and cells and foreign substances such as chemical compounds and pathogens (Krieger and Herz, 1994). In this respect, CD36 expressed in monocyte/macrophage cells cooperates with the alpha(v)beta(3) vitronectin receptor in the recognition and subsequent phagocytic clearance of apoptotic cells (including neutrophils, T lymphocytes, and eosinophils) migrated to inflamed areas (Savill et al., 1992; Ren et al., 1995). In addition, CD36 expressed on macrophages infiltrated in damaged endothelium participates in the macrophage uptake of locally formed oxidized low density lipoprotein, thus contributing to foam cell formation and atherosclerosis development (Endemann et al., 1993; Nicholson et al., 1995).

In vivo regulation of CD36 expression in monocytes may be a complex process resulting from the coordinated interplay between multiple soluble factors and cell surface adhesion molecules. Thus, CD36 expression is dramatically increased on monocytes upon their interaction with activated endothelium and by treatment of monocytes with macrophage colony-stimulating factor or interleukin-4 (Huh et al., 1995). Moreover, CD36 expression varies in some myeloproliferative disorders (Clezardin et al., 1985) and is induced during the differentiation of promonocytes to monocytes and macrophages (Edelman et al., 1986). Up-regulation of CD36 may increase macrophage clearance of apoptotic cells and facilitate monocyte migration through the endothelial barrier, enhancing oxidized low density lipoprotein uptake and monocyte-extracellular matrix interactions. On the contrary, treatment with lipopolysaccharide or -interferon results in down-regulation of CD36 mRNA (Huh et al., 1995).

Despite the existence of a substantial amount of data regarding CD36 expression, little information is available on the mechanisms underlying its transcriptional regulation. We have recently delineated the structural organization of the CD36 gene, which revealed the presence of a TATA box located 28 base pairs upstream from the transcription initiation site (Armesilla and Vega, 1994). To define the CD36 gene regions, and to identify the transcription factors important for the expression of CD36 in monocyte/macrophage cells, we have isolated and characterized the 5`-flanking region of the human CD36 gene. Our data demonstrate that the transcription of the CD36 gene in monocytic cell lines is mainly controlled by its proximal promoter region and that transcription factors belonging to the polyomavirus enhancer-binding protein 2/core-binding factor (PEBP2/CBF) (^1)family play a major role in the transcriptional regulation of the CD36 gene.


EXPERIMENTAL PROCEDURES

Cell Culture and Transient Transfections

The cell lines used in this study, U937, Mono Mac 6, and THP-1 (monocytic), Jurkat (T cell leukemia), K562 (erytholeukemic cell line), JY (B lymphoblastoid cell line), and HeLa (epitheloid carcinoma) were cultured in RPMI 1640 medium supplemented with 10% fetal calf serum, and 2 mML-glutamine. Peripheral blood monocytes were isolated from blood obtained from healthy volunteer donors by centrifugation on Ficoll-Hypaque and subsequent adhesion to tissue culture dishes.

U937, Mono Mac 6, Jurkat, and K562 cells were transfected by electroporation. 20 times 10^6 U937 or Mono Mac 6 cells were electroporated in 500 µl of RPMI 1640 medium. Electroporation parameters were set at 2950 microfarads, 100 V, and a resistance of 186 ohms. 20 times 10^6 K562 cells were electroporated like U937 cells with the electric parameters set up to 400 V, 600 microfarads, and 13 ohms. Jurkat cells were electroporated in 250 µl of OPTI-MEM medium (Life Technologies, Inc.) supplemented with 10% fetal calf serum with the following electroporation parameters: 1700 microfarads, 126 V, and a resistance of 72 ohms. For all electroporation experiments, the cells were incubated a 4 °C for 20 min prior to and after the electric shock. For each electroporation experiment 40 µg of the luciferase-reporter vector and 15 µg of the beta-galactosidase reference plasmid pCMV-betagal were used.

HeLa cells were transfected by lipofection as follows. 5 times 10^5 cells were incubated in 60-mm tissue culture plates with 3 ml of OPTI-MEM medium containing 15 µg of Lipofectin (Life Technologies, Inc.), 5 µg of luciferase reporter vector, and 1.5 µg of pCMV-betagal vector. After 16 h, the transfection mixture was replaced by culture medium, where cells were maintained for 36-48 h.

Luciferase and beta-galactosidase activities were measured 15 h after transfection for all cells except HeLa, according to Pahl et al.(1991) and Promega published procedures. For HeLa cells those activities were determined 36-48 h posttransfection. Luciferase activities were normalized for transfection efficiency to the beta-galactosidase levels provided by the cotransfected internal standard vector pCMV-betagal. Reported data represented the mean from several independent experiments.

Deletion Constructs of the CD36 Promoter Region

An EcoRI-PstI fragment of the CD36 gene that contains the TATA box and approximately 2.8 kilobase pairs upstream from it, was obtained from CD36 genomic phage Ch21ACD36.1 (described by Armesilla and Vega(1994)). This fragment was ligated to a pair of partially complementary oligonucleotides (GTGTAGGACTTTCCTGCA and AGCTTGCAGGAAAGTCCTACACTGCA, derived from the promoter region +11/+28 and displaying PstI and HindIII sites when annealed), and to EcoRI-HindIII-digested vector pUCBM21. Fragment EcoRI-HindIII was blunt-ended with Klenow and subcloned into the blunt-ended BglII site of the luciferase reporter vector pGL2-Basic (Promega) to yield the plasmid p2.8KbCD36-luc, which included -2.8 kilobase pairs to +28 bp of the CD36 promoter region. Plasmid p2.8KbCD36-luc was used as the starting material to generate the progressive 5` end deletion constructs p2.5KbCD36-luc to p0.6KbCD36-luc using the Erase a Base kit (Promega). Plasmids of the series p2.8KbCD36-luc to p0.6KbCD36-luc contained the CD36 promoter region comprised between nucleotides -X and +28. Plasmids p267CD36-luc to p38CD36-luc were generated by PCR using the DNA isolated from phage Ch21ACD36.1 as template and pairs of oligonucleotides containing sites for restriction enzymes KpnI and XhoI. The resulting PCR fragments were ligated to KpnI-XhoI-digested vector pGL2-Basic. The structure of all of the PCR-generated constructs was confirmed by DNA sequencing. Plasmids of the series p267CD36-luc to p38CD36-luc contained the CD36 promoter region comprised between nucleotides -X and +43.

