Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Roesler, W. J.
Right arrow Articles by McFie, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roesler, W. J.
Right arrow Articles by McFie, P. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 271, Number 14, Issue of April 5, 1996 pp. 8068-8074
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
The -Isoform of the CCAAT/Enhancer-binding Protein Is Required for Mediating cAMP Responsiveness of the Phosphoenolpyruvate Carboxykinase Promoter in Hepatoma Cells (*)

(Received for publication, December 7, 1995; and in revised form, January 22, 1996)

William J. Roesler (1)(§) Sean M. Crosson (1) Charles Vinson (2) Pam J. McFie (1)

From the  (1)Department of Biochemistry, University of Saskatchewan, Saskatoon, Saskatchewan, S7N 5E5 Canada and (2)Laboratory of Biochemistry, NCI, National Institutes of Health, Bethesda, Maryland 20892

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

The gene coding for phosphoenolpyruvate carboxykinase (GTP) (EC 4.1.1.32) is expressed in all gluconeogenic tissues, but stimulation of its rate of transcription by cAMP is robust only in liver. Evidence has accumulated which suggests that a liver-enriched transcription factor, likely a member of the CCAAT/enhancer binding protein (C/EBP) family, is required along with other ubiquitously expressed transcription factors to mediate this liver-specific response to cAMP. In this study, we examined the ability of C/EBP to participate in the cAMP-mediated activation of phosphoenolpyruvate carboxykinase (PEPCK) gene transcription in hepatoma cells. Expression of a dominant repressor of C/EBP in hepatoma cells significantly inhibited the protein kinase A-stimulated transcription of the PEPCK promoter, suggesting that a C/EBP family member was required for maximal transcriptional activation by protein kinase A. To provide additional support for this hypothesis, we prepared GAL4 fusion proteins containing C/EBP domains. Both C/EBPalpha and C/EBPbeta GAL4 fusion proteins were capable of stimulating transcription from promoters containing binding sites for the DNA-binding domain of GAL4. However, only the GAL4-C/EBPalpha fusion protein demonstrated the ability to synergize with the other transcription factors bound to the PEPCK promoter which are required to mediate cAMP responsiveness. The DNA-binding domain of C/EBPalpha was not required for this activity in hepatoma cells, although in non-hepatoma cells the basic region leucine zipper domain appeared to inhibit the ability of C/EBPalpha to participate in mediating cAMP responsiveness. These results suggest that the liver-specific nature of the cAMP responsiveness of the PEPCK promoter involves the recruitment of C/EBPalpha to the cAMP response unit.


INTRODUCTION

Cyclic AMP is the intracellular mediator of many extracellular stimuli and increases in the cellular concentration of this second messenger lead to the transcriptional activation of many genes. Distinct DNA sequences within gene promoters, termed cAMP response elements (CREs), (^1)have been shown to confer such cAMP responsiveness. CREs function by acting as binding sites for transcription factors which mediate the cAMP effect. These transcription factors include some members of the CREB/ATF-1 protein family (reviewed in (1) ), as well as activator protein 2(2) . However, in many, if not most, promoters examined to date, the maximal effect of cAMP on transcriptional activity is mediated by more than one cis-element. In these cases, either multiple CREs are present, or different cis-elements cooperate with the CRE to mediate the response, forming what has been termed a ``cAMP response unit''(3) . For example, the glycoprotein hormone (alpha-subunit) gene promoter contains two tandemly arranged CREs(4) , the c-fos promoter contains four cis-elements which mediate the cAMP response(5) , and the cAMP responsiveness of the tyrosine aminotransferase promoter is mediated by synergistic interactions between a CRE and a binding site for hepatic nuclear factor 4(6) . It has been hypothesized that utilization of several proteins to mediate the response may allow for a fine-tuned response of promoter activity to extracellular stimuli, as well as provide a mechanism for cell/tissue-specific responses(7) .

The promoter for the gene that codes for the cytosolic form of phosphoenolpyruvate carboxykinase (PEPCK), the rate-limiting enzyme of gluconeogenesis, is strongly activated by cAMP in liver but poorly in kidney(8, 9) . Footprinting experiments indicated that while both kidney and liver nuclear extracts contained CRE-binding activity, only extracts from liver footprinted a region upstream of the CRE(10) . Subsequently, this liver-specific region was shown to contain several protein binding domains, all of which were critical for cAMP responsiveness of the promoter both in vivo and in vitro(3, 7, 11, 12) . Thus, full responsiveness of this promoter to cAMP requires synergism between the CRE and the liver-specific region. Recently, we provided evidence that CREB mediates the response through the CRE(13) . The factors which bind to the liver-specific region, however, have not yet been identified, although C/EBP protein members have been shown to bind to this region in vitro and overexpression of C/EBP proteins lead to transactivation of the promoter(14, 15) .

Our goal is to identify and characterize the proteins which participate in mediating this liver-specific, cAMP responsiveness of the PEPCK promoter in order to fully understand the molecular details of the response. In this study, we provide functional evidence in support of a role for C/EBPalpha in mediating the cAMP responsiveness of this gene synergistically with CREB.


EXPERIMENTAL PROCEDURES

Materials

DNA-modifying enzymes were purchased from New England Biolabs, Promega Corp., and U. S. Biochemical Corp. Poly[d(I-C)bulletd(I-C)] was purchased from Pharmacia Biotech Inc. [acetyl-^3H]CoA (10 Ci/mmol) was purchased from DuPont NEN. Tissue culture supplies were from Life Technologies, Inc. HepG2 and JEG3 cells were acquired from American Type Culture Collection. Synthetic oligonucleotides were purchased from either the Regional DNA Synthesis Laboratory (University of Calgary) or Bio/Can Scientific. GAL4-specific antiserum was purchased from Upstate Biotechnology, Inc.

