|
Volume 271,
Number 14,
Issue of April 5, 1996 pp. 8068-8074
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
The
-Isoform of the CCAAT/Enhancer-binding Protein Is Required for
Mediating cAMP Responsiveness of the Phosphoenolpyruvate Carboxykinase
Promoter in Hepatoma Cells (*)
(Received for publication, December 7,
1995; and in revised form, January 22, 1996)
William J.
Roesler
(1), (§),
Sean M.
Crosson
(1),
Charles
Vinson
(2),
Pam
J.
McFie
(1)From the
(1)Department of Biochemistry, University of
Saskatchewan, Saskatoon, Saskatchewan, S7N 5E5 Canada and
(2)Laboratory of Biochemistry, NCI, National
Institutes of Health, Bethesda, Maryland 20892
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
The gene coding for phosphoenolpyruvate carboxykinase (GTP) (EC
4.1.1.32) is expressed in all gluconeogenic tissues, but stimulation of
its rate of transcription by cAMP is robust only in liver. Evidence has
accumulated which suggests that a liver-enriched transcription factor,
likely a member of the CCAAT/enhancer binding protein (C/EBP) family,
is required along with other ubiquitously expressed transcription
factors to mediate this liver-specific response to cAMP. In this study,
we examined the ability of C/EBP to participate in the cAMP-mediated
activation of phosphoenolpyruvate carboxykinase (PEPCK) gene
transcription in hepatoma cells. Expression of a dominant repressor of
C/EBP in hepatoma cells significantly inhibited the protein kinase
A-stimulated transcription of the PEPCK promoter, suggesting that a
C/EBP family member was required for maximal transcriptional activation
by protein kinase A. To provide additional support for this hypothesis,
we prepared GAL4 fusion proteins containing C/EBP domains. Both
C/EBP and C/EBP GAL4 fusion proteins were capable of
stimulating transcription from promoters containing binding sites for
the DNA-binding domain of GAL4. However, only the GAL4-C/EBP
fusion protein demonstrated the ability to synergize with the other
transcription factors bound to the PEPCK promoter which are required to
mediate cAMP responsiveness. The DNA-binding domain of C/EBP was
not required for this activity in hepatoma cells, although in
non-hepatoma cells the basic region leucine zipper domain appeared to
inhibit the ability of C/EBP to participate in mediating cAMP
responsiveness. These results suggest that the liver-specific nature of
the cAMP responsiveness of the PEPCK promoter involves the recruitment
of C/EBP to the cAMP response unit.
INTRODUCTION
Cyclic AMP is the intracellular mediator of many extracellular
stimuli and increases in the cellular concentration of this second
messenger lead to the transcriptional activation of many genes.
Distinct DNA sequences within gene promoters, termed cAMP response
elements (CREs), ( )have been shown to confer such cAMP
responsiveness. CREs function by acting as binding sites for
transcription factors which mediate the cAMP effect. These
transcription factors include some members of the CREB/ATF-1 protein
family (reviewed in (1) ), as well as activator protein
2(2) . However, in many, if not most, promoters examined to
date, the maximal effect of cAMP on transcriptional activity is
mediated by more than one cis-element. In these cases, either
multiple CREs are present, or different cis-elements cooperate
with the CRE to mediate the response, forming what has been termed a
``cAMP response unit''(3) . For example, the
glycoprotein hormone ( -subunit) gene promoter contains two
tandemly arranged CREs(4) , the c-fos promoter
contains four cis-elements which mediate the cAMP
response(5) , and the cAMP responsiveness of the tyrosine
aminotransferase promoter is mediated by synergistic interactions
between a CRE and a binding site for hepatic nuclear factor
4(6) . It has been hypothesized that utilization of several
proteins to mediate the response may allow for a fine-tuned response of
promoter activity to extracellular stimuli, as well as provide a
mechanism for cell/tissue-specific responses(7) . The
promoter for the gene that codes for the cytosolic form of
phosphoenolpyruvate carboxykinase (PEPCK), the rate-limiting enzyme of
gluconeogenesis, is strongly activated by cAMP in liver but poorly in
kidney(8, 9) . Footprinting experiments indicated that
while both kidney and liver nuclear extracts contained CRE-binding
activity, only extracts from liver footprinted a region upstream of the
CRE(10) . Subsequently, this liver-specific region was shown to
contain several protein binding domains, all of which were critical for
cAMP responsiveness of the promoter both in vivo and in
vitro(3, 7, 11, 12) . Thus,
full responsiveness of this promoter to cAMP requires synergism between
the CRE and the liver-specific region. Recently, we provided evidence
that CREB mediates the response through the CRE(13) . The
factors which bind to the liver-specific region, however, have not yet
been identified, although C/EBP protein members have been shown to bind
to this region in vitro and overexpression of C/EBP proteins
lead to transactivation of the promoter(14, 15) . Our goal is to identify and characterize the proteins which
participate in mediating this liver-specific, cAMP responsiveness of
the PEPCK promoter in order to fully understand the molecular details
of the response. In this study, we provide functional evidence in
support of a role for C/EBP in mediating the cAMP responsiveness
of this gene synergistically with CREB.
EXPERIMENTAL PROCEDURES
MaterialsDNA-modifying enzymes were purchased
from New England Biolabs, Promega Corp., and U. S. Biochemical Corp.
Poly[d(I-C) d(I-C)] was purchased from Pharmacia Biotech
Inc. [acetyl- H]CoA (10 Ci/mmol) was
purchased from DuPont NEN. Tissue culture supplies were from Life
Technologies, Inc. HepG2 and JEG3 cells were acquired from American
Type Culture Collection. Synthetic oligonucleotides were purchased from
either the Regional DNA Synthesis Laboratory (University of Calgary) or
Bio/Can Scientific. GAL4-specific antiserum was purchased from Upstate
Biotechnology, Inc.
Transfection ExperimentsHepG2 cells were grown in
Dulbecco's modified essential medium containing 10% fetal calf
serum. Four hours before transfection, the cells were plated to
approximately 30% confluence in 10-cm plates. DNA transfections were
carried out by the calcium-phosphate precipitation procedure as
described in Sambrook et al.(16) . RSV- gal vector
was co-transfected in all experiments to monitor transfection
efficiency. The amount of DNA used in the various transfection
experiments was maintained at 25 µg/plate by the addition of the
phagemid pTZ18R. RSV-GBF-F is an expression vector for a dominant
negative C/EBP polypeptide, driven by the RSV promoter, which
preferentially forms heterodimers with C/EBP proteins (17) .