Site-directed Mutagenesis

Mutation in the PEBP2 site at position -103 of the CD36 promoter was performed by polymerase chain reaction. Plasmid p158CD36-luc was used as a template. Primer A (GTTGGTACCTCAGTAATGTGCTGTGT) and primer B (GCGAAGCTTTTGTTGCCAGAGGAATTGAAAG) were used to generate fragment 1. Primers C (GCGAAGCTTCACTGGGATCTGACACTGTAG) and D (GGTCTCGAGGATCAAATGGTATTCTGCAGG) were used to generate fragment 2. Primers B and C were partially complementary and carried the point mutations for the PEBP2 site. PCR fragment 1 was digested with KpnI and HindIII. PCR fragment 2 was digested with HindIII and XhoI. Both digested fragments were ligated to KpnI-XhoI vector pGL2-Basic to generate the pCD36-158(m-102/-98)-luc plasmid. Nucleotide sequence of the mutant was confirmed by DNA sequencing.

Nuclear Extracts and EMSA

Nuclear extracts were prepared as described by Schreiber et al.(1989), with the inclusion of the phosphatase inhibitor sodium orthovanadate at 10 mM, the protease inhibitors aprotinin, leupeptin, and pepstatin at 1 µg/µl, and phenylmethylsulfonyl fluoride at 2 mM.

For EMSA experiments double-stranded oligonucleotides were P-labeled using avian myeloblastosis virus reverse transcriptase. 0.5 ng of probe at a specific activity of about 10^8 cpm/µg were incubated for 15 min at 4 °C with 2-6 µg of nuclear extracts in 20 µl containing 28 mM EDTA, 15 mM KCl, 6 mM MgCl(2), 7 mM HEPES (pH 7.9 at 4 °C), 7% glycerol, 1 mM dithiothreitol, 2.5 µg of poly(dI-dC), and 1 µg of acetylated DNase-free bovine serum albumin. For competition assays, unlabeled oligonucleotides were added to the nuclear extracts at a 50-fold molar excess 15 min before the addition of the radiolabeled probe. When required, antibodies were added to the nuclear extracts 15 min prior to the addition of the radioactive probe. Two µl and 1 µl of the antibodies alpha-AML1 (Meyers et al., 1993) and R3034 (kindly provided by Dr. N. A. Speck) were used, respectively. Binding reactions were electrophoresed at 15 V/cm on 4-5% polyacrylamide gels in 0.4 times TBE (45 mM Tris base, 45 mM boric acid, 1 mM EDTA) at 4 °C. Gels were dried and exposed to Kodak XAR film. The sequence of the oligonucleotides used for EMSA is shown in the figure legends.


RESULTS

A 158-bp Fragment from the 5` Region of the CD36 Gene Controls Gene Expression in Monocytic Cell Lines

The involvement of CD36 expressed on monocyte/macrophage cells in atherosclerosis development and phagocytosis of apoptotic cells prompted us to investigate the transcriptional regulation of the CD36 gene in this cell type. As cell models we have used the widely characterized monocytic cell lines Mono Mac 6, U937, and THP-1 (Ziegler-Heitbrock et al., 1988; Lübbert et al., 1991). All of them displayed CD36 on the cell surface as determined by staining with fluoresceinated CD36-specific antibodies. (^2)By contrast, Jurkat, K562, and HeLa cells were used as nonexpressing CD36 cell lines, as evidenced by the absence of CD36-specific cell surface staining and by Northern blot analysis.^2

To examine the promoter activity of the 5`-flanking region of the CD36 gene and to identify potential cis-acting regulatory elements essential for its constitutive transcriptional activity, a series of deletion fragments of the region 5`-upstream from the TATA box of the CD36 gene (in the range from -2.8 kilobase pairs to -38 bp) was generated and coupled to the luciferase reporter vector pGL2-Basic. Plasmids were transfected in several cell lines, and the luciferase activity directed by each construct was measured as described under ``Experimental Procedures.''

CD36 deletion promoter constructs yielded between 40- and 80-fold higher luciferase activities than the pGL2-Basic promoterless construct in Mono Mac 6 and U937 cells (Fig. 1, A and C), while they only reached a maximum of 14 times in Jurkat and K562 cells (Fig. 1, B and D), demonstrating that 1) the 5`-upstream region of the CD36 gene possesses promoter activity and 2) the reporter luciferase gene under the control of the CD36 promoter is more efficiently transcribed in the CD36-expressing monocytic cell lines Mono Mac 6 and U937 than in the non-CD36-expressing cell lines Jurkat and K562. In this regard, the promoter activities of the CD36 constructs in Mono Mac 6 and U937 cells were higher than or comparable with the activity directed by vector pGL2-Promoter (Promega) (which contains the SV40 promoter), while they were significantly lower in the cell lines Jurkat and K562 (Fig. 1, A-D). Taken together, these observations indicate that the activity of the CD36 promoter correlates with the expression levels of CD36 and suggests that the promoter contains regulatory elements that contribute to the tissue-specific expression of this gene in monocytic cell lines.