Transfection Experiments

HepG2 cells were grown in Dulbecco's modified essential medium containing 10% fetal calf serum. Four hours before transfection, the cells were plated to approximately 30% confluence in 10-cm plates. DNA transfections were carried out by the calcium-phosphate precipitation procedure as described in Sambrook et al.(16) . RSV-betagal vector was co-transfected in all experiments to monitor transfection efficiency. The amount of DNA used in the various transfection experiments was maintained at 25 µg/plate by the addition of the phagemid pTZ18R. RSV-GBF-F is an expression vector for a dominant negative C/EBP polypeptide, driven by the RSV promoter, which preferentially forms heterodimers with C/EBP proteins (17) . Expression vectors for GAL4-C/EBP proteins are detailed below. All other expression vectors and reporter plasmids used in this study, with the exception of -109/G3A1 (see below), have been described previously(3, 7, 13, 18) .

A synthetic PEPCK promoter-CAT reporter plasmid was created to examine the transcriptional properties of the GAL4-C/EBP fusion proteins. This plasmid, called -109/G3A1, was constructed by restricting -109 PCK-CAT (3) with XbaI and ligating into this site three copies of a 25-mer, double-stranded oligonucleotide which contained the recognition sequence for the yeast transcription factor GAL4(19) . The sequence of the two oligonucleotides annealed were: 5` CTAGATCGGAGTACTGTCCTCCGTA 3` and 5` CTAGTACGGAGGACAGTACTCCGAT 3`. This vector was then cut with AvaI, which cuts just upstream of the XbaI site, and into this site was ligated a double-stranded oligonucleotide (described in (3) ), which contains the AP-1 binding site present in the PEPCK promoter.

Construction of GAL4-C/EBP Fusion Protein Expression Vectors

The vector expressing a GAL4-C/EBPalpha fusion protein, termed Galpha1, was created by fusing the DNA-binding domain of GAL4 (amino acids 1-147) (20) to amino acids 6-359 of rat C/EBPalpha(21) , with expression of the vector driven by the SV40 early promoter. This was accomplished by constructing an EcoRI site over codons 5 and 6 in the C/EBPalpha gene by site-directed mutagenesis using the Kunkel method(22) . The mutagenic oligonucleotide contained the sequence 5` GTCGGCCGAATTCTACGAGG 3`. Galpha2 was similarly constructed but contained only the transactivation domain (amino acids 6-217) of C/EBPalpha, obtained by digesting the C/EBPalpha gene with PstI which cuts at codon 217(21) . The GAL4-C/EBPbeta fusion protein expression vector, termed Gbeta1, expressed a protein containing amino acids 8-345 of human C/EBPbeta(23) . A BamHI site was created over codons 8 and 9 using a mutagenic oligonucleotide containing the sequence 5` GGCCTGGGATCCAGCATGTC 3`. A similar fusion protein which lacked a functional DNA-binding domain due to the deletion of amino acids 315-345, termed Gbeta2, was constructed by digesting the C/EBPbeta gene with PstI which cuts at codon 315(23) . Verification that similar levels of appropriately sized GAL4 fusion proteins were expressed in HepG2 cells was determined by performing Western blot analysis of lysates prepared from transiently transfected HepG2 cells as described previously(13) .


RESULTS

A schematic of the cAMP response unit of the PEPCK promoter is shown in Fig. 1. It consists of two components: the CRE, which acts as a binding site for CREB, and the liver-specific region (LSR), which contains three binding sites for a protein enriched in liver nuclei, as well as a binding site for AP-1. All five of the cis-elements shown are required for optimal cAMP responsiveness(3, 7, 12) . Several studies, consisting mainly of in vitro DNA-protein binding assays, have suggested that C/EBP proteins may be the trans-acting factors which bind to the liver-specific binding sites in the LSR. However, to date there has been no functional data in support of this hypothesis. Furthermore, no information is available as to what C/EBP isoform is involved in the response.


Figure 1: A schematic of the cAMP response unit of the PEPCK promoter. The cAMP response unit of the PEPCK promoter consists of two components; the CRE, to which CREB binds, and the liver-specific region, which consists of three sites to which C/EBP binds and an AP-1 site. All five of the binding sites shown are required for optimal responsiveness to cAMP.



In order to further test our hypothesis that C/EBP proteins are involved in mediating the cAMP responsiveness of the PEPCK promoter, and thus confer a liver-specific hormonal response, we took advantage of the development by Olive et al.(17) of a ``designer'' dominant negative C/EBP repressor molecule. This C/EBP repressor molecule, termed GBF-F, is a chimera containing a DNA-binding (basic) region from the plant bZIP protein GBF-1 and a modified leucine zipper which preferentially forms heterodimers with other C/EBP molecules rather than self-homodimers. Because of this preference for heterodimer formation, and because GBF-F lacks a transactivation domain, expression of this chimera in cells results in the formation of inactive heterodimers with all known members of the C/EBP family and thus repression of C/EBP transactivation(17) . Initially, we tested the ability of GBF-F to inhibit the C/EBP-mediated activation of the PEPCK promoter in HepG2 cells. As shown in Fig. 2A, the 6-fold transactivation of the -490 PCK-CAT produced by C/EBPalpha overexpression was significantly inhibited by co-expression of GBF-F. In order to verify that the bZIP domain was required for this repressor effect, we performed a domain-swap experiment examining the ability of Galpha2, a C/EBPalpha fusion protein that has the bZIP domain replaced by the DNA-binding domain of the yeast transcription factor GAL4 (see Fig. 3), to activate a PEPCK promoter derivative (-109/G3A1), which has the three C/EBP binding sites replaced by binding sites for GAL4. As shown in Fig. 2B, Galpha2 strongly transactivated the modified PEPCK promoter and was insensitive to the repressor effect of GBF-F. Thus, the repressor effects of GBF-F on the PEPCK promoter appear to be specific for the C/EBP bZIP domain.


Figure 2: GBF-F inhibits the ability of C/EBP to transactivate the PEPCK promoter through bZIP domain interactions. A, HepG2 cells were transfected with 5 µg of a PEPCK promoter-CAT vector -490 PCK-CAT, along with 1 µg of C/EBPalpha expression vector and/or 3 µg GBF-F expression vector per plate as described under ``Experimental Procedures.'' All transfections also contained 2 µg of RSV-betagal vector to monitor transfection efficiency. The values shown are the averages ± S.E. of at least three experiments and are expressed relative to the CAT activity obtained with transfection of -490 PCK-CAT alone, which was set arbitrarily at 1.0. B, the experiment was performed as described for A except that the CAT reporter plasmid was -109/G3A1, which is described under ``Experimental Procedures,'' and the GAL4-C/EBPalpha fusion protein Galpha2 (see Fig. 3A) was co-expressed in the absence or presence of GBF-F.