Expression vectors for GAL4-C/EBP proteins are detailed below. All
other expression vectors and reporter plasmids used in this study, with
the exception of -109/G3A1 (see below), have been described
previously(3, 7, 13, 18) .A
synthetic PEPCK promoter-CAT reporter plasmid was created to examine
the transcriptional properties of the GAL4-C/EBP fusion proteins. This
plasmid, called -109/G3A1, was constructed by restricting
-109 PCK-CAT (3) with XbaI and ligating into
this site three copies of a 25-mer, double-stranded oligonucleotide
which contained the recognition sequence for the yeast transcription
factor GAL4(19) . The sequence of the two oligonucleotides
annealed were: 5` CTAGATCGGAGTACTGTCCTCCGTA 3` and 5`
CTAGTACGGAGGACAGTACTCCGAT 3`. This vector was then cut with AvaI, which cuts just upstream of the XbaI site, and
into this site was ligated a double-stranded oligonucleotide (described
in (3) ), which contains the AP-1 binding site present in the
PEPCK promoter.
Construction of GAL4-C/EBP Fusion Protein Expression
VectorsThe vector expressing a GAL4-C/EBP fusion protein,
termed G 1, was created by fusing the DNA-binding domain of GAL4
(amino acids 1-147) (20) to amino acids 6-359 of
rat C/EBP (21) , with expression of the vector driven by
the SV40 early promoter. This was accomplished by constructing an EcoRI site over codons 5 and 6 in the C/EBP gene by
site-directed mutagenesis using the Kunkel method(22) . The
mutagenic oligonucleotide contained the sequence 5`
GTCGGCCGAATTCTACGAGG 3`. G 2 was similarly constructed but
contained only the transactivation domain (amino acids 6-217) of
C/EBP , obtained by digesting the C/EBP gene with PstI which cuts at codon 217(21) . The GAL4-C/EBP
fusion protein expression vector, termed G 1, expressed a protein
containing amino acids 8-345 of human C/EBP (23) . A BamHI site was created over codons 8 and 9 using a mutagenic
oligonucleotide containing the sequence 5` GGCCTGGGATCCAGCATGTC 3`. A
similar fusion protein which lacked a functional DNA-binding domain due
to the deletion of amino acids 315-345, termed G 2, was
constructed by digesting the C/EBP gene with PstI which
cuts at codon 315(23) . Verification that similar levels of
appropriately sized GAL4 fusion proteins were expressed in HepG2 cells
was determined by performing Western blot analysis of lysates prepared
from transiently transfected HepG2 cells as described
previously(13) .
RESULTS
A schematic of the cAMP response unit of the PEPCK promoter
is shown in Fig. 1. It consists of two components: the CRE,
which acts as a binding site for CREB, and the liver-specific region
(LSR), which contains three binding sites for a protein enriched in
liver nuclei, as well as a binding site for AP-1. All five of the cis-elements shown are required for optimal cAMP
responsiveness(3, 7, 12) . Several studies,
consisting mainly of in vitro DNA-protein binding assays, have
suggested that C/EBP proteins may be the trans-acting factors
which bind to the liver-specific binding sites in the LSR. However, to
date there has been no functional data in support of this hypothesis.
Furthermore, no information is available as to what C/EBP isoform is
involved in the response.
Figure 1:
A
schematic of the cAMP response unit of the PEPCK promoter. The cAMP
response unit of the PEPCK promoter consists of two components; the
CRE, to which CREB binds, and the liver-specific region, which consists
of three sites to which C/EBP binds and an AP-1 site. All five of the
binding sites shown are required for optimal responsiveness to
cAMP.
In order to further test our hypothesis
that C/EBP proteins are involved in mediating the cAMP responsiveness
of the PEPCK promoter, and thus confer a liver-specific hormonal
response, we took advantage of the development by Olive et al.(17) of a ``designer'' dominant negative C/EBP
repressor molecule. This C/EBP repressor molecule, termed GBF-F, is a
chimera containing a DNA-binding (basic) region from the plant bZIP
protein GBF-1 and a modified leucine zipper which preferentially forms heterodimers with other C/EBP molecules rather than
self-homodimers. Because of this preference for heterodimer formation,
and because GBF-F lacks a transactivation domain, expression of this
chimera in cells results in the formation of inactive heterodimers with
all known members of the C/EBP family and thus repression of C/EBP
transactivation(17) . Initially, we tested the ability of GBF-F
to inhibit the C/EBP-mediated activation of the PEPCK promoter in HepG2
cells. As shown in Fig. 2A, the 6-fold transactivation of the
-490 PCK-CAT produced by C/EBP overexpression was
significantly inhibited by co-expression of GBF-F. In order to verify
that the bZIP domain was required for this repressor effect, we
performed a domain-swap experiment examining the ability of G 2, a
C/EBP fusion protein that has the bZIP domain replaced by the
DNA-binding domain of the yeast transcription factor GAL4 (see Fig. 3), to activate a PEPCK promoter derivative
(-109/G3A1), which has the three C/EBP binding sites replaced by
binding sites for GAL4. As shown in Fig. 2B, G 2
strongly transactivated the modified PEPCK promoter and was insensitive
to the repressor effect of GBF-F. Thus, the repressor effects of GBF-F
on the PEPCK promoter appear to be specific for the C/EBP bZIP domain.
Figure 2:
GBF-F
inhibits the ability of C/EBP to transactivate the PEPCK promoter
through bZIP domain interactions. A, HepG2 cells were
transfected with 5 µg of a PEPCK promoter-CAT vector -490
PCK-CAT, along with 1 µg of C/EBP expression vector and/or 3
µg GBF-F expression vector per plate as described under
``Experimental Procedures.'' All transfections also contained
2 µg of RSV- gal vector to monitor transfection efficiency. The
values shown are the averages ± S.E. of at least three
experiments and are expressed relative to the CAT activity obtained
with transfection of -490 PCK-CAT alone, which was set
arbitrarily at 1.0. B, the experiment was performed as
described for A except that the CAT reporter plasmid was
-109/G3A1, which is described under ``Experimental
Procedures,'' and the GAL4-C/EBP fusion protein G 2 (see Fig. 3A) was co-expressed in the absence or presence of
GBF-F.