Figure 1: Deletion analysis of CD36 promoter. A panel of CD36 promoter deletion constructs coupled to the reported luciferase gene were transiently transfected into the cell lines Mono Mac 6, U937, Jurkat, and K562, as described under ``Experimental Procedures.'' Promoter activity of each construct was expressed as -fold activity above the background activity conferred by the promoterless control plasmid pGL2-Basic, corrected for transfection efficiency (Böttinger et al., 1994). Number enclosed in parenthesis in charts B and D denote the relative luciferase activities yielded by the pGL2-promoter construct (which contains the SV40 promoter).



As shown in Fig. 1A, comparable luciferase activities were obtained after transfection of constructs having 5` ends ranging from -2.8 kilobase pairs to -158 bp in Mono Mac 6 cells, indicating that the region -158/+43 retains most of the promoter activity (Fig. 1A). Data obtained with U937 cells further supported this finding (Fig. 1C).^2 Nevertheless, our experiments did not rule out the possibility that other regions located upstream from position -158 may play important positive or negative regulatory roles, which might have remained hidden by mutual compensatory effects. A further deletion extending to -90 bp resulted in a 70% reduction of the basal promoter activity in both Mono Mac 6 and U937 cells, dropping the activity to the levels found out in the CD36-negative cell lines Jurkat and K562 (Fig. 1, A-D). These results point out the presence of strong positive regulatory elements within the region -158/-90, which are required for the efficient transcription of the CD36 gene in monocytic cell lines. Deletion to -38 bp (a construct that still preserved an intact TATA box) abrogated promoter activity, indicating the presence of regulatory elements in the region -90/-38 necessary for the basal transcription of the CD36 gene.

The Region Comprising the Nucleotides -102/-98 Is Required for Optimal Transcription of the CD36 Gene

A search within the -158/-90 region for nucleotide sequences corresponding to binding sites for known transcription factors revealed the sequence ACCACA at position -103, which conforms to the core site for the binding of the transcription factors belonging to the PEBP2/CBF family (Meyers et al., 1993; Ogawa et al., 1993b), also referred as the AML1 family.

To evaluate the functional significance of the putative PEBP2 site, the core PEBP2 binding site within the pCD36-158-luc construct was mutated from ACCACA to AAGCTT (originating the construct pCD36-158(m-102/-98)-luc). When these constructs were transfected in Mono Mac 6 and U937 cells, the promoter activity directed by the mutant construct pCD36-158(m-102/-98)-luc was 30% of the activity obtained by the wild type construct pCD36-158-luc (Fig. 2). By contrast, comparable activities were yielded by both the mutant and wild type constructs in HeLa cells, an observation consistent with the low levels of PEBP2/CBF factors detected in this cell line (Fig. 3). In Jurkat cells, the mutant also decreased the low promoter activity directed by the wild type construct. This observation, in agreement with the presence of PEBP2/CBF factors in this cell line ( Fig. 3and Fig. 4), suggests that the PEBP2/CBF site by itself does not confer the tissue specificity of the CD36 gene in monocytic cells. Interestingly, the level of reduction in promoter activity in monocytic cells when the PEBP2/CBF site was mutated was similar to the decrease in promoter activity observed when the activity directed by the pCD36-90-luc construct (which does not contain the PEBP2 site) was compared with the activity yielded by the pCD36-158-luc construct (which does contain the PEBP2 site) (Fig. 1, A and C). These results demonstrate the importance of the region -102/-98 for the constitutive transcription of the CD36 gene.


Figure 2: Mutation of site -102/-98 severely impairs the activity of the CD36 promoter. CD36 promoter wild type construct pCD36-158-luc (represented as 158wt) and mutant construct pCD36-158(m-102/-98)-luc (represented as 158mut) were transiently transfected in Mono Mac 6, U937, Jurkat, and HeLa cells. For each cell line assayed, promoter activities were represented as indicated for Fig. 1.




Figure 3: Binding of CD36 promoter region -110/-91 to nuclear extracts from several cell lines. Radiolabeled double-stranded CD36 promoter -110/-91 oligonucleotide, GCAACAAACCACACACTGGG, was incubated with nuclear extracts from cell lines lines of different origin (Mono Mac 6, U937, and THP-1, monocytic; JY, B lymphoblastoid; Jurkat, T cell leukemia; HeLa, epitheloid carcinoma).




Figure 4: CD36 promoter contains a PEBP2/CBF site at region -103/-98. A, radiolabeled double-stranded CD36 promoter -110/-91 oligonucleotide was incubated with nuclear extracts from cell lines THP-1 and Jurkat. Prior to adding the radiolabeled oligonucleotide, nuclear extracts were incubated with a 50-fold molar excess of the following cold double-stranded oligonucleotides: -110/-91, to demonstrate specificity of complexes; -110/-91 mut (GCAACAAAAGCTTCACTGGG), to assay the effect of positions -102/-98 in the binding; and AML1 cons. (GGATATCTGTGGTAAGCA), an oligonucletide containing a PEBP2/CBF consensus site from the Moloney murine leukemia virus enhancer, to assay the molecular nature of the complexes bound to oligonucleotide -110/-91. -, no inhibitor added. B, nuclear extracts from cell lines THP-1 and Jurkat were incubated with radiolabeled double-stranded oligonucleotide -110/-91, without(-) or with a prior incubation with a 50-fold molar excess of cold oligonucleotide -110/-91, rabbit preimmune sera (PI), or AML1-specific antisera alpha-AML1 or R3034. The last lane shows the effect of the antisera alpha-AML1 on the labeled double-stranded oligonucleotide -110/-91 in the absence of nuclear extract.