Figure 3: Schematic of the GAL4-C/EBP fusion proteins and synthetic promoters used to examine the activity of C/EBP proteins in mediating PKA responsiveness. A, Galpha1 contains the entire rat C/EBPalpha protein, minus the amino-terminal five amino acids, linked to the DNA-binding domain of the yeast transcription factor GAL4. Galpha2 is similar to Galpha1 except that amino acids 218-359, which contain the bZIP domain, have been deleted. Gbeta1 contains all but the amino-terminal seven amino acids of human C/EBPbeta (also called NFIL-6 (23) ) linked to GAL4. Gbeta2 is similar to Gbeta1 except that the leucine zipper has been deleted, which disables the dimerization and thus DNA binding activity of this bZIP domain. Western blot analysis using a GAL4 antibody verified that all four proteins accumulated to approximately equivalent levels when expressed in HepG2 cells. B, The reporter plasmid -109/ G3A1 consists of the -109 PCK-CAT 5` deletion promoter(3) , which contains the CRE, along with three GAL4-binding sites and an AP-1-binding site. The -109/ G3 promoter is similar except that it lacks the AP-1 site. The -68/G3 promoter consists of the -68 PCK-CAT 5`-deletion promoter(3) , which is a minimal promoter containing a TATA box, to which has been ligated three GAL4 binding sites. All three of these synthetic promoters drive expression of the CAT reporter gene. Refer to ``Experimental Procedures'' for details on plasmid construction.



We next examined the ability of GBF-F to inhibit the PKA responsiveness of the PEPCK promoter. As shown in Table 1, expression of the catalytic subunit of PKA in HepG2 cells activated the PEPCK promoter (-490 PCK-CAT), which contains the intact cAMP response unit, including the C/EBP binding sites, by approximately 40-fold. However, in the presence of expressed GBF-F, the activation by PKA was significantly reduced to about 9-fold. Experiments where increasing amounts of GBF-F were expressed indicated that maximum inhibition that could be achieved was a reduction to about 5-fold activation by PKA, (^2)consistent with the responsiveness mediated by the CRE alone(3) . The specificity of this inhibitory effect was determined by examining the effect of GBF-F on the cAMP responsiveness of the alpha-subunit of glycoprotein hormone gene promoter in JEG-3 cells. The cAMP responsiveness of this promoter is mediated solely by CREB bound to two tandemly arranged CREs(18) , thus this promoter should be relatively immune to the effects of the C/EBP repressor due to incompatible bZIP domains. As shown in Table 1, the approximately 20-fold activation of the alpha-gene promoter by PKA was unaffected by the expression of GBF-F in JEG-3 cells.



The data above provide the first functional evidence that C/EBP proteins play a role in mediating the cAMP responsiveness of the PEPCK promoter in liver. In an effort to further test this hypothesis as well as to identify which isoform mediates the response, we created expression vectors for GAL4-C/EBP fusion proteins and tested their activity on promoters which have the C/EBP binding sites replaced by bindings sites for GAL4. This approach allows the examination and characterization of C/EBP proteins in hepatoma cells without interference by endogenous C/EBP proteins, as well as identification of the protein domain(s) which mediate the response. A schematic of the fusion proteins utilized in this study, shown in Fig. 3A, have either the entire protein or the transactivation domain (without a functional bZIP domain) linked to the DNA-binding domain of GAL4. It should be noted that only the alpha and beta isoforms of C/EBP were examined, since the other major isoform expressed in liver, C/EBP, is not present in significant amounts in liver except under acute phase response conditions(24) .

Initially, we examined the GAL4-C/EBP fusion proteins for their constitutive transcriptional activity by using a CAT reporter gene driven by a minimal promoter containing three GAL4 binding sites, termed -68/G3 CAT (see the schematic in Fig. 3B). As shown in Table 2, the GAL4 DNA-binding domain alone (GAL4-(1-147)) did not transactivate this promoter. Fusing the entire C/EBPalpha coding region to the GAL4 domain, producing Galpha1, resulted in a protein that produced transactivation, although removal of the bZIP domain, forming Galpha2, created a much stronger transactivator. The GAL4 fusion protein containing the entire C/EBPbeta protein (Gbeta1) did not demonstrate transactivation activity, although once again removal of the bZIP domain, forming Gbeta2, resulted in a strong transactivator. We speculate that the poor transactivation activity of Galpha1 and Gbeta1 is related to the fact that these fusion proteins have two dimerization domains at each end of the polypeptide, one contributed by the GAL4 DNA-binding domain and the other by the C/EBPalpha bZIP domain, which could interfere with the transactivation properties of the fusion protein. However, we felt it important to test such constructs, since the bZIP domain has been shown previously to be important for the ability of human C/EBPbeta to synergize with the transcription factor NF-kappaB(25) . The activity of the GAL4-C/EBP fusion proteins was dependent upon the presence of GAL4 binding sites in the promoter, demonstrated by the observation that none of the fusion proteins significantly transactivated the promoter -68 PCK-CAT which lacks GAL4 binding sites (Table 2).