Figure 3:
Schematic of the GAL4-C/EBP fusion
proteins and synthetic promoters used to examine the activity of C/EBP
proteins in mediating PKA responsiveness. A, G 1 contains
the entire rat C/EBP protein, minus the amino-terminal five amino
acids, linked to the DNA-binding domain of the yeast transcription
factor GAL4. G 2 is similar to G 1 except that amino acids
218-359, which contain the bZIP domain, have been deleted.
G 1 contains all but the amino-terminal seven amino acids of human
C/EBP (also called NFIL-6 (23) ) linked to GAL4. G 2
is similar to G 1 except that the leucine zipper has been deleted,
which disables the dimerization and thus DNA binding activity of this
bZIP domain. Western blot analysis using a GAL4 antibody verified that
all four proteins accumulated to approximately equivalent levels when
expressed in HepG2 cells. B, The reporter plasmid -109/
G3A1 consists of the -109 PCK-CAT 5` deletion
promoter(3) , which contains the CRE, along with three
GAL4-binding sites and an AP-1-binding site. The -109/ G3
promoter is similar except that it lacks the AP-1 site. The -68/G3
promoter consists of the -68 PCK-CAT 5`-deletion
promoter(3) , which is a minimal promoter containing a TATA
box, to which has been ligated three GAL4 binding sites. All three of
these synthetic promoters drive expression of the CAT reporter gene.
Refer to ``Experimental Procedures'' for details on plasmid
construction.
We next examined the ability of GBF-F to inhibit the PKA
responsiveness of the PEPCK promoter. As shown in Table 1,
expression of the catalytic subunit of PKA in HepG2 cells activated the
PEPCK promoter (-490 PCK-CAT), which contains the intact cAMP
response unit, including the C/EBP binding sites, by approximately
40-fold. However, in the presence of expressed GBF-F, the activation by
PKA was significantly reduced to about 9-fold. Experiments where
increasing amounts of GBF-F were expressed indicated that maximum
inhibition that could be achieved was a reduction to about 5-fold
activation by PKA, ( )consistent with the responsiveness
mediated by the CRE alone(3) . The specificity of this
inhibitory effect was determined by examining the effect of GBF-F on
the cAMP responsiveness of the -subunit of glycoprotein hormone
gene promoter in JEG-3 cells. The cAMP responsiveness of this promoter
is mediated solely by CREB bound to two tandemly arranged
CREs(18) , thus this promoter should be relatively immune to
the effects of the C/EBP repressor due to incompatible bZIP domains. As
shown in Table 1, the approximately 20-fold activation of the
-gene promoter by PKA was unaffected by the expression of GBF-F in
JEG-3 cells.
The data above provide the first functional evidence
that C/EBP proteins play a role in mediating the cAMP responsiveness of
the PEPCK promoter in liver. In an effort to further test this
hypothesis as well as to identify which isoform mediates the response,
we created expression vectors for GAL4-C/EBP fusion proteins and tested
their activity on promoters which have the C/EBP binding sites replaced
by bindings sites for GAL4. This approach allows the examination and
characterization of C/EBP proteins in hepatoma cells without
interference by endogenous C/EBP proteins, as well as identification of
the protein domain(s) which mediate the response. A schematic of the
fusion proteins utilized in this study, shown in Fig. 3A, have either the entire protein or the
transactivation domain (without a functional bZIP domain) linked to the
DNA-binding domain of GAL4. It should be noted that only the and
isoforms of C/EBP were examined, since the other major isoform
expressed in liver, C/EBP , is not present in significant amounts
in liver except under acute phase response conditions(24) . Initially, we examined the GAL4-C/EBP fusion proteins for their
constitutive transcriptional activity by using a CAT reporter gene
driven by a minimal promoter containing three GAL4 binding sites,
termed -68/G3 CAT (see the schematic in Fig. 3B).
As shown in Table 2, the GAL4 DNA-binding domain alone
(GAL4-(1-147)) did not transactivate this promoter. Fusing the
entire C/EBP coding region to the GAL4 domain, producing G 1,
resulted in a protein that produced transactivation, although removal
of the bZIP domain, forming G 2, created a much stronger
transactivator. The GAL4 fusion protein containing the entire
C/EBP protein (G 1) did not demonstrate transactivation
activity, although once again removal of the bZIP domain, forming
G 2, resulted in a strong transactivator. We speculate that the
poor transactivation activity of G 1 and G 1 is related to the
fact that these fusion proteins have two dimerization domains at each
end of the polypeptide, one contributed by the GAL4 DNA-binding domain
and the other by the C/EBP bZIP domain, which could interfere with
the transactivation properties of the fusion protein. However, we felt
it important to test such constructs, since the bZIP domain has been
shown previously to be important for the ability of human C/EBP to
synergize with the transcription factor NF- B(25) . The
activity of the GAL4-C/EBP fusion proteins was dependent upon the
presence of GAL4 binding sites in the promoter, demonstrated by the
observation that none of the fusion proteins significantly
transactivated the promoter -68 PCK-CAT which lacks GAL4 binding
sites (Table 2).
We next tested the GAL4-C/EBP fusion proteins
for their ability to mediate PKA responsiveness. Previously, we had
shown that we could reconstitute the cAMP response unit of the PEPCK
promoter by linking three C/EBP binding sites and the native AP-1 site
of the PEPCK promoter to a 5` deletion of the PEPCK promoter containing
the CRE, creating the -109/C3A1 promoter(3) . This
reconstituted PEPCK promoter mimicked the PKA-responsive
characteristics of the native promoter. Thus, to test the ability of
the GAL4-C/EBP fusion proteins to mediate PKA responsiveness, we simply
replaced the C/EBP binding sites with GAL4 binding sites to form
-109/G3A1 (Fig. 3B). This reporter vector, in the
absence of GAL4 fusion protein expression, was activated approximately
3-fold by PKA expression (Table 3), consistent with the PKA
responsiveness mediated by the CRE alone(3) . Expression of
GAL4-(1-147) in HepG2 cells provided no enhancement of this PKA
responsiveness, and expression of G 1, G 1, and G 2
produced the same negative result (Table 3). However, when
G 2 was expressed in HepG2 cells, a 52-fold activation by PKA was
observed, similar to the level of PKA activation observed using the
intact PEPCK promoter in HepG2 cells(3) . This finding
indicates that the bZIP domain is not required for this activity of
C/EBP , which was confirmed by the observation that the PKA
responsiveness mediated by G 2 is not inhibited by the
co-expression of GBF-F. The inability of G 1 to mediate
a PKA response may be due to the abnormal structure of this fusion
protein as discussed above.