Transcription Factors of the PEBP2 Family Bind to the -102/-98 Region

To investigate the trans-acting factors that account for the promoter activity ascribed to the -102/-98 region, a double-stranded oligonucleotide spanning the -110/-91 region and comprising the PEBP2 core sequence ACCACA, was radiolabeled and used as a probe in EMSA with nuclear extracts derived from several cell lines, including the monocytic cell lines Mono Mac 6, U937, and THP-1 (Fig. 3). Major low mobility complexes were observed for all of them, although practically undetectable levels were found in nuclear extracts from HeLa cells. The specificity of the complexes was verified by competition with an excess of the unlabeled oligonucleotide.^2 The multiplicity, distinct relative mobilities, and wide cellular distribution of the complexes bound to oligonucleotide -110/-91 was consistent with the EMSA pattern for transcription factors of the PEPB2/CBF family (Fig. 3) (Meyers et al., 1993, 1995; Ogawa et al., 1993b; Nuchprayoon et al., 1994). The dissimilarity between the retardation complexes detected in the monocytic cell lines analyzed ( Fig. 3and 4A) may be the result of partial proteolytic degradation of the nuclear extracts obtained from cell lines Mono Mac 6 and U937. In fact, high levels of protease activity have been reported in nuclear extracts derived from monocytic cell lines, making isolation of nuclear extracts without proteolytic degradation extremely difficult (Galson and Housman, 1988; Pahl et al. 1993). Particularly, susceptibility to proteolytic cleavage of PEBP2/CBF factors in nuclear extracts from some monocytic cell lines has been documented (Nuchprayoon et al., 1994). Moreover, the relative intensities of the complexes derived from Mono Mac 6 showed significant variations depending on the preparation and age of the extract and on the numbers of freezing and thawing processes undergone by the extract.^2 For the above reasons, only the experiments performed with nuclear extracts from THP-1 are shown, although similar conclusions were reached when nuclear extracts from Mono Mac 6 and U937 cells were used.^2

Binding of radiolabeled oligonucleotide -110/-91 to nuclear extracts from THP-1 and Jurkat cells gave rise to several complexes whose formation was completely prevented by a 50-fold excess of the same unlabeled oligonucleotide, demonstrating their specificity (Fig. 4A). An oligonucleotide containing a consensus core for the PEBP2/CBF site (designated as AML1 cons.) and derived from the Moloney virus enhancer (Wang and Speck, 1992) competed the binding of all complexes to the oligonucleotide -110/-91, indicating that the sequence ACCACA was responsible for the appearance of the observed complexes (Fig. 4A). This observation was confirmed by the absence of inhibition by a mutant oligonucleotide (-110/-91 mut), which spanned the -110/-91 region and contained a cluster of mutations identical to those generated in the mutant construct pCD36-158(m-102/-98)-luc (Fig. 4A). These data indicate that the decrease of transcriptional activity in this mutant is due to the loss of its capability to interact with the factors bound to the PEBP2/CBF site (nucleotides -103/-98).

To identify the molecular nature of the complexes observed, nuclear extracts obtained from THP-1 and Jurkat were independently incubated with two distinct antibodies specific for AML1 factors before the addition of the labeled oligonucleotide -110/-91. As shown in Fig. 4B, the alpha-AML1 antisera, raised against the N-terminal region of the AML1 alpha subunit (Meyers et al., 1993), induced specific supershift in only a fraction of the complexes (as negative control see last lane showing the binding of the probe to the antibody). Identical results have been obtained by several investigators (Meyers et al., 1993; Nuchprayoon et al., 1994; Zhang et al., 1994). Moreover, the rabbit polyclonal antibody R3034 raised against the DNA-binding domain of AML1, but not a preimmune rabbit serum, prevented the formation of most of the complexes. Given the high degree of amino acid sequence similarity within the regions used to generate both the alpha-AML1 and the R3034 antisera, between the different members constituting the PEBP2/CBF family, it is conceivable that both antisera react with several members of the PEBP2/CBF transcription family (Levanon et al., 1994). Finally, a similar set of experiments was carried out using extracts isolated from peripheral blood monocytes (Fig. 5). As expected, PEBP2/CBF transcription factors present in monocytes bind in vitro to the CD36 promoter, therefore allowing us to extend the conclusions to normal (nontransformed) monocytes. Altogether, these findings demonstrate that factors belonging to the PEBP2/CBF family bind to the region -103/-98 of the CD36 promoter and regulate its functional activity .


Figure 5: Nuclear extracts from peripheral blood monocytes contain PEBP2/CBF factors that bind to the CD36 promoter PEBP2/CBF site. Radiolabeled double-stranded CD36 promoter -110/-91 oligonucleotide was incubated with nuclear extracts from THP-1 cells and from peripheral blood monocytes. Prior to adding the radiolabeled oligonucleotide, nuclear extracts from monocytes were incubated with a 50-fold molar excess of the cold double-stranded oligonucleotides -110/-91, -110/-91 mut, and AML1 cons. (see Fig. 4legend for details) or with rabbit preimmune sera (PI) or AML1-specific antisera R3034. -, no inhibitor added.




DISCUSSION

In this report we have examined the transcriptional regulation of the CD36 gene in monocytic cell lines. Deletion analysis has revealed 1) that the CD36 promoter contributes to its monocytic-specific expression, and 2) that most of the promoter activity is contained within the -158/+43 region, which encompasses the subregion -158/-90 required for the efficient transcription of the gene in monocytic cells. We have also shown that within the above region members of the PEBP2/CBF family of transcription factors bind to nucleotides -103/-98. Moreover, mutation of the PEBP2 site severely impaired the expression of a reporter gene under the control of the CD36 promoter, outlining the significant contribution of the PEBP2/CBF site to the transcriptional activity of the CD36 gene.