We next tested the GAL4-C/EBP fusion proteins for their ability to mediate PKA responsiveness. Previously, we had shown that we could reconstitute the cAMP response unit of the PEPCK promoter by linking three C/EBP binding sites and the native AP-1 site of the PEPCK promoter to a 5` deletion of the PEPCK promoter containing the CRE, creating the -109/C3A1 promoter(3) . This reconstituted PEPCK promoter mimicked the PKA-responsive characteristics of the native promoter. Thus, to test the ability of the GAL4-C/EBP fusion proteins to mediate PKA responsiveness, we simply replaced the C/EBP binding sites with GAL4 binding sites to form -109/G3A1 (Fig. 3B). This reporter vector, in the absence of GAL4 fusion protein expression, was activated approximately 3-fold by PKA expression (Table 3), consistent with the PKA responsiveness mediated by the CRE alone(3) . Expression of GAL4-(1-147) in HepG2 cells provided no enhancement of this PKA responsiveness, and expression of Galpha1, Gbeta1, and Gbeta2 produced the same negative result (Table 3). However, when Galpha2 was expressed in HepG2 cells, a 52-fold activation by PKA was observed, similar to the level of PKA activation observed using the intact PEPCK promoter in HepG2 cells(3) . This finding indicates that the bZIP domain is not required for this activity of C/EBPalpha, which was confirmed by the observation that the PKA responsiveness mediated by Galpha2 is not inhibited by the co-expression of GBF-F.^2 The inability of Galpha1 to mediate a PKA response may be due to the abnormal structure of this fusion protein as discussed above.



Previously, in characterizing the cAMP response unit of the PEPCK promoter, we showed that maximal responsiveness to PKA or cAMP analogs required all three components: the CRE, the three C/EBP binding sites, and the AP-1 site(3) . Elimination of any one component significantly decreased the activity of the cAMP responsiveness. In order to further test our hypothesis that C/EBPalpha was the isoform involved, we tested the activity of Galpha2 to mediate PKA responsiveness on promoters lacking one or more components of the cAMP response unit (see Fig. 3for a schematic of these promoters). As shown in Table 3, the synthetic promoter -68/G3, which contains the requisite three GAL4 binding sites but lacks the CRE and AP-1 sites (Fig. 3B), was unable to be significantly activated by PKA in the presence of Galpha2. The small degree of activation obtained is consistent with previous observations from our laboratory which indicated that a promoter containing three C/EBP binding sites alone can mediate a weak PKA response(3) . Additionally, the synthetic promoter -109/G3, which contains the CRE and the three GAL4 sites but lacks the AP-1 site (Fig. 3B), was not strongly responsive to PKA in the presence of Galpha2 (Table 3), again consistent with previous observations(3) . Thus, the activity of Galpha2 on the reconstituted PEPCK promoter (containing three GAL4 binding sites) requires the presence of the CRE and the AP-1 sites for full PKA-responsiveness, mimicking previous observations using the native C/EBP binding sites present in the promoter and the proteins native to HepG2 cells.

The requirement for C/EBPalpha in the cAMP response unit now provides a possible explanation for the weak activation of the PEPCK promoter by PKA or cAMP in most non-hepatoma cell lines, which typically do not express C/EBP proteins at significant levels. This hypothesis was tested by examining whether overexpression of C/EBPalpha could restore PKA responsiveness of the PEPCK promoter in JEG3 cells, a human placental cell line in which many studies on cAMP responsive promoters have been performed. Similar to previous observations, -490 PCK-CAT vector was not responsive to PKA in JEG3 cells, and overexpression of C/EBPalpha did not restore responsiveness (Fig. 4A). C/EBPalpha also did not transactivate the PEPCK promoter in JEG3 cells, even though C/EBPalpha accumulated in transfected JEG3 cells similar to the level achieved in transfected HepG2 cells as indicated by Western analysis. (^3)Since previous studies had indicated that the bZIP domain may modulate the activity of C/EBP proteins in non-hepatoma cells(26) , we examined the ability of Galpha2 to mediate PKA responsiveness on the synthetic promoter -109/G3A1. This promoter, in the absence of Galpha2 expression, was activated less than 2-fold by PKA (Fig. 4B). Galpha2 showed no constitutive transcriptional activity in JEG3 cells; however, it mediated a strong 52-fold activation in response to PKA. This ``restored'' PKA responsiveness was not related to some cryptic characteristic of the reconstituted promoter, since -109/C3A1, which is identical to that of -109/G3A1 except that it contains C/EBP binding sites instead of GAL4 sites(3) , was not responsive to PKA in the absence or presence of C/EBPalpha expression (Fig. 4C). Thus the bZIP domain of C/EBPalpha appears to inhibit the PKA-mediating properties of this transcription factor in non-hepatoma cells.


Figure 4: The bZIP domain represses the PKA-mediating activity of C/EBPalpha in JEG3 cells. A, 7 µg of -490 PCK-CAT was transfected into JEG3 cells along with a 5 µg of C/EBPalpha expression vector and/or 2 µg of PKA expression vector per plate as described under ``Experimental Procedures.'' B, a transfection experiment was designed similar to that described in A except that the CAT reporter plasmid is -109/G3A1, which is a synthetic PEPCK promoter containing the CRE, the AP-1 site, and three GAL4-binding sites. Five µg of the Galpha2 expression vector along with 2 µg of PKA expression plasmid were used. C, a transfection experiment in JEG3 cells was performed similar to that described for A and B, except that the CAT reporter plasmid was -109/C3A1, which is a synthetic PEPCK promoter containing the CRE, the AP-1 site, and three C/EBP binding sites(3) . The values shown are the averages ± S.E. of at least three experiments and are expressed relative to the CAT activity obtained with transfection of the CAT reporter plasmid alone, which was set arbitrarily at 1.0.




DISCUSSION

The PEPCK promoter offers a good model to examine how genes can respond to hormonal signals in a tissue-specific fashion. The cAMP responsiveness of this promoter is robust in liver-derived cells but weak in other cell types, and this liver-specific responsiveness is mediated by a complex cAMP response unit(3, 12) . Consistent with the liver-specific nature of the response, three of the cis-elements required for maximal hormonal responsiveness bind factors that are enriched in liver(10) . Results from in vitro DNA-protein binding assays suggested that this factor may be a member of the C/EBP family(3, 14, 15) , although prior to the present study there has been no functional data in support of this hypothesis nor any data indicating what isoform may be involved. In the present study, we have obtained functional data in support of a role for C/EBP proteins, and, furthermore, using GAL4 fusion methodology, have identified that the alpha-isoform mediates maximal cAMP responsiveness of this promoter. It should be noted that the findings of this study do not rule out the possibility that a combination of alpha and beta isoforms bound to the three C/EBP binding sites could also mediate a cAMP response, only that three C/EBPalpha, but not three C/EBPbeta molecules, bound to the promoter can mediate the response. It is also acknowledged that a role for C/EBP in the cAMP response, which was not explored in this study, cannot be formally eliminated as a possible candidate protein. However, given that 1) the transactivation domains of C/EBPalpha and share no apparent similarities, 2) the expression of C/EBP in liver is weak except under acute phase response conditions, and 3) the cAMP response is apparently mediated by a specific domain lying within the transactivation domain of C/EBPalpha as evidenced by the inactivity of the C/EBPbeta transactivation domain, we feel that a role for C/EBP is unlikely.