Previously, in characterizing the cAMP
response unit of the PEPCK promoter, we showed that maximal
responsiveness to PKA or cAMP analogs required all three components:
the CRE, the three C/EBP binding sites, and the AP-1 site(3) .
Elimination of any one component significantly decreased the activity
of the cAMP responsiveness. In order to further test our hypothesis
that C/EBP was the isoform involved, we tested the activity of
G 2 to mediate PKA responsiveness on promoters lacking one or more
components of the cAMP response unit (see Fig. 3for a schematic
of these promoters). As shown in Table 3, the synthetic promoter
-68/G3, which contains the requisite three GAL4 binding sites but
lacks the CRE and AP-1 sites (Fig. 3B), was unable to
be significantly activated by PKA in the presence of G 2. The small
degree of activation obtained is consistent with previous observations
from our laboratory which indicated that a promoter containing three
C/EBP binding sites alone can mediate a weak PKA response(3) .
Additionally, the synthetic promoter -109/G3, which contains the
CRE and the three GAL4 sites but lacks the AP-1 site (Fig. 3B), was not strongly responsive to PKA in the
presence of G 2 (Table 3), again consistent with previous
observations(3) . Thus, the activity of G 2 on the
reconstituted PEPCK promoter (containing three GAL4 binding sites)
requires the presence of the CRE and the AP-1 sites for full
PKA-responsiveness, mimicking previous observations using the native
C/EBP binding sites present in the promoter and the proteins native to
HepG2 cells. The requirement for C/EBP in the cAMP response
unit now provides a possible explanation for the weak activation of the
PEPCK promoter by PKA or cAMP in most non-hepatoma cell lines, which
typically do not express C/EBP proteins at significant levels. This
hypothesis was tested by examining whether overexpression of C/EBP
could restore PKA responsiveness of the PEPCK promoter in JEG3 cells, a
human placental cell line in which many studies on cAMP responsive
promoters have been performed. Similar to previous observations,
-490 PCK-CAT vector was not responsive to PKA in JEG3 cells, and
overexpression of C/EBP did not restore responsiveness (Fig. 4A). C/EBP also did not transactivate the
PEPCK promoter in JEG3 cells, even though C/EBP accumulated in
transfected JEG3 cells similar to the level achieved in transfected
HepG2 cells as indicated by Western analysis. ( )Since
previous studies had indicated that the bZIP domain may modulate the
activity of C/EBP proteins in non-hepatoma cells(26) , we
examined the ability of G 2 to mediate PKA responsiveness on the
synthetic promoter -109/G3A1. This promoter, in the absence of
G 2 expression, was activated less than 2-fold by PKA (Fig. 4B). G 2 showed no constitutive
transcriptional activity in JEG3 cells; however, it mediated a strong
52-fold activation in response to PKA. This ``restored'' PKA
responsiveness was not related to some cryptic characteristic of the
reconstituted promoter, since -109/C3A1, which is identical to
that of -109/G3A1 except that it contains C/EBP binding sites
instead of GAL4 sites(3) , was not responsive to PKA in the
absence or presence of C/EBP expression (Fig. 4C).
Thus the bZIP domain of C/EBP appears to inhibit the PKA-mediating
properties of this transcription factor in non-hepatoma cells.
Figure 4:
The bZIP domain represses the
PKA-mediating activity of C/EBP in JEG3 cells. A, 7
µg of -490 PCK-CAT was transfected into JEG3 cells along with
a 5 µg of C/EBP expression vector and/or 2 µg of PKA
expression vector per plate as described under ``Experimental
Procedures.'' B, a transfection experiment was designed
similar to that described in A except that the CAT reporter
plasmid is -109/G3A1, which is a synthetic PEPCK promoter
containing the CRE, the AP-1 site, and three GAL4-binding sites. Five
µg of the G 2 expression vector along with 2 µg of PKA
expression plasmid were used. C, a transfection experiment in
JEG3 cells was performed similar to that described for A and B, except that the CAT reporter plasmid was -109/C3A1,
which is a synthetic PEPCK promoter containing the CRE, the AP-1 site,
and three C/EBP binding sites(3) . The values shown are the
averages ± S.E. of at least three experiments and are expressed
relative to the CAT activity obtained with transfection of the CAT
reporter plasmid alone, which was set arbitrarily at
1.0.
DISCUSSION
The PEPCK promoter offers a good model to examine how genes
can respond to hormonal signals in a tissue-specific fashion. The cAMP
responsiveness of this promoter is robust in liver-derived cells but
weak in other cell types, and this liver-specific responsiveness is
mediated by a complex cAMP response unit(3, 12) .