PEBP2/CBF are heterodimeric DNA-binding proteins. They were initially identified as factors interacting with the polyomavirus enhancer core site (Wang and Speck, 1992). They are constituted by an alpha subunit, which binds to the DNA consensus sequence ACCACA (Meyers et al., 1993) and harbors a transactivation domain, and a beta subunit, which enhances the DNA-binding affinity of the alpha subunit through heterodimer formation (Ogawa et al., 1993a; Wang et al., 1993). While the beta subunit is encoded by a single gene, the alpha subunits are encoded by three genes, designated as PEBP2alphaA, PEBP2alphaB, and PEBP2alphaC in mouse and AML3, AML1, and AML2 in human, respectively (Bae et al., 1994, 1995; Levanon et al., 1994). The alpha subunits share a 128-amino acid region known as the runt domain, first found (and hence its name) in the Drosophila melanogaster segmentation gene, runt (Kania et al., 1990; Kagoshima et al., 1993). This domain is required for DNA binding and heterodimerization (Ogawa et al., 1993b). Alternatively spliced forms for the alpha subunits (Ogawa et al., 1993b, Bae et al., 1994, Levanon et al., 1994) and the beta subunit (Ogawa et al. 1993a, Wang et al., 1993) have been described. The relevance in gene regulation of the different protein forms is at present unknown (Bae et al., 1994).

On the basis of the cellular distribution, one should expect to find transcripts corresponding to all of the three AML alpha subunits in monocytic cell lines (Levanon et al., 1994). Nevertheless, identification of the alpha subunits, which interact with the CD36 promoter must await generation of specific reagents for each subunit.

So far, only a few genes have been shown to be regulated by the PEBP2/CBF transcription factors. Gene expression of the myeloid genes encoding murine neutrophil elastase, myeloperoxidase (Suzow and Friedman, 1993; Nuchprayoon et al., 1994), and human colony-stimulating factor receptor (Zhang et al., 1994) is controlled by PEBP2/CBF transcription factors. Functional sites for PEBP2/CBF factors have been also described in the enhancers of T cell receptor genes (Gottschalk and Leiden, 1990; Redondo et al., 1992) and in the enhancers of murine leukemia viruses (Wang and Speck, 1992).

Like the murine myeloid genes neutrophil elastase, myeloperoxidase (Nuchprayoon et al., 1994), and the T cell receptor alpha enhancer (Giese et al., 1995), trans-activation experiments carried out in HeLa cells with vector pEF-BOSalphaB1 (which drives the expression of the alphaB chain) did not enhance the activity of the pCD36-158-luc construct,^2 suggesting the requirement of other factors for the transcriptional activation mediated by PEBP2/CBF. In this respect, reconstitution of the T cell receptor alpha enhancer activity in nonlymphoid cells required the assembly of a stereospecific complex constituted by the transcription factors PEBP2/CBF, Ets-1, and the lymphoid-specific high-mobility group protein LEF-1 (Giese et al., 1995). That the mutation of the PEBP2 site abolished most of the transcriptional activity does not imply that other sites for transcription factors might not be required for efficient transcription of the CD36 gene. Transcription factors Ets-1, Ets-2 (Wotton et al., 1994), and Myb (Hernández-Munain and Krangel, 1994, 1995) are known to synergize with PEBP2/CBF factors. Meyer et al.(1995), on the basis of the functional studies of PEBP2/CBF sites in several promoters, have outlined the conclusion that the PEBP2/CBF factors are necessary but not sufficient for tissue-specific activity. Our data on the PEBP2/CBF site in the CD36 promoter support this statement.

The human AML1 gene is involved in translocations t(8;21)(q22;q22) and t(3;21) (q26,q22) (reviewed by Nucifora and Rowley(1995)) and accounts for 12% of all forms of acute myeloid leukemia (Miyoshi et al., 1993). In addition, the human PEBP2/CBF beta gene undergoes an inversion (inv(16)(p13q22)), also associated with a particular subtype of acute myeloid leukemia (Liu et al., 1993). The short transcript form of AML1 (designated as AML1a), which lacks the transactivation domain, as well as the fusion proteins resulting as a consequence of the translocations dominantly suppress transcriptional activation by presumably interfering with binding of transactivating PEBP2/CBF forms (Meyers et al., 1995). Through this mechanism the PEBP2/CBF forms lacking transactivation capacity inhibit myeloid differentiation and may cause leukemia (Tanaka et al., 1995). All of these studies highlight the importance of the AML1 gene in myeloid cell growth and/or differentiation, and strengthen its proposed role in the regulation of CD36 gene expression in monocytic cell lines.

Little information is available on the factors and molecular events that regulate the expression and functional activity of the PEBP2/CBF genes. Dr. Ito and co-workers (Lu et al., 1995) have recently discovered that the beta subunit of PEBP2/CBF is mainly found in the cytoplasm, from where it translocates to the nucleus and binds to the alpha chain, thus increasing binding affinity of the alpha subunit for the DNA. Molecular events that dictate such a unique regulatory mechansim are so far unknown, but they are likely to be crucial in regulating the transcriptional activity of the PEBP2 transcription factors, and the genes under their control. It would therefore be rational to investigate whether changes in the expression and in the transcriptional activity of PEBP2 factors occur under conditions that modulate the RNA expression levels of CD36, such as interaction of monocytes with E-selectin, interleukin-4, lipopolysaccharide, and -interferon (Huh et al., 1995).

Interestingly, the high levels of CD36 expression found in immature erythrocytes (Edelman et al., 1986) may be a consequence of the expression of PEBP2/CBF alphaB chain detected in this type of cells (Satake et al., 1995). Nevertheless, the expression of CD36 in a variety of different tissues makes conceivable the existence of distinct regulatory mechanisms on each tissue type. In this respect, expression of CD36 in murine B cells (although so far not detected in human B cells) has been shown to be dependent on the transcription factor Oct-2 (König et al., 1995), a factor not found in all cell types where CD36 is expressed.

We are currently analyzing the transcription factors governing the basal promoter activity found downstream from position -90. Preliminary experiments indicate that a Sp1 site close to the TATA box could possibly account for this activity.