Previous hypotheses as to what isoform of C/EBP, if any, might be responsible for mediating the cAMP responsiveness of this promoter suggested C/EBPbeta as a more likely candidate. This reasoning was based on several studies which linked the beta-isoform with the cAMP signaling system, which included the ability of cAMP to (i) stimulate C/EBPbeta gene expression (15) and (ii) to stimulate translocation of C/EBPbeta from the cytosol to the nucleus(27) , although this latter effect is likely cell type-specific. Recently, Darlington and co-workers (28) created knockout mice deficient in C/EBPalpha, and they observed that PEPCK gene expression, which is normally turned on just prior to birth, was significantly reduced in these mice during the first few hours postpartum. While PEPCK gene expression in these knockout mice recovered to normal levels by 7-32 h postpartum, perhaps due to the presence of other C/EBP isoforms, it has not yet been determined whether these mice have the ability to respond to cAMP. The results of the present paper would suggest that, while basal expression of PEPCK gene expression is possible in these mice due to the many transcription factors which likely act on the promoter, including NF-1, HNF-1, HNF-4, CREB, AP-1,(10, 29, 30, 31, 32) , the lack of C/EBPalpha should significantly limit the extent to which this promoter can be activated by a rise in intrahepatocyte cAMP levels. In this respect, it is noteworthy that these knockout mice were severely hypoglycemic and could only be kept alive by glucose injections, implicating that there was an impairment in activating gluconeogenesis, the rate-limiting enzyme of which is PEPCK(33) .

The findings of the present study indicate that the bZIP domain of C/EBPalpha is not required for its ability to mediate cAMP responsiveness in hepatoma cells. Structure/function studies of this protein indicate that the bZIP domain is also not required for its constitutive transactivation function, which instead is mediated by several regions in the amino terminus, including a proline-rich domain(26, 34, 35) . While it is not yet known whether the domain(s) mediating cAMP responsiveness co-resides with the constitutive transactivation domains, the ability of Galpha2 to mediate PKA responsiveness in JEG3 cells, without demonstrating any constitutive transactivation function (Fig. 4B), suggests that different regions of the protein may mediate cAMP-inducible and constitutive activities, similar to that which has been observed for the transcription factor CREB(36, 37) .

The bZIP domain may, however, play an important role in modulating the activity of C/EBPalpha in non-hepatoma cells. Our studies using JEG3 cells suggest an important role for the bZIP domain of C/EBPalpha in modulating the transactivation properties of C/EBPalpha. Removal of the bZIP domain allowed unmasking of the PKA-mediating activity of C/EBPalpha, although no constitutive activity was detectable (Fig. 4, A and B). These results suggest that the bZIP domain exerts a strong inhibitory effect on the PKA-mediating activity of C/EBPalpha in JEG3 cells. Nerlov and Ziff (26) also showed that the bZIP domain exerted a strong inhibitory effect on the ability of C/EBPalpha to transactivate the albumin promoter in HeLa cells. Whether this masking effect occurs through modulation of the DNA binding activity or the transactivation properties is not clear, although it is interesting to note that the DNA-binding activity of C/EBPalpha can be attenuated by phosphorylation of serine 299(38) . The ``scissors-grip'' model of the tertiary structure of the bZIP domain (39) predicts that serine 299, which lies within the basic region, interacts with the major groove of the DNA. Phosphorylation of this serine residue, which has been shown to be a good substrate for protein kinase C(38) , could alter the contact between C/EBPalpha and the negatively charged DNA binding site. Whether the observed ``masking'' of C/EBPalpha's transactivation properties is mediated by PKC in vivo remains to be determined. However, if this turns out to be the case, then the masking phenomenon would also be expected to be operational in liver-derived cells that contain protein kinase C activity. Studies examining the effect of protein kinase C on C/EBPalpha's participation in the cAMP responsiveness of the PEPCK promoter are currently under way.

A question that arises from this study is how does C/EBPalpha get specifically recruited to the PEPCK promoter? In vitro binding assays indicate that both alpha and beta isoforms bind, with identical relative affinities, to the same sites on the promoter(14, 15) , and the similarities in their bZIP domains as well as results from comparative in vitro binding assays (40, 41) suggest that their absolute binding affinities to the three C/EBP binding sites in the PEPCK promoter would be similar. Thus, differences in DNA binding affinities are unlikely to explain the specific recruitment of the alpha-isoform to the promoter. Another model for strategic positioning of proteins involves the specific ``fitting'' of transcription factors to promoters, using protein contact surfaces of adjacently bound factors in addition to DNA sequences(42) . In support of this model, studies from our laboratory have shown that while the AP-1 alone or in conjunction with CREB has no effect on cAMP responsiveness, it greatly augments the weak synergism displayed between the three C/EBP proteins and CREB in mediating cAMP responsiveness(3) . This ``augmenting activity'' of AP-1 could take the form of recruiting C/EBPalpha to the promoter, at least to one of the C/EBP binding sites and possibly all three. Such an activity would likely require protein-protein interactions, and it is noteworthy that not only does AP-1 bind to the promoter in a region where it is closely surrounded by the three C/EBP molecules, but one of the C/EBP binding sites is closely juxtapositioned to the AP-1 site such that an uninterrupted DNase I footprint extends over both sites on the sense strand using liver nuclear extracts(10) . However, since AP-1 is also required for maximal cAMP responsiveness in the studies using Galpha2 (Table 3), where no specific recruitment is necessary due to the GAL4 domain, AP-1 must possess additional functions besides the putative recruiting role.