Consistent with the liver-specific nature of the response, three of the cis-elements required for maximal hormonal responsiveness bind
factors that are enriched in liver(10) . Results from in
vitro DNA-protein binding assays suggested that this factor may be
a member of the C/EBP family(3, 14, 15) ,
although prior to the present study there has been no functional data
in support of this hypothesis nor any data indicating what isoform may
be involved. In the present study, we have obtained functional data in
support of a role for C/EBP proteins, and, furthermore, using GAL4
fusion methodology, have identified that the -isoform mediates
maximal cAMP responsiveness of this promoter. It should be noted that
the findings of this study do not rule out the possibility that a
combination of and isoforms bound to the three C/EBP
binding sites could also mediate a cAMP response, only that three
C/EBP , but not three C/EBP molecules, bound to the promoter
can mediate the response. It is also acknowledged that a role for
C/EBP in the cAMP response, which was not explored in this study,
cannot be formally eliminated as a possible candidate protein. However,
given that 1) the transactivation domains of C/EBP and share
no apparent similarities, 2) the expression of C/EBP in liver is
weak except under acute phase response conditions, and 3) the cAMP
response is apparently mediated by a specific domain lying within the
transactivation domain of C/EBP as evidenced by the inactivity of
the C/EBP transactivation domain, we feel that a role for
C/EBP is unlikely. Previous hypotheses as to what isoform of
C/EBP, if any, might be responsible for mediating the cAMP
responsiveness of this promoter suggested C/EBP as a more likely
candidate. This reasoning was based on several studies which linked the
-isoform with the cAMP signaling system, which included the
ability of cAMP to (i) stimulate C/EBP gene expression (15) and (ii) to stimulate translocation of C/EBP from the
cytosol to the nucleus(27) , although this latter effect is
likely cell type-specific. Recently, Darlington and co-workers (28) created knockout mice deficient in C/EBP , and they
observed that PEPCK gene expression, which is normally turned on just
prior to birth, was significantly reduced in these mice during the
first few hours postpartum. While PEPCK gene expression in these
knockout mice recovered to normal levels by 7-32 h postpartum,
perhaps due to the presence of other C/EBP isoforms, it has not yet
been determined whether these mice have the ability to respond to cAMP.
The results of the present paper would suggest that, while basal
expression of PEPCK gene expression is possible in these mice due to
the many transcription factors which likely act on the promoter,
including NF-1, HNF-1, HNF-4, CREB,
AP-1,(10, 29, 30, 31, 32) ,
the lack of C/EBP should significantly limit the extent to which
this promoter can be activated by a rise in intrahepatocyte cAMP
levels. In this respect, it is noteworthy that these knockout mice were
severely hypoglycemic and could only be kept alive by glucose
injections, implicating that there was an impairment in activating
gluconeogenesis, the rate-limiting enzyme of which is
PEPCK(33) . The findings of the present study indicate that
the bZIP domain of C/EBP is not required for its ability to
mediate cAMP responsiveness in hepatoma cells. Structure/function
studies of this protein indicate that the bZIP domain is also not
required for its constitutive transactivation function, which instead
is mediated by several regions in the amino terminus, including a
proline-rich domain(26, 34, 35) . While it is
not yet known whether the domain(s) mediating cAMP responsiveness
co-resides with the constitutive transactivation domains, the ability
of G 2 to mediate PKA responsiveness in JEG3 cells, without
demonstrating any constitutive transactivation function (Fig. 4B), suggests that different regions of the
protein may mediate cAMP-inducible and constitutive activities, similar
to that which has been observed for the transcription factor
CREB(36, 37) . The bZIP domain may, however, play
an important role in modulating the activity of C/EBP in
non-hepatoma cells. Our studies using JEG3 cells suggest an important
role for the bZIP domain of C/EBP in modulating the
transactivation properties of C/EBP . Removal of the bZIP domain
allowed unmasking of the PKA-mediating activity of C/EBP , although
no constitutive activity was detectable (Fig. 4, A and B). These results suggest that the bZIP domain exerts a strong
inhibitory effect on the PKA-mediating activity of C/EBP in JEG3
cells. Nerlov and Ziff (26) also showed that the bZIP domain
exerted a strong inhibitory effect on the ability of C/EBP to
transactivate the albumin promoter in HeLa cells. Whether this masking
effect occurs through modulation of the DNA binding activity or the
transactivation properties is not clear, although it is interesting to
note that the DNA-binding activity of C/EBP can be attenuated by
phosphorylation of serine 299(38) . The
``scissors-grip'' model of the tertiary structure of the bZIP
domain (39) predicts that serine 299, which lies within the
basic region, interacts with the major groove of the DNA.
Phosphorylation of this serine residue, which has been shown to be a
good substrate for protein kinase C(38) , could alter the
contact between C/EBP and the negatively charged DNA binding site.
Whether the observed ``masking'' of C/EBP 's
transactivation properties is mediated by PKC in vivo remains
to be determined. However, if this turns out to be the case, then the
masking phenomenon would also be expected to be operational in
liver-derived cells that contain protein kinase C activity. Studies
examining the effect of protein kinase C on C/EBP 's
participation in the cAMP responsiveness of the PEPCK promoter are
currently under way. A question that arises from this study is how
does C/EBP get specifically recruited to the PEPCK promoter? In vitro binding assays indicate that both and
isoforms bind, with identical relative affinities, to the same sites on
the promoter(14, 15) , and the similarities in their
bZIP domains as well as results from comparative in vitro binding assays (40, 41) suggest that their
absolute binding affinities to the three C/EBP binding sites in the
PEPCK promoter would be similar. Thus, differences in DNA binding
affinities are unlikely to explain the specific recruitment of the
-isoform to the promoter. Another model for strategic positioning
of proteins involves the specific ``fitting'' of
transcription factors to promoters, using protein contact surfaces of
adjacently bound factors in addition to DNA sequences(42) . In
support of this model, studies from our laboratory have shown that
while the AP-1 alone or in conjunction with CREB has no effect on cAMP
responsiveness, it greatly augments the weak synergism displayed
between the three C/EBP proteins and CREB in mediating cAMP
responsiveness(3) . This ``augmenting activity'' of
AP-1 could take the form of recruiting C/EBP to the promoter, at
least to one of the C/EBP binding sites and possibly all three. Such an
activity would likely require protein-protein interactions, and it is
noteworthy that not only does AP-1 bind to the promoter in a region
where it is closely surrounded by the three C/EBP molecules, but one of
the C/EBP binding sites is closely juxtapositioned to the AP-1 site
such that an uninterrupted DNase I footprint extends over both sites on
the sense strand using liver nuclear extracts(10) . However,
since AP-1 is also required for maximal cAMP responsiveness in the
studies using G 2 (Table 3), where no specific recruitment is
necessary due to the GAL4 domain, AP-1 must possess additional
functions besides the putative recruiting role. The findings of this
study have important implications for other regulatory aspects of the
PEPCK promoter. Thyroid hormone (T ) stimulates
transcription of this gene, and T responsiveness is
mediated by a C/EBP-binding site that resides within the LSR along with
a typical thyroid hormone response element(43, 44) .