The characterization of the CD36 gene promoter provided in this report establishes the molecular basis to further dissect the promoter in activating conditions, such as those existing in the microenvironments where monocytes are found when participating in foam cell formation and clearance of apoptotic cells.


FOOTNOTES

*
This work was supported by Comunidad Autónoma de Madrid Grant C086/91 and Ministerio de Educación y Ciencia of Spain Grants PM91/0138 and PB93/1020. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
Recipient of a predoctoral fellowship from the Ministerio de Educación y Ciencia of Spain and from the Comunidad Autónoma de Madrid.

To whom correspondence should be addressed. Fax: 34-58-203323; mavega{at}samba.cnb.uam.es.

(^1)
The abbreviations used are: PEBP2/CBF, polyomavirus enhancer-binding protein 2/core-binding factor; EMSA, electrophoretic mobility shift assay; PCR, polymerase chain reaction; bp, base pair(s).

(^2)
A. L. Armesilla, D. Calvo, and M. A. Vega, unpublished observations.


ACKNOWLEDGEMENTS

We thank Dr. Scott Hiebert for providing the alpha-AML1 serum, Dr. Nancy A.. Speck for providing the antisera to the runt domain of AML1, Dr. Yoshiaki Ito and Dr. Shigekazy Nagata for providing the expression plasmids pEF-BOS and pEF-BOSalphaB1, and Dr. Angel L. Corbi for helpful discussions and critical reading of the manuscript.