The findings of this study have important implications for other regulatory aspects of the PEPCK promoter. Thyroid hormone (T(3)) stimulates transcription of this gene, and T(3) responsiveness is mediated by a C/EBP-binding site that resides within the LSR along with a typical thyroid hormone response element(43, 44) . While it is still unknown as to whether C/EBPalpha is involved in this response, it seems possible that this transcription factor could serve to integrate information from different signaling pathways along with tissue-specific responses. In fact, the involvement of C/EBPalpha in both the cAMP and thyroid hormone responses may provide a mechanism for the synergistic activation of PEPCK gene transcription elicited by these two signals(43) . Studies examining the role of C/EBPalpha in the T(3) response, along with characterization of the specific domains that mediate the various responses, should provide interesting information on the various functions mediated by this protein.


FOOTNOTES

*
This work was supported by operating grants from the Medical Research Council of Canada and the Canadian Diabetes Association (to W. J. R.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed. Tel.: 306-966-4375; Fax: 306-966-4390; roesler{at}duke.usask.ca.

(^1)
The abbreviations used are: CRE, cAMP response element; CREB, cAMP response element-binding protein; PEPCK, phosphoenolpyruvate carboxykinase; C/EBP, CCAAT/enhancer-binding protein; AP-1, activator protein 1; CAT, chloramphenicol acetyltransferase; PKA, protein kinase A; bZIP, basic region leucine zipper; LSR, liver-specific region; T(3), triiodothyronine.

(^2)
W. J. Roesler and P. J. McFie, unpublished observations.

(^3)
W. J. Roesler and G. F. Davies, unpublished observations.


ACKNOWLEDGEMENTS

We thank Shizuo Akira, Richard Hanson, G. Stanley McKnight, Steve McKnight, John Nilson, and Ivan Sadowski for plasmids. We also thank Gerald Davies for performing the Western blot analyses.


REFERENCES

  1. de Groot, R. P., and Sassone-Corsi, P. (1993) Mol. Endocrinol. 7, 145-153 [Free Full Text]
  2. Imagawa, M., Chiu, R., and Karin, M. (1987) Cell 51, 251-260 [CrossRef][Medline] [Order article via Infotrieve]
  3. Roesler, W. J., Simard, J., Graham, J. G., and McFie, P. J. (1994) J. Biol. Chem. 269, 14276-14283 [Abstract/Free Full Text]
  4. Silver, B. J., Bokar, J. A., Virgin, J. B., Vallen, E. A., Milsted, A., and Nilson, J. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 2198-2202 [Abstract/Free Full Text]
  5. Fisch, T. M., Prywes, R., Simon, M. C., and Roeder, R. G. (1989) Genes & Dev. 3, 198-211
  6. Nitsch, D., Boshart, M., and Schutz, G. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 5479-5483 [Abstract/Free Full Text]
  7. Roesler, W. J., McFie, P. J., and Puttick, D. M. (1993) J. Biol. Chem. 268, 3791-3796 [Abstract/Free Full Text]
  8. Lamers, W. H., Hanson, R. W., and Meisner, H. M. (1982) Proc. Natl. Acad. Sci. U. S. A. 79, 5137-5141 [Abstract/Free Full Text]
  9. Meisner, H., Loose, D. S., and Hanson, R. W. (1985) Biochemistry 24, 421-425 [CrossRef][Medline] [Order article via Infotrieve]
  10. Roesler, W. J., Vandenbark, G. R., and Hanson, R. W. (1989) J. Biol. Chem. 264, 9657-9664 [Abstract/Free Full Text]
  11. Patel, Y. M., Yun, J. S., Liu, J., McGrane, M. M., and Hanson, R. W. (1994) J. Biol. Chem. 269, 5619-5628 [Abstract/Free Full Text]
  12. Liu, J., Park, E. A., Gurney, A. L., Roesler, W. J., and Hanson, R. W. (1991) J. Biol. Chem. 266, 19095-19102 [Abstract/Free Full Text]
  13. Roesler, W. J., Graham, J. G., Kolen, R., Klemm, D. J., and McFie, P. J. (1995) J. Biol. Chem. 270, 8225-8232 [Abstract/Free Full Text]
  14. Park, E. A., Roesler, W. J., Liu, J., Klemm, D. J., Gurney, A. L., Thatcher, J. D., Shuman, J., Friedman, A., and Hanson, R. W. (1990) Mol. Cell. Biol. 10, 6264-6272 [Abstract/Free Full Text]
  15. Park, E. A., Gurney, A. L., Nizielski, S. E., Hakimi, P., Cao, Z., Moorman, A., and Hanson, R. W. (1993) J. Biol. Chem. 268, 613-619
  16. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed., pp. 16.32-16.38, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  17. Olive, M., Williams, S. C., Dezan, C., Johnson, P. F., and Vinson, C. (1996) J. Biol. Chem. 271, 2040-2047 [Abstract/Free Full Text]
  18. Silver, B. J., Bokar, J. A., Virgin, J. B., Vallen, E. A., Milsted, A., and Nilson, J. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 2198-2202
  19. Webster, N., Jin, J. R., Green, S., Hollis, M., and Chambon, P. (1988) Cell 52, 169-178 [CrossRef][Medline] [Order article via Infotrieve]
  20. Sadowski, I., and Ptashne, M. (1989) Nucleic Acids Res. 17, 7539 [Free Full Text]
  21. Landschultz, W. H., Johnson, P. F., Adashi, E. Y., Graves, B. J., and McKnight, S. L. (1988) Genes & Dev. 2, 786-800
  22. Kunkel, T. A. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 488-492 [Abstract/Free Full Text]
  23. Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T., Hirano, T., and Kishimoto, T. (1990) EMBO J. 9, 1897-1906 [Medline] [Order article via Infotrieve]
  24. Alam, T., An, M. R., and Papaconstantinou, J. (1992) J. Biol. Chem. 267, 5021-5024 [Abstract/Free Full Text]
  25. Stein, B., Cogswell, P. C., and Baldwin, A. S., Jr. (1993) Mol. Cell. Biol. 13, 3964-3974 [Abstract/Free Full Text]
  26. Nerlov, C., and Ziff, E. B. (1994) Genes & Dev. 8, 350-362
  27. Metz, R., and Ziff, E. (1991) Genes & Dev. 5, 1754-1766
  28. Wang, N.-D., Finegold, M. J., Bradley, A., Ou, C. N., Abdelsayed, S. V., Wilde, M. D., Taylor, L. R., Wilson, D. R., and Darlington, G. J. (1995) Science 269, 1108-1112 [Abstract/Free Full Text]
  29. Gurney, A. L., Park, E. A., Giralt, M., Liu, J., and Hanson, R. W. (1992) J. Biol. Chem. 267, 18133-18139 [Abstract/Free Full Text]
  30. Yanuka-Kashles, O., Cohen, H., Trus, M., Aran, A., Benvenisty, N., and Reshef, L. (1994) Mol. Cell. Biol. 14, 7124-7133 [Abstract/Free Full Text]
  31. Hall, R. K., Sladek, F. M., and Granner, D. K. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 412-416 [Abstract/Free Full Text]
  32. O'Brien, R. M., Noisin, E. L., Suwanichkul, A., Yamasaki, T., Lucas, P. C., Wang, J.-C., Powell, D. R., and Granner, D. K. (1995) Mol. Cell. Biol. 15, 1747-1758 [Abstract]
  33. Rognstad, R. (1979) J. Biol. Chem. 254, 1875-1878 [Abstract/Free Full Text]
  34. Friedman, A. D., and McKnight, S. L. (1990) Genes & Dev. 4, 1416-1426
  35. Pei, D., and Shih, C. (1991) Mol. Cell. Biol. 11, 1480-1487 [Abstract/Free Full Text]
  36. Gonzalez, G. A., Menzel, P., Leonard, J., Fischer, W. H., and Montminy, M. R. (1991) Mol. Cell. Biol. 11, 1306-1312 [Abstract/Free Full Text]
  37. Quinn, P. G. (1993) J. Biol. Chem. 268, 16999-17009 [Abstract/Free Full Text]
  38. Mahoney, C. W., Shuman, J., McKnight, S. L., Chen, H.-C., and Huang, K.-P. (1992) J. Biol. Chem. 267, 19396-19403 [Abstract/Free Full Text]
  39. Vinson, C. R., Sigler, P. B., and McKnight, S. L. (1989) Science 246, 911-916 [Abstract/Free Full Text]
  40. Cao, Z., Umek, R. M., and McKnight, S. L. (1991) Genes & Dev. 5, 1538-1552
  41. Williams, S. C., Cantwell, C. A., and Johnson, P. F. (1991) Genes & Dev. 5, 1553-1567
  42. Lamb, P., and McKnight, S. L. (1991) Trends Biochem. Sci. 16, 417-422 [CrossRef][Medline] [Order article via Infotrieve]
  43. Giralt, M., Park, E. A., Gurney, A. L., Liu, J., Hakimi, P., and Hanson, R. W. (1991) J. Biol. Chem. 266, 21991-21996 [Abstract/Free Full Text]
  44. Park, E. A., Jerden, D. C., and Bahouth, S. W. (1995) Biochem. J. 309, 913-919