While it is still unknown as to whether C/EBP is involved in this
response, it seems possible that this transcription factor could serve
to integrate information from different signaling pathways along with
tissue-specific responses. In fact, the involvement of C/EBP in
both the cAMP and thyroid hormone responses may provide a mechanism for
the synergistic activation of PEPCK gene transcription elicited by
these two signals(43) . Studies examining the role of
C/EBP in the T response, along with characterization
of the specific domains that mediate the various responses, should
provide interesting information on the various functions mediated by
this protein.
FOOTNOTES
- *
- This work was supported by
operating grants from the Medical Research Council of Canada and the
Canadian Diabetes Association (to W. J. R.). The costs of publication
of this article were defrayed in part by the payment of page charges.
This article must therefore by hereby marked
``advertisement'' in accordance with 18 U.S.C.
Section 1734 solely to indicate this fact.
- §
- To whom correspondence should be addressed.
Tel.: 306-966-4375; Fax: 306-966-4390; roesler{at}duke.usask.ca.
- (
) - The abbreviations used are: CRE, cAMP response
element; CREB, cAMP response element-binding protein; PEPCK,
phosphoenolpyruvate carboxykinase; C/EBP, CCAAT/enhancer-binding
protein; AP-1, activator protein 1; CAT, chloramphenicol
acetyltransferase; PKA, protein kinase A; bZIP, basic region leucine
zipper; LSR, liver-specific region; T
, triiodothyronine.
- (
) - W. J. Roesler and P. J. McFie, unpublished
observations.
- (
) - W. J. Roesler and G. F. Davies,
unpublished observations.
ACKNOWLEDGEMENTS
We thank Shizuo Akira, Richard Hanson, G. Stanley
McKnight, Steve McKnight, John Nilson, and Ivan Sadowski for plasmids.
We also thank Gerald Davies for performing the Western blot analyses.
REFERENCES
- de Groot, R. P., and
Sassone-Corsi, P. (1993) Mol. Endocrinol. 7, 145-153
[Free Full Text]
- Imagawa, M., Chiu, R.,
and Karin, M. (1987) Cell 51, 251-260
[CrossRef][Medline]
[Order article via Infotrieve]
- Roesler, W. J., Simard,
J., Graham, J. G., and McFie, P. J. (1994) J. Biol.
Chem. 269, 14276-14283
[Abstract/Free Full Text]
- Silver, B. J., Bokar, J.
A., Virgin, J. B., Vallen, E. A., Milsted, A., and Nilson, J. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 2198-2202
[Abstract/Free Full Text]
- Fisch, T. M., Prywes, R.,
Simon, M. C., and Roeder, R. G. (1989) Genes & Dev. 3, 198-211
- Nitsch, D., Boshart, M.,
and Schutz, G. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 5479-5483
[Abstract/Free Full Text]
- Roesler, W. J., McFie, P.
J., and Puttick, D. M. (1993) J. Biol. Chem. 268, 3791-3796
[Abstract/Free Full Text]
- Lamers, W. H., Hanson, R.
W., and Meisner, H. M. (1982) Proc. Natl. Acad. Sci.
U. S. A. 79, 5137-5141
[Abstract/Free Full Text]
- Meisner, H., Loose, D.
S., and Hanson, R. W. (1985) Biochemistry 24, 421-425
[CrossRef][Medline]
[Order article via Infotrieve]
- Roesler, W. J.,
Vandenbark, G. R., and Hanson, R. W. (1989) J. Biol.
Chem. 264, 9657-9664
[Abstract/Free Full Text]
- Patel, Y. M., Yun, J.
S., Liu, J., McGrane, M. M., and Hanson, R. W. (1994) J. Biol. Chem. 269, 5619-5628
[Abstract/Free Full Text]
- Liu, J., Park, E. A.,
Gurney, A. L., Roesler, W. J., and Hanson, R. W. (1991) J. Biol. Chem. 266, 19095-19102
[Abstract/Free Full Text]
- Roesler, W. J., Graham,
J. G., Kolen, R., Klemm, D. J., and McFie, P. J. (1995) J. Biol. Chem. 270, 8225-8232
[Abstract/Free Full Text]
- Park, E. A., Roesler, W.
J., Liu, J., Klemm, D. J., Gurney, A. L., Thatcher, J. D., Shuman, J.,
Friedman, A., and Hanson, R. W. (1990) Mol. Cell.
Biol. 10, 6264-6272
[Abstract/Free Full Text]
- Park, E. A., Gurney, A.
L., Nizielski, S. E., Hakimi, P., Cao, Z., Moorman, A., and Hanson, R.
W. (1993) J. Biol. Chem. 268, 613-619
- Sambrook, J., Fritsch, E. F.,
and Maniatis, T. (1989) Molecular Cloning: A Laboratory
Manual , 2nd Ed., pp. 16.32-16.38, Cold Spring Harbor
Laboratory, Cold Spring Harbor, NY
- Olive, M., Williams, S.
C., Dezan, C., Johnson, P. F., and Vinson, C. (1996) J. Biol. Chem. 271, 2040-2047
[Abstract/Free Full Text]
- Silver, B. J., Bokar, J.
A., Virgin, J. B., Vallen, E. A., Milsted, A., and Nilson, J. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 2198-2202
- Webster, N., Jin, J. R.,
Green, S., Hollis, M., and Chambon, P. (1988) Cell 52, 169-178
[CrossRef][Medline]
[Order article via Infotrieve]
- Sadowski, I., and
Ptashne, M. (1989) Nucleic Acids Res. 17, 7539
[Free Full Text]
- Landschultz, W. H.,
Johnson, P. F., Adashi, E. Y., Graves, B. J., and McKnight, S. L. (1988) Genes & Dev. 2, 786-800
- Kunkel, T. A. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 488-492
[Abstract/Free Full Text]
- Akira, S., Isshiki, H.,
Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T.,
Hirano, T., and Kishimoto, T. (1990) EMBO J. 9, 1897-1906
[Medline]
[Order article via Infotrieve]
- Alam, T., An, M. R., and
Papaconstantinou, J. (1992) J. Biol. Chem. 267, 5021-5024
[Abstract/Free Full Text]
- Stein, B., Cogswell, P.