REFERENCES

  1. Abumrad, N. A., El-Maghrabi, R., Amri, E., López, E., and Grimaldi, P. A. (1993) J. Biol. Chem. 268, 17665-17668 [Abstract/Free Full Text]
  2. Acton, S. L., Scherer, P. E., Lodish, H. F., and Krieger, M. (1994) J. Biol. Chem. 269, 21003-21009 [Abstract/Free Full Text]
  3. Armesilla, A. L., and Vega, M. A. (1994) J. Biol. Chem. 269, 18985-18991 [Abstract/Free Full Text]
  4. Asch, A. S., Barnwell, J., Silverstein, R. L., and Nachman, R. L. (1987) J. Clin. Invest. 79, 1054-1061
  5. Asch, A. S., Liu, I., Briccetti, F. M., Barnwell, J. W., Kwakye-Berko, F., Dokun, A., Goldberger, J., and Pernambuco, M. (1993) Science 262, 1436-1440 [Abstract/Free Full Text]
  6. Bae, S. C., Ogawa, E., Maruyama, M., Oka, H., Masanobu, S., Shigesada, K., Jenkins, N. A., Debra, J. G., Copeland, N. G., and Ito, Y. (1994) Mol. Cell. Biol. 14, 3242-3252 [Abstract/Free Full Text]
  7. Bae, S. C., Takahashi, E., Zhang, Y. W., Ogawa, E., Shigesada, K., Jenkins, N. A., Gilbert, D. J., Copeland, N. G., and Ito, Y. (1996) Gene ( Amst. ), in press
  8. Barnwell, J. W., Ockenhouse, C. F., and Knowles, D. M. (1985) J. Immunol. 135, 3494-3497 [Abstract]
  9. Böttinger, E. P., Shelley, C. S., Farokhzad, O. C., and Arnaut, M. A. (1994) Mol. Cell. Biol. 14, 2604-2615 [Abstract/Free Full Text]
  10. Calvo, D., and Vega, M. A. (1993) J. Biol. Chem. 268, 18929-18935 [Abstract/Free Full Text]
  11. Calvo, D., Dopazo, J., and Vega, M. A. (1995) Genomics 25, 100-106 [CrossRef][Medline] [Order article via Infotrieve]
  12. Clezardin, P., McGregor, J. L., Dechvanne, M., and Clemetson, K. J. (1985) Br. J. Haematol. 60, 331-338 [Medline] [Order article via Infotrieve]
  13. Edelman, P., Vinci, G. Villeval, J. L., Vainchenker, W., Henri, A., Miglierina, R., Rouger, P., Reviron, J., Breton-Gorius, J., Sureau, C., and Edelman, L. (1986) Blood 67, 56-63 [Abstract/Free Full Text]
  14. Endemann, G., Stanton, L. W., Madden, K. S., Bryant, C. M., White, R. T., and Protter, A. A. (1993) J. Biol. Chem. 268, 11811-11816 [Abstract/Free Full Text]
  15. Galson, D. L., and Housman, D. E. (1988) Mol. Cell. Biol. 8, 381-392 [Abstract/Free Full Text]
  16. Giese, K., Kingley, C., Kirshner, J. R., and Grosschedl (1995) Genes & Dev. 9, 995-1008
  17. Gottschalk, L. R., and Leiden, J. M. (1990) Mol. Cell. Biol. 10, 5486-5495 [Abstract/Free Full Text]
  18. Greenwalt, D. M., Lipsky, R. H., Ockenhouse, C. F., Ikeda, H., Tandon, N. N., and Jamieson, G. A. (1992) Blood 80, 1105-1115 [Free Full Text]
  19. Greenwalt, D. M., Scheck, S. H., and Rhinehart-Jones, T. (1995) J. Clin. Invest. 96, 1382-1388
  20. Hernández-Munain, C., and Krangel, M. S. (1994) Mol. Cell. Biol. 14, 473-483 [Abstract/Free Full Text]
  21. Hernández-Munain, C., and Krangel, M. S. (1995) Mol. Cell. Biol. 15, 3090-3099 [Abstract]
  22. Huh, H. Y., Lo, S. K., Yesner, L. M., and Silverstein, R. L. (1995) J. Biol. Chem. 270, 6267-6271 [Abstract/Free Full Text]
  23. Kagoshima, H., Shigesada, K., Ito, Y., Miyoshi, H., Ohki, M., Pepling, M., and Gergen, P. (1993) Trends Genet. 9, 338-341 [CrossRef][Medline] [Order article via Infotrieve]
  24. Kania, M. A., Bonner A. S., Duffy, J. B., and Gergen J. P. (1990) Genes & Dev. 4, 1701-1703
  25. Kieffer, N., Bettaieb, A., Legrand, C., Coulombel, L., Vainchenker, W., Edelman, L., and Breton-Gorius, J. (1989) Biochem. J. 262, 835-842 [Medline] [Order article via Infotrieve]
  26. König, H., Pfisterer, P., Corcoran, L. M., and Wirth, T. (1995) Genes & Dev. 9, 1598-1607
  27. Krieger, M., and Herz, J. (1994) Annu. Rev. Biochem. 63, 601-637 [Medline] [Order article via Infotrieve]
  28. Levanon, D., Negreanu, V., Bernstein, Y., Bar-Am, I., Avivi, L., and Groner, Y. (1994) Genomics 23, 425-432 [CrossRef][Medline] [Order article via Infotrieve]
  29. Liu, P., Tarlé, S. A., Hajra, A., Claxton, D. F., Marlton, P., Freddman, M., Siciliano, M. J., and Collins, F. S. (1993) Science 261, 1041-1044 [Abstract/Free Full Text]
  30. Lu, J., Maruyama, M., Satake, M., Bae, S. C., Ogawa, E., Kagoshima, H., Shigesada, K., and Ito, Y. (1995) Mol. Cell. Biol. 15, 1651-1661 [Abstract]
  31. Lübbert, M., Herrmann, F., and Koeffler, H. P. (1991) Blood 77, 909-924 [Free Full Text]
  32. Meyers, S., Downing, J. R., and Hiebert, S. W. (1993) Mol. Cell. Biol. 13, 6336-6345 [Abstract/Free Full Text]
  33. Meyers, S., Lenny, N., and Hiebert, S. W. (1995) Mol. Cell. Biol. 15, 1974-1982 [Abstract]
  34. Miyoshi, H., Kozu, T., Shimizu, K., Enomoto, K., Maseki, N., Kaneko, Y., Kamada, N., and Ohki, M. (1993) EMBO J. 12, 2715-2721 [Medline] [Order article via Infotrieve]
  35. Nicholson, A. C., Frieda, S., Pearce, A., and Silverstein, R. L. (1995) Arterioscler. Thromb. Vasc. Biol. 15, 269-275 [Abstract/Free Full Text]
  36. Nuchprayoon I., Meyers, S., Scott, L. M., Suzow, J., Hiebert, S., and Friedman, A. D. (1994) Mol. Cell. Biol. 14, 5558-5568 [Abstract/Free Full Text]
  37. Nucifora, G., and Rowley, J. D. (1995) Blood 86, 1-14 [Free Full Text]
  38. Ogawa, E., Inuzuka, M., Maruyama, M., Satake, M., Naito-Fujimoto, M., Ito, Y., and Shigesada, K. (1993a) Virology 194, 314-331 [CrossRef][Medline] [Order article via Infotrieve]
  39. Ogawa, E., Maruyama, M., Kagoshima, H., Inuzuka, I., Lu, J., Satake, M., Shigesada, K., and Ito., Y. (1993b) Proc. Natl. Acad. Sci. U. S. A. 90, 6859-6863 [Abstract/Free Full Text]
  40. Oquendo, P., Hundt, E., Lawler, J., and Seed, B. (1989) Cell 58, 95-101 [CrossRef][Medline] [Order article via Infotrieve]
  41. Pahl, H. L., Burn, T. C., and Tenen, D. G. (1991) Exp. Hematol. 19, 1038-1041 [Medline] [Order article via Infotrieve]
  42. Pahl, H. L., Scheibe, R. J., Zhang, D. E., Chen, H. M., Galson, D. L., Maki, R. A., and Tenen, D. G. (1993) J. Biol. Chem. 268, 5014-5020 [Abstract/Free Full Text]
  43. Redondo, J. M., Pfohl, J. L., Hernández-Munain, C., Wang, S., Speck, N. A., and Krangel, M. S. (1992) Mol. Cell. Biol. 12, 4817-4823 [Abstract/Free Full Text]
  44. Ren, Y., Silverstein, R. L., Allen J., and Savill, J. (1995) J. Exp. Med. 181, 1857-1862 [Abstract/Free Full Text]
  45. Rigotti, A., Acton, S. L., and Krieger, M. (1995) J. Biol. Chem. 270, 16221-16224 [Abstract/Free Full Text]
  46. Satake, M., Nomura, S., Yamaguchi-Iwai, Y., Takahama, Y., Hashimoto, Y., Niki, M., Kitamura, Y., and Ito, Y. (1995) Mol. Cell. Biol. 15, 1662-1670 [Abstract]
  47. Savill, J., Hogg, N., Ren, Y, and Haslett, C. (1992) J. Clin. Invest. 90, 1513-1522
  48. Schreiber, E., Matthias, P., Muller, M. M., and Schaffner, W. (1989) Nucleic Acids Res. 17, 6419 [Free Full Text]
  49. Silverstein, R. L., Baird, M., Lo, S. K., and Yesner, L. M. (1992) J. Biol. Chem. 267, 16607-16612 [Abstract/Free Full Text]
  50. Suzow, J., and Friedman, A. D. (1993) Mol. Cell. Biol. 13, 2141-2151 [Abstract/Free Full Text]
  51. Swerlick, R. A., Lee, K. H., Wick, T. M., and Lawley, T. J. (1992) J. Immunol. 148, 78-83 [Abstract]
  52. Tanaka, T., Tanaka, K., Ogawa, S., Kurokawa, M., Mitani, K., Nishida, J., Shibata, Y., Yazaki, Y., and Hirai, H. (1995) EMBO J. 14, 341-350 [Medline] [Order article via Infotrieve]
  53. Tandon, N. N., Kralisz, U., and Jamieson, G. A. (1989) J. Biol. Chem. 264, 7576-7583 [Abstract/Free Full Text]
  54. van Schravendijk, M. R., Handunnetti, S. M., Barnwell, J. W., and Howard, R. J. (1992) Blood 80, 2105-2114 [Abstract/Free Full Text]
  55. Vega, M. A., Seguí-Real, B., Garcia, J. A., Calés, C., Rodríguez, F., Vanderkerckhove, J., and Sandoval, I. V. (1991) J. Biol. Chem. 266, 16818-16824 [Abstract/Free Full Text]
  56. Wang, S., and Speck, N. A. (1992) Mol. Cell. Biol. 12, 89-102 [Abstract/Free Full Text]
  57. Wang, S., Wang, Q., Crute, B. E., Melnikova, I. N., Keller, S. R., and Speck, N. (1993) Mol. Cell. Biol. 13, 3324-3339 [Abstract/Free Full Text]
  58. Wotton, D., Ghysdael, J., Wang, S., Speck, N. A., and Owen, M. J. (1994) Mol. Cell. Biol. 14, 840-850 [Abstract/Free Full Text]
  59. Zhang, D. E., Fujioka, K. I., Hetherrington, C. J., Shapiro, L. H., Chen, H. M., Look A. T., and Tenen, D. G. (1994) Mol. Cell. Biol. 14, 8085-8095 [Abstract/Free Full Text]
  60. Ziegler-Heitbrock, H. W. L., Thiel, E., Fütterer, A., Herzog, V., Wirtz, A., and Riethmüller, G. (1988) Int. J. Cancer 41, 456-461 [Medline] [Order article via Infotrieve]