©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
P. J. McFie, G.-L. Wang, N. A. Timchenko, H. L. Wilson, X. Hu, and W. J. Roesler
Identification of a Co-repressor That Inhibits the Transcriptional and Growth-Arrest Activities of CCAAT/Enhancer-binding Protein {alpha}
J. Biol. Chem., June 30, 2006; 281(26): 18069 - 18080.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Krones-Herzig, A. Mesaros, D. Metzger, A. Ziegler, U. Lemke, J. C. Bruning, and S. Herzig
Signal-dependent Control of Gluconeogenic Key Enzyme Genes through Coactivator-associated Arginine Methyltransferase 1
J. Biol. Chem., February 10, 2006; 281(6): 3025 - 3029.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Choy and R. Derynck
Transforming Growth Factor-beta Inhibits Adipocyte Differentiation by Smad3 Interacting with CCAAT/Enhancer-binding Protein (C/EBP) and Repressing C/EBP Transactivation Function
J. Biol. Chem., March 7, 2003; 278(11): 9609 - 9619.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. L. Wilson, P. J. McFie, and W. J. Roesler
Different Transcription Factor Binding Arrays Modulate the cAMP Responsivity of the Phosphoenolpyruvate Carboxykinase Gene Promoter
J. Biol. Chem., November 8, 2002; 277(46): 43895 - 43902.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. A. Jurado, S. Song, W. J. Roesler, and E. A. Park
Conserved Amino Acids within CCAAT Enhancer-binding Proteins (C/EBPalpha and beta ) Regulate Phosphoenolpyruvate Carboxykinase (PEPCK) Gene Expression
J. Biol. Chem., July 26, 2002; 277(31): 27606 - 27612.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
X. Liu, Q.-T. Wall, L. Taylor, and N. P. Curthoys
C/EBPbeta contributes to cAMP-activated transcription of phosphoenolpyruvate carboxykinase in LLC-PK1-F+ cells
Am J Physiol Renal Physiol, October 1, 2001; 281(4): F649 - F657.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
H. L. Ross, M. R. Nonnemacher, T. H. Hogan, S. J. Quiterio, A. Henderson, J. J. McAllister, F. C. Krebs, and B. Wigdahl
Interaction between CCAAT/Enhancer Binding Protein and Cyclic AMP Response Element Binding Protein 1 Regulates Human Immunodeficiency Virus Type 1 Transcription in Cells of the Monocyte/Macrophage Lineage
J. Virol., February 15, 2001; 75(4): 1842 - 1856.
[Abstract] [Full Text]