C., and Baldwin, A. S., Jr. (1993) Mol. Cell. Biol. 13, 3964-3974
[Abstract/Free Full Text]
- Nerlov, C., and Ziff, E.
B. (1994) Genes & Dev. 8, 350-362
- Metz, R., and Ziff, E. (1991) Genes & Dev. 5, 1754-1766
- Wang, N.-D., Finegold,
M. J., Bradley, A., Ou, C. N., Abdelsayed, S. V., Wilde, M. D., Taylor,
L. R., Wilson, D. R., and Darlington, G. J. (1995) Science 269, 1108-1112
[Abstract/Free Full Text]
- Gurney, A. L., Park, E.
A., Giralt, M., Liu, J., and Hanson, R. W. (1992) J.
Biol. Chem. 267, 18133-18139
[Abstract/Free Full Text]
- Yanuka-Kashles, O.,
Cohen, H., Trus, M., Aran, A., Benvenisty, N., and Reshef, L. (1994) Mol. Cell. Biol. 14, 7124-7133
[Abstract/Free Full Text]
- Hall, R. K., Sladek, F.
M., and Granner, D. K. (1995) Proc. Natl. Acad. Sci.
U. S. A. 92, 412-416
[Abstract/Free Full Text]
- O'Brien, R. M.,
Noisin, E. L., Suwanichkul, A., Yamasaki, T., Lucas, P. C., Wang,
J.-C., Powell, D. R., and Granner, D. K. (1995) Mol.
Cell. Biol. 15, 1747-1758
[Abstract]
- Rognstad, R. (1979) J. Biol. Chem. 254, 1875-1878
[Abstract/Free Full Text]
- Friedman, A. D., and
McKnight, S. L. (1990) Genes & Dev. 4, 1416-1426
- Pei, D., and Shih, C. (1991) Mol. Cell. Biol. 11, 1480-1487
[Abstract/Free Full Text]
- Gonzalez, G. A., Menzel,
P., Leonard, J., Fischer, W. H., and Montminy, M. R. (1991) Mol. Cell. Biol. 11, 1306-1312
[Abstract/Free Full Text]
- Quinn, P. G. (1993) J. Biol. Chem. 268, 16999-17009
[Abstract/Free Full Text]
- Mahoney, C. W., Shuman,
J., McKnight, S. L., Chen, H.-C., and Huang, K.-P. (1992) J. Biol. Chem. 267, 19396-19403
[Abstract/Free Full Text]
- Vinson, C. R., Sigler,
P. B., and McKnight, S. L. (1989) Science 246, 911-916
[Abstract/Free Full Text]
- Cao, Z., Umek, R. M.,
and McKnight, S. L. (1991) Genes & Dev. 5, 1538-1552
- Williams, S. C.,
Cantwell, C. A., and Johnson, P. F. (1991) Genes & Dev. 5, 1553-1567
- Lamb, P., and McKnight,
S. L. (1991) Trends Biochem. Sci. 16, 417-422
[CrossRef][Medline]
[Order article via Infotrieve]
- Giralt, M., Park, E. A.,
Gurney, A. L., Liu, J., Hakimi, P., and Hanson, R. W. (1991) J. Biol. Chem. 266, 21991-21996
[Abstract/Free Full Text]
- Park, E. A., Jerden, D.
C., and Bahouth, S. W. (1995) Biochem. J. 309, 913-919
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
P. J. McFie, G.-L. Wang, N. A. Timchenko, H. L. Wilson, X. Hu, and W. J. Roesler
Identification of a Co-repressor That Inhibits the Transcriptional and Growth-Arrest Activities of CCAAT/Enhancer-binding Protein {alpha}
J. Biol. Chem.,
June 30, 2006;
281(26):
18069 - 18080.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Krones-Herzig, A. Mesaros, D. Metzger, A. Ziegler, U. Lemke, J. C. Bruning, and S. Herzig
Signal-dependent Control of Gluconeogenic Key Enzyme Genes through Coactivator-associated Arginine Methyltransferase 1
J. Biol. Chem.,
February 10, 2006;
281(6):
3025 - 3029.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Choy and R. Derynck
Transforming Growth Factor-beta Inhibits Adipocyte Differentiation by Smad3 Interacting with CCAAT/Enhancer-binding Protein (C/EBP) and Repressing C/EBP Transactivation Function
J. Biol. Chem.,
March 7, 2003;
278(11):
9609 - 9619.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. L. Wilson, P. J. McFie, and W. J. Roesler
Different Transcription Factor Binding Arrays Modulate the cAMP Responsivity of the Phosphoenolpyruvate Carboxykinase Gene Promoter
J. Biol. Chem.,
November 8, 2002;
277(46):
43895 - 43902.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. A. Jurado, S. Song, W. J. Roesler, and E. A. Park
Conserved Amino Acids within CCAAT Enhancer-binding Proteins (C/EBPalpha and beta ) Regulate Phosphoenolpyruvate Carboxykinase (PEPCK) Gene Expression
J. Biol. Chem.,
July 26, 2002;
277(31):
27606 - 27612.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Liu, Q.-T. Wall, L. Taylor, and N. P. Curthoys
C/EBPbeta contributes to cAMP-activated transcription of phosphoenolpyruvate carboxykinase in LLC-PK1-F+ cells
Am J Physiol Renal Physiol,
October 1, 2001;
281(4):
F649 - F657.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. L. Ross, M. R. Nonnemacher, T. H. Hogan, S. J. Quiterio, A. Henderson, J. J. McAllister, F. C. Krebs, and B. Wigdahl
Interaction between CCAAT/Enhancer Binding Protein and Cyclic AMP Response Element Binding Protein 1 Regulates Human Immunodeficiency Virus Type 1 Transcription in Cells of the Monocyte/Macrophage Lineage
J. Virol.,
February 15, 2001;
75(4):
1842 - 1856.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. Immenschuh, V. Hinke, N. Katz, and T. Kietzmann
Transcriptional Induction of Heme Oxygenase-1 Gene Expression by Okadaic Acid in Primary Rat Hepatocyte Cultures
Mol. Pharmacol.,
March 1, 2000;
57(3):
610 - 618.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. M. Crosson and W. J. Roesler
Hormonal Regulation of the Phosphoenolpyruvate Carboxykinase Gene. ROLE OF SPECIFIC CCAAT/ENHANCER-BINDING PROTEIN ISOFORMS
J. Biol. Chem.,
February 25, 2000;
275(8):
5804 - 5809.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-C. Wang, P.-E. Strömstedt, T. Sugiyama, and D. K. Granner
The Phosphoenolpyruvate Carboxykinase Gene Glucocorticoid Response Unit: Identification of the Functional Domains of Accessory Factors HNF3{beta} (Hepatic Nuclear Factor-3{beta}) and HNF4 and the Necessity of Proper Alignment of Their Cognate Binding Sites
Mol. Endocrinol.,
April 1, 1999;
13(4):
604 - 618.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
K. Yamada, D. T. Duong, D. K. Scott, J.-C. Wang, and D. K. Granner
CCAAT/Enhancer-binding Protein beta Is an Accessory Factor for the Glucocorticoid Response from the cAMP Response Element in the Rat Phosphoenolpyruvate Carboxykinase Gene Promoter
J. Biol. Chem.,
February 26, 1999;
274(9):
5880 - 5887.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. A. Park, S. Song, C. Vinson, and W. J. Roesler
Role of CCAAT Enhancer-binding Protein beta in the Thyroid Hormone and cAMP Induction of Phosphoenolpyruvate Carboxykinase Gene Transcription
J. Biol. Chem.,
January 1, 1999;
274(1):
211 - 217.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Croniger, P. Leahy, L. Reshef, and R. W. Hanson
C/EBP and the Control of Phosphoenolpyruvate Carboxykinase Gene Transcription in the Liver
J. Biol. Chem.,
November 27, 1998;
273(48):
31629 - 31632.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. M. Christoffels, T. Grange, K. H. Kaestner, T. J. Cole, G. J. Darlington, C. M. Croniger, and W. H. Lamers
Glucocorticoid Receptor, C/EBP, HNF3, and Protein Kinase A Coordinately Activate the Glucocorticoid Response Unit of the Carbamoylphosphate Synthetase I Gene
Mol. Cell. Biol.,
November 1, 1998;
18(11):
6305 - 6315.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
W. Liu, E. Feifel, T. Holcomb, X. Liu, N. Spitaler, G. Gstraunthaler, and N. P. Curthoys
PMA and staurosporine affect expression of the PCK gene in LLC-PK1-F+ cells
Am J Physiol Renal Physiol,
September 1, 1998;
275(3):
F361 - F369.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Yeagley, J. M. Agati, and P. G. Quinn
A Tripartite Array of Transcription Factor Binding Sites Mediates cAMP Induction of Phosphoenolpyruvate Carboxykinase Gene Transcription and Its Inhibition by Insulin
J. Biol. Chem.,
July 24, 1998;
273(30):
18743 - 18750.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Agati, D. Yeagley, and P. G. Quinn
Assessment of the Roles of Mitogen-activated Protein Kinase, Phosphatidylinositol 3-Kinase, Protein Kinase B, and Protein Kinase C in Insulin Inhibition of cAMP-induced Phosphoenolpyruvate Carboxykinase Gene Transcription
J. Biol. Chem.,
July 24, 1998;
273(30):
18751 - 18759.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. J. Roesler, E. A. Park, and P. J. McFie
Characterization of CCAAT/Enhancer-binding Protein alpha as a Cyclic AMP-responsive Nuclear Regulator
J. Biol. Chem.,
June 12, 1998;
273(24):
14950 - 14957.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Sassi, R. Pictet, and T. Grange
Glucocorticoids are insufficient for neonatal gene induction in the liver
PNAS,
May 12, 1998;
95(10):
5621 - 5625.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. J. D. Delhanty and R. C. Baxter
The Regulation of Acid-Labile Subunit Gene Expression and Secretion by Cyclic Adenosine 3',5'-Monophosphate
Endocrinology,
January 1, 1998;
139(1):
260 - 265.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Hemati, S. E. Ross, R. L. Erickson, G. E. Groblewski, and O. A. MacDougald
Signaling Pathways through Which Insulin Regulates CCAAT/Enhancer Binding Protein alpha (C/EBPalpha ) Phosphorylation and Gene Expression in 3T3-L1 Adipocytes. CORRELATION WITH GLUT4 GENE EXPRESSION
J. Biol. Chem.,
October 10, 1997;
272(41):
25913 - 25919.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. P. Savon, P. Hakimi, D. R. Crawford, D. J. Klemm, A. L. Gurney, and R. W. Hanson
The Promoter Regulatory Regions of the Genes for the Cytosolic Form of Phosphoenolpyruvate Carboxykinase (GTP) from the Chicken and the Rat Have Different Species-Specific Roles in Gluconeogenesis
J. Nutr.,
February 1, 1997;
127(2):
276 - 285.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
D. M. Fass, J. C. Craig, S. Impey, and R. H. Goodman
Cooperative Mechanism of Transcriptional Activation by a Cyclic AMP-response Element Modulator alpha Mutant Containing a Motif for Constitutive Binding to CREB-binding Protein
J. Biol. Chem.,
January 26, 2001;
276(5):
2992 - 2997.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Yeagley, S. Guo, T. Unterman, and P. G. Quinn
Gene- and Activation-specific Mechanisms for Insulin Inhibition of Basal and Glucocorticoid-induced Insulin-like Growth Factor Binding Protein-1 and Phosphoenolpyruvate Carboxykinase Transcription. ROLES OF FORKHEAD AND INSULIN RESPONSE SEQUENCES
J. Biol. Chem.,
August 31, 2001;
276(36):
33705 - 33710.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Yeagley, J. Moll, C. A. Vinson, and P. G. Quinn
Characterization of Elements Mediating Regulation of Phosphoenolpyruvate Carboxykinase Gene Transcription by Protein Kinase A and Insulin. IDENTIFICATION OF A DISTINCT COMPLEX FORMED IN CELLS THAT MEDIATE INSULIN INHIBITION
J. Biol. Chem.,
June 2, 2000;
275(23):
17814 - 17820.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1996 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|