©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
L. Qiao, C. Zou, P. Shao, J. Schaack, P. F. Johnson, and J. Shao
Transcriptional Regulation of Fatty Acid Translocase/CD36 Expression by CCAAT/Enhancer-binding Protein {alpha}
J. Biol. Chem., April 4, 2008; 283(14): 8788 - 8795.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Puig-Kroger, A. Dominguez-Soto, L. Martinez-Munoz, D. Serrano-Gomez, M. Lopez-Bravo, E. Sierra-Filardi, E. Fernandez-Ruiz, N. Ruiz-Velasco, C. Ardavin, Y. Groner, et al.
RUNX3 Negatively Regulates CD36 Expression in Myeloid Cell Lines
J. Immunol., August 15, 2006; 177(4): 2107 - 2114.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Tonks, L. Pearn, A. J. Tonks, L. Pearce, T. Hoy, S. Phillips, J. Fisher, J. R. Downing, A. K. Burnett, and R. L. Darley
The AML1-ETO fusion gene promotes extensive self-renewal of human primary erythroid cells
Blood, January 15, 2003; 101(2): 624 - 632.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. K. Zaidi, A. J. Sullivan, A. J. van Wijnen, J. L. Stein, G. S. Stein, and J. B. Lian
Integration of Runx and Smad regulatory signals at transcriptionally active subnuclear sites
PNAS, June 11, 2002; 99(12): 8048 - 8053.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
P. Shore, W. Dietrich, and L. M. Corcoran
Oct-2 regulates CD36 gene expression via a consensus octamer, which excludes the co-activator OBF-1
Nucleic Acids Res., April 15, 2002; 30(8): 1767 - 1773.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J.-M. Zingg, R. Ricciarelli, E. Andorno, and A. Azzi
Novel 5' Exon of Scavenger Receptor CD36 Is Expressed in Cultured Human Vascular Smooth Muscle Cells and Atherosclerotic Plaques
Arterioscler. Thromb. Vasc. Biol., March 1, 2002; 22(3): 412 - 417.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
R. Ricciarelli, J.-M. Zingg, and A. Azzi
Vitamin E Reduces the Uptake of Oxidized LDL by Inhibiting CD36 Scavenger Receptor Expression in Cultured Aortic Smooth Muscle Cells
Circulation, July 4, 2000; 102(1): 82 - 87.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
J. Han, D. P. Hajjar, J. M. Tauras, and A. C. Nicholson
Cellular cholesterol regulates expression of the macrophage type B scavenger receptor, CD36
J. Lipid Res., May 1, 1999; 40(5): 830 - 838.
[Abstract] [Full Text]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
N. Hrboticky, G. Draude, G. Hapfelmeier, R. Lorenz, and P. C. Weber
Lovastatin Decreases the Receptor-Mediated Degradation of Acetylated and Oxidized LDLs in Human Blood Monocytes During the Early Stage of Differentiation Into Macrophages
Arterioscler. Thromb. Vasc. Biol., May 1, 1999; 19(5): 1267 - 1275.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Han, D. P. Hajjar, M. Febbraio, and A. C. Nicholson
Native and Modified Low Density Lipoproteins Increase the Functional Expression of the Macrophage Class B Scavenger Receptor, CD36
J. Biol. Chem., August 22, 1997; 272(34): 21654 - 21659.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Gutierrez, A. Javed, D. K. Tennant, M. van Rees, M. Montecino, G. S. Stein, J. L. Stein, and J. B. Lian
CCAAT/Enhancer-binding Proteins (C/EBP) beta and delta Activate Osteocalcin Gene Transcription and Synergize with Runx2 at the C/EBP Element to Regulate Bone-specific Expression
J. Biol. Chem., January 4, 2002; 277(2): 1316 - 1323.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Armesilla, A. L.
Right arrow Articles by Vega, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Armesilla, A. L.
Right arrow Articles by Vega, M. A.
Social Bookmarking