Home page
Mol. Pharmacol.Home page
S. Immenschuh, V. Hinke, N. Katz, and T. Kietzmann
Transcriptional Induction of Heme Oxygenase-1 Gene Expression by Okadaic Acid in Primary Rat Hepatocyte Cultures
Mol. Pharmacol., March 1, 2000; 57(3): 610 - 618.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
S. M. Crosson and W. J. Roesler
Hormonal Regulation of the Phosphoenolpyruvate Carboxykinase Gene. ROLE OF SPECIFIC CCAAT/ENHANCER-BINDING PROTEIN ISOFORMS
J. Biol. Chem., February 25, 2000; 275(8): 5804 - 5809.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J.-C. Wang, P.-E. Strömstedt, T. Sugiyama, and D. K. Granner
The Phosphoenolpyruvate Carboxykinase Gene Glucocorticoid Response Unit: Identification of the Functional Domains of Accessory Factors HNF3{beta} (Hepatic Nuclear Factor-3{beta}) and HNF4 and the Necessity of Proper Alignment of Their Cognate Binding Sites
Mol. Endocrinol., April 1, 1999; 13(4): 604 - 618.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
K. Yamada, D. T. Duong, D. K. Scott, J.-C. Wang, and D. K. Granner
CCAAT/Enhancer-binding Protein beta  Is an Accessory Factor for the Glucocorticoid Response from the cAMP Response Element in the Rat Phosphoenolpyruvate Carboxykinase Gene Promoter
J. Biol. Chem., February 26, 1999; 274(9): 5880 - 5887.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. A. Park, S. Song, C. Vinson, and W. J. Roesler
Role of CCAAT Enhancer-binding Protein beta  in the Thyroid Hormone and cAMP Induction of Phosphoenolpyruvate Carboxykinase Gene Transcription
J. Biol. Chem., January 1, 1999; 274(1): 211 - 217.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Croniger, P. Leahy, L. Reshef, and R. W. Hanson
C/EBP and the Control of Phosphoenolpyruvate Carboxykinase Gene Transcription in the Liver
J. Biol. Chem., November 27, 1998; 273(48): 31629 - 31632.
[Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
V. M. Christoffels, T. Grange, K. H. Kaestner, T. J. Cole, G. J. Darlington, C. M. Croniger, and W. H. Lamers
Glucocorticoid Receptor, C/EBP, HNF3, and Protein Kinase A Coordinately Activate the Glucocorticoid Response Unit of the Carbamoylphosphate Synthetase I Gene
Mol. Cell. Biol., November 1, 1998; 18(11): 6305 - 6315.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Renal Physiol.Home page
W. Liu, E. Feifel, T. Holcomb, X. Liu, N. Spitaler, G. Gstraunthaler, and N. P. Curthoys
PMA and staurosporine affect expression of the PCK gene in LLC-PK1-F+ cells
Am J Physiol Renal Physiol, September 1, 1998; 275(3): F361 - F369.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Yeagley, J. M. Agati, and P. G. Quinn
A Tripartite Array of Transcription Factor Binding Sites Mediates cAMP Induction of Phosphoenolpyruvate Carboxykinase Gene Transcription and Its Inhibition by Insulin
J. Biol. Chem., July 24, 1998; 273(30): 18743 - 18750.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. M. Agati, D. Yeagley, and P. G. Quinn
Assessment of the Roles of Mitogen-activated Protein Kinase, Phosphatidylinositol 3-Kinase, Protein Kinase B, and Protein Kinase C in Insulin Inhibition of cAMP-induced Phosphoenolpyruvate Carboxykinase Gene Transcription
J. Biol. Chem., July 24, 1998; 273(30): 18751 - 18759.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. J. Roesler, E. A. Park, and P. J. McFie
Characterization of CCAAT/Enhancer-binding Protein alpha  as a Cyclic AMP-responsive Nuclear Regulator
J. Biol. Chem., June 12, 1998; 273(24): 14950 - 14957.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Sassi, R. Pictet, and T. Grange
Glucocorticoids are insufficient for neonatal gene induction in the liver
PNAS, May 12, 1998; 95(10): 5621 - 5625.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. J. D. Delhanty and R. C. Baxter
The Regulation of Acid-Labile Subunit Gene Expression and Secretion by Cyclic Adenosine 3',5'-Monophosphate
Endocrinology, January 1, 1998; 139(1): 260 - 265.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Hemati, S. E. Ross, R. L. Erickson, G. E. Groblewski, and O. A. MacDougald
Signaling Pathways through Which Insulin Regulates CCAAT/Enhancer Binding Protein alpha  (C/EBPalpha ) Phosphorylation and Gene Expression in 3T3-L1 Adipocytes. CORRELATION WITH GLUT4 GENE EXPRESSION
J. Biol. Chem., October 10, 1997; 272(41): 25913 - 25919.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
S. P. Savon, P. Hakimi, D. R. Crawford, D. J. Klemm, A. L. Gurney, and R. W. Hanson
The Promoter Regulatory Regions of the Genes for the Cytosolic Form of Phosphoenolpyruvate Carboxykinase (GTP) from the Chicken and the Rat Have Different Species-Specific Roles in Gluconeogenesis
J. Nutr., February 1, 1997; 127(2): 276 - 285.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
D. M. Fass, J. C. Craig, S. Impey, and R. H. Goodman
Cooperative Mechanism of Transcriptional Activation by a Cyclic AMP-response Element Modulator alpha Mutant Containing a Motif for Constitutive Binding to CREB-binding Protein
J. Biol. Chem., January 26, 2001; 276(5): 2992 - 2997.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Yeagley, S. Guo, T. Unterman, and P. G. Quinn
Gene- and Activation-specific Mechanisms for Insulin Inhibition of Basal and Glucocorticoid-induced Insulin-like Growth Factor Binding Protein-1 and Phosphoenolpyruvate Carboxykinase Transcription. ROLES OF FORKHEAD AND INSULIN RESPONSE SEQUENCES
J. Biol. Chem., August 31, 2001; 276(36): 33705 - 33710.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Yeagley, J. Moll, C. A. Vinson, and P. G. Quinn
Characterization of Elements Mediating Regulation of Phosphoenolpyruvate Carboxykinase Gene Transcription by Protein Kinase A and Insulin. IDENTIFICATION OF A DISTINCT COMPLEX FORMED IN CELLS THAT MEDIATE INSULIN INHIBITION
J. Biol. Chem., June 2, 2000; 275(23): 17814 - 17820.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Roesler, W. J.
Right arrow Articles by McFie, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roesler, W. J.
Right arrow Articles by McFie, P. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1996 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement