JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hwang, M.-C. C.
Right arrow Articles by Hwang, Y.-W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hwang, M.-C. C.
Right arrow Articles by Hwang, Y.-W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 271, Number 14, Issue of April 5, 1996 pp. 8196-8202
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
The Differential Effects of the Gly-60 to Ala Mutation on the Interaction of H-Ras p21 with Different Downstream Targets (*)

(Received for publication, November 3, 1995; and in revised form, January 10, 1996)

Mo-Chou Chen Hwang (1) Ying-Ju Sung (1) (2) Yu-Wen Hwang (1) (2)(§)

From the  (1)Molecular Biology Department, New York State Institute for Basic Research in Developmental Disabilities, Staten Island, New York 10314 and the (2)CSI/IBR Center for Developmental Neuroscience and Graduate Program in Biology, City University of New York, New York, New York 10036

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

We examined the effects of the Gly-60 to Ala mutation on the interaction of H-Ras with Ras GTPase activating protein (GAP), neurofibromin 1 (NF1), Raf-1, and ral guanine nucleotide dissociation stimulator (ralGDS), factors that interact with GTP-bound form of H-Ras. Previous study has shown that the G60A mutation perturbs GTP-induced conformational changes of H-Ras. We found that the G60A mutation decreases GTPase activity of H-Ras without significantly affecting GTP/GDP binding. The reduction in GTPase activity is most dramatic in the presence of GAP or NF1. Interestingly, the G60A mutation does not appear to alter the affinity of H-Ras for GAP or NF1. The G60A mutation moderately reduces the binding of H-Ras to Raf-1 Ras binding domain; however, the binding of H-Ras to ralGDS Ras binding domain was more significantly affected by the same mutation. These results indicate that although GAP, NF1, Raf-1, and ralGDS all interact with H-Ras in a GTP-dependent manner and they are able to compete against each other for binding to H-Ras, these factors share overlapping but not identical binding domains on H-Ras. The significance of our findings is discussed in the light of the GTP-induced conformational change model.


INTRODUCTION

Like all other members of the regulatory GTPases, Ras p21 cycles between two states: the active, GTP-bound state and the inactive, GDP-bound state(1, 2) . The cycle is controlled by the balance of guanine nucleotide exchange and GTP hydrolysis, which are in turn regulated by guanine nucleotide exchange factors and factors that possess GAP (^1)activity(3) . The differences between these two states are characterized by the differences in their ability to exert biological effects and to be recognized by several protein factors, such as GAP/NF1, Raf-1, ralGDS, and others(4, 5, 6, 7, 8, 9) . GTP induces conformational change in Ras(3) ; it is clear that the difference in the protein structures between the GDP-bound state and the GTP-bound state must account for the difference in Ras activities.

The GTP binding induces conformational change primarily in two regions of H-Ras termed the switch I (residues 30-38, loop 2, and the effector domain) and the switch II (residues 60-76, loop 4, and helix 2) domains(10, 11, 12) . Therefore, any Ras activity that is associated with RasbulletGTP would be likely to involve these two regions. The requirement of the switch I region for the action of Ras is well documented(3, 4, 5, 13) . Numerous mutations in the switch I region have been shown to disrupt the biological and biochemical functions of Ras(3, 4) . On the other hand, although the interaction of H-Ras with exchange factors appears to require the switch II domain(14, 15, 16, 17, 18) , the role of the switch II region for the activity of Ras is still not clear. In fact, studies using deletion mutants as well as Ras-Rap chimeras have concluded that the switch II region is not essential for the biological activity of H-Ras(19, 20) .

In the process of conformational change, residues in the loop 4 undergo significant movements and reorientations to adapt the -phosphate moiety of GTP(21) . The key feature of the loop 4 is a highly conserved glycine residue, which is also a part of the consensus DXXG motif of regulatory GTPase family(22) . Because glycine exhibits a much broader range of and dihedral angles than other amino acids and will allow sharp bend around the residue(23) , it is uniquely suitable for serving as a pivot for conformational change. Although the glycine in the DXXG motif is not conserved in all regulatory GTPases (24, 25) , its importance to the function of regulatory GTPases has been demonstrated in heterotrimeric G protein, EF-Tu, and H-Ras(26, 27, 28, 29, 30) . In H-Ras, the substitution of the glycine residue by alanine (G60A mutation) was found to perturb the GTP-induced conformation change and to abolish the biological activity(29) . A preliminary NMR study supports the hypothesis that the region affected by the G60A mutation is the switch II domain, whereas the switch I domain appears to be unaltered. (^2)This finding is in accord with the studies of G and EF-Tu harboring the corresponding mutation (26, 27, 28) and supports the crucial functional role of the switch II region for regulatory GTPases. In this study, we examined the effects of the G60A mutation on the GTPase activity of H-Ras and on the interaction of H-Ras with four factors that interact with H-RasbulletGTP.


MATERIALS AND METHODS

Mutant and Clone Construction

The c-H-Ras(G60A) mutant was constructed by oligonucleotide site-directed mutagenesis (31) using oligonucleotide CTTCTTGAGCTGCTGTG as the mutagenic primer. The mouse ralGDS-C127 (C-domain 127 residues fragment) was prepared by PCR from the full-length ralGDS clone(32) . The oligonucleotides TTCCTTATCGATGCCTCTCTACAACCAGCA (5` primer containing a ClaI site) and CTCTCTCTCGAGACGTCCTTAGAAGATGCC (3` primer containing a XhoI site) were used for amplification. The PCR product was digested with ClaI and XhoI and then inserted into the ClaI-XhoI sites of a modified GST fusion vector(29) . The maltose binding protein (MBP) fusion ralGDS-C127 clone was prepared similarly to the GST-ralGDS-C127 clone, except that the oligonucleotide TCTCTCGAATTCTCACTGCCTCTCTACAACCAG (containing an EcoRI site) was used as the 5` PCR primer. The PCR product was then cleaved with EcoRI and XhoI and cloned into the EcoRI-SalI sites of vector pMALc2 (New England Biolabs, Inc.). For cloning H-Ras gene into the Gal4 DNA binding domain vector, the multiple cloning site of pGBT9 was first modified by inserting an oligonucleotide linker between the EcoRI and SalI sites. This modification abolishes the EcoRI site but creates a ClaI and a NdeI site preceding the SalI site. The introduction of the C186S mutation were performed by PCR using pHR clone (33) as the template and the following oligonucleotides: ACCGGAATTCAAAATTAAGGAGGATCC and GAGAGAGTCGACCCTCACCTGGTGTCAGGACAGCACAGACTTGCAGCTCATGC (containing a SalI site), respectively, as the 5` and 3` primer. The 5` primer includes sequences from the ribosome binding region of the cloning vector pND1 and a BamHI site(33, 34) . The 3` PCR primer contains a sequence that is complementary to the last nine codons of the H-Ras gene except that the Cys codon at position 186 was replaced by a Ser codon (underlined). The H-Ras PCR product was digested with ClaI and SalI, and then cloned into the ClaI-SalI sites of the modified vector pGBT9. The Raf-N275 DNA fragment was prepared by PCR using oligonucleotides TCTCTCGAATTCATGGAGCACATACAGGGAGCT (containing an EcoRI site) and TTCCTTCTCGAGTCACATCCTGCTGTCCACAGGCAG (containing a XhoI site) from the human full-length Raf-1 cDNA clone as described(29) . The pGAD-Raf-1 N-terminal 275-residue fragment (Raf-N275) plasmid was then obtained by cloning the PCR fragment into the vector pGAD424 via the EcoRI and the XhoI-SalI sites. Similarly, the pGAD-ralGDS-C127 plasmid was obtained by ligating the pGAD424 vector with the same ralGDS-C127 fragment produced for constructing the MBP fusion ralGDS-C127 clone via the EcoRI and the XhoI-SalI sites.

Protein Purification

Nondenaturing conditions were used throughout for preparing proteins. The intact H-Ras proteins were purified by a combination of ion exchange and gel filtration columns as described(33) . GST fusion proteins were purified using glutathione-Sepharose as described(29) . The MBP fusion protein was purified using amylose resin (New England Biolabs, Inc.) by following the manufacturer's instructions.

GTP/GDP Binding and Dissociation

GTP/GDP dissociation constants and the rate of nucleotide release were determined exactly as described(29) . The data (averages and standard deviations) were calculated from the results of duplicate experiments each with two samples.

GTPase and NF1 Competition Assays

The time course of GTPase activity was measured by monitoring the release of P(i) from [-P]GTP as follows. The reaction mixture (100 µl) contained 50 mM Tris-HCl, pH 7.4, 2 mM MgCl(2), 50 mM KCl, 50 µg/ml BSA, 1 mM dithiothreitol, and 100 nM of labeled H-Ras (specific activity, 1500 Ci/mmol). GTP hydrolysis was initiated by the addition of 4 nM of full-length GAP. The mixtures were incubated at 30 °C and at the specified times, 10-µl aliquots were withdrawn, and free phosphate was analyzed by the isobutanol-benzene extraction method (35) as described(29) . A reaction mixture minus GAP was similarly prepared and used to determine the intrinsic hydrolysis rate. The steady-state kinetic parameters of GAP-stimulated GTP hydrolysis were determined in a 50-µl volume similarly as described by others (36) except that the progress of the reaction was monitored by the release of P(i). The data (eight data points) obtained from 0.1 to 10 µM of substrate (c-H-Rasbullet[-P]GTP; specific activity, 25 Ci/mmol) and 0.5 nM GAP (or 5 nM GST-NF1) were then used to fit the Michaelis-Menton equation to determine k and K(m). The NF1 concentration-dependent reactions were performed in 100 µl of reaction mixture containing 50 mM Tris-HCl, pH 7.4, 2 mM MgCl(2), 50 mM KCl, 50 µg/ml BSA, 1 mM dithiothreitol, and 62.5 nM c-H-Rasbullet[-P]GTP (specific acticity, 450 Ci/mmol). The reactions were started by the addition of GST-NF1 and allowed to proceed for 10 min at 30 °C. The NF1 competition assay was similarly performed in a 50-µl mixture containing 25 nM c-H-Rasbullet[-P]GTP, 6 nM GST-NF1, and varying amounts of competing H-Ras. The reaction was initiated by the addition of labeled c-H-Ras and allowed to proceed for 10 min at 30 °C. The reaction was monitored by the release of P(i) as described above. The data (averages and standard deviations) were calculated from the results of duplicate experiments each with two samples.

Raf-1 and ralGDS Binding Assays

Raf-1 or ralGDS binding was determined by a co-precipitation assay as described(29) . The binding reactions were carried out in a 200-µl reaction mixture containing a constant amount of H-Rasbullet[-P]GTP (62.5 nM; specific activity, 450 Ci/mmol) and 20-1200 nM Raf-N275 or ralGDS-C127. The binding was allowed to proceed for 30 min at 4 °C and followed by an additional 30 min incubation with either glutathione-Sepharose (for precipitating GST-fusion proteins) or amylose-resin (for precipitating MBP-fusion proteins). The bound H-Ras was then separated from the reaction mixture by passing it through a glass fiber filter and quantified by scintillation counting. Dissociation constants were calculated from a Scatchard plot. Similar reactions performed without the addition of GST or MBP fusion protein were used as controls. Raf-1 and ralGDS competition assays were performed in 200-µl reaction mixtures containing 62.5 nM H-Rasbullet[-P]GTP, 167 nM GST-Raf-N275 (precipitating agent), and 0.3-4.8 µM MBP-ralGDS-C127 (competing agent) similarly as described above. The amount of H-Rasbullet[-P]GTP co-precipitated without MBP-ralGDS-C127 was used as 100% for calculation. The data (averages and standard deviations) were calculated from the results of duplicate experiments each with two samples.

Two-hybrid System

Two-hybrid system assays were performed in yeast strain SFY526 (37) supplied by the Matchmaker two-hybrid system kit from Clontech Laboratories. beta-Galactosidase activity was quantified in a liquid culture assay following the procedure provided by the vender. Briefly, 1.5 ml of yeast cells in log phase (A about 1) were collected by centrifugation, washed, and resuspended in 0.3 ml of Z buffer containing 50 mM sodium phosphate buffer, pH 7.0, 10 mM KCl, and 50 mM MgSO(4). Yeast cell lysate was prepared by three cycles of freezing in liquid nitrogen and thawing in a 37 °C water bath. The measurement of beta-galactosidase activity was performed in a 1-ml reaction mixture containing Z buffer, 0.1-0.3 ml of yeast lysate, 0.6 mg/ml o-nitrophenylgalactoside, and 40 mM beta-mercaptoethanol. The reaction was allowed to proceed at 30 °C in the dark until the yellow color appeared, and it was terminated by adding 0.4 ml of 1 M Na(2)CO(3). The optical density of the reaction mixtures were determined at 420 nm after cell debris were removed by centrifugation at 12,000 times g for 10 min. The beta-galactosidase activity expressed in Miller units was calculated by the following equation: beta-galactosidase unit = 1000 times [A/reaction time (min) times original cell volume (ml) times cell density (A)] as described(38) . The maximum incubation time for all experiments was 3 h. Under these conditions, the beta-galactosidase detection limit was about 0.02 unit. The data presented in the tables were obtained from the duplicate experiments performed on three independent yeast transformats (total number of analyses was 6).


RESULTS

The G60A Mutation Perturbs GAP and NF1-stimulated GTP Hydrolysis But Not the Binding of H-Ras to GAP or NF1

Previously, we showed that the physical interaction of v-H-Ras with GAP was not affected by the G60A mutation(29) . However, the effect of the G60A mutation on the GAP-induced GTPase activity of H-Ras was not determined because the mutation was constructed in the v-H-Ras background, which possesses little GTP hydrolysis activity. In order to measure GTPase activity, c-H-Ras harboring the same G60A mutation was constructed.

The biochemical property of c-H-Ras(G60A) was first examined by determining the GDP/GTP dissociation constants (Table 1). The equilibrium binding indicates that the c-H-Ras(G60A) appears to have slightly lower GDP/GTP binding affinity than c-H-Ras. This result is opposite to our measurements with v-H-Ras(G60A), where we observed a slight increase in GDP/GTP binding over v-H-Ras(29) . The intrinsic GDP/GTP release also shows that nucleotide dissociates faster from c-H-Ras(G60A) than from c-H-Ras (Fig. 1). Nevertheless, considering the intracellular concentrations of GTP/GDP, these differences are small and are unlikely to have physiological significance. Therefore, we conclude that the G60A mutation does not significantly alter the GDP/GTP binding affinity of either c-H-Ras or v-H-Ras.




Figure 1: Time course of GTP/GDP release from c-H-Ras and c-H-Ras(G60A). GDP/GTP dissociation was measured by labeling p21 with [^3H]GDP (bullet and ) or [^3H]GTP (circle and box) to equilibrium and then chased with a 500-fold excess of cold respective guanine nucleotides. The chase reactions were carried out in the presence of 0.5 mM free Mg ion at 30 °C and quantified by membrane filtration method as described (29) . C(o) represents the amounts of GDP/GTP at time zero, and C(t) represents the amounts of GDP/GTP at the indicated time point. circle and bullet, c-H-Ras; box and , c-H-Ras(G60A).



In contrast to GDP/GTP binding, the GTPase activity of c-H-Ras was markedly reduced by the G60A mutation. We observed a 30-fold reduction in k for the intrinsic GTPase (Table 2). More strikingly, the GTP hydrolysis stimulated by GAP was largely abolished by the G60A mutation (Fig. 2). The k of GAP-stimulated GTPase of the c-H-Ras is over 4 orders of magnitude greater than that of c-H-Ras(G60A) (Table 2). Nevertheless, c-H-Ras(G60A) still displays a measurable level of GAP-stimulated GTPase activity, which is distinguishable from that of v-H-Ras (Fig. 3).




Figure 2: Time course of intrinsic and GAP-stimulated GTP hydrolysis. GTP hydrolysis was measured by monitoring the release of P(i) from [-P]GTP in a 100-µl reaction mixture containing 50 mM Tris-HCl, pH 7.4, 2 mM MgCl(2), 50 mM KCl, 50 µg/ml BSA, 1 mM dithiothreitol, and 100 nM of [-P]GTP-labeled H-Ras (specific activity, 1500 Ci/mmol). GTP hydrolysis was initiated by the addition of 4 nM of full-length GAP. A set of reaction without adding GAP was used for measuring the intrinsic rate. The experiments were performed at 30 °C, and at the specified times the free phosphate was analyzed by the isobutanol-benzene extraction method as described under ``Materials and Methods.'' circle, c-H-Ras intrinsic; bullet, c-H-Ras + GAP; box, c-H-Ras(G60A) intrinsic; , c-H-Ras(G60A); up triangle, v-H-Ras intrinsic; , v-H-Ras + GAP.




Figure 3: Stimulation of GTP hydrolysis by GST-NF1. NF1-stimulated GTP hydrolysis was performed in a 100-µl reaction mixture containing 50 mM Tris-HCl, pH 7.4, 2 mM MgCl(2), 50 mM KCl, 50 µg/ml BSA, 1 mM dithiothreitol, and 62.5 nM [-P]GTP-labeled H-Ras (specific activity 450 Ci/mmol). The reactions were started by the addition of the indicated amounts of GST-NF1 and allowed to proceed for 10 min at 30 °C. The release of P(i) was analyzed similar to the reaction involving GAP. The results were corrected for the intrinsic rate before plotting. bullet, c-H-Ras; , c-H-Ras(G60A).



Previous study showed that the G G226A mutant exhibited a reduction in GTPase activity when the Mg concentration in the reaction mixture was lower than 100 nM; however, the reduction was restored by supplying millimolar concentrations of Mg(27) . Thus, we determined the intrinsic and the GAP-stimulated GTPase at Mg concentrations ranging from 0.1 to 5 mM. For the G60A mutant, we were unable to detect a significant variation in the rate of GTP hydrolysis due to Mg concentration (data not shown). Routinely, we performed GTP hydrolysis at 2 mM Mg. Although the GAP-stimulated GTPase is drastically reduced, the affinity of H-Ras for GAP appears to be unaffected by the G60A mutation (Table 2). In fact, the apparent K(m) for the GAP-stimulated GTP hydrolysis reaction suggests that the affinity of H-Ras for GAP may be slightly enhanced, a result similar to that of v-H-Ras(G60A)(29) . This observation is not unique for the G60A mutant because a neighboring mutation at position 61 has been shown to enhance GAP binding(36, 39) .

The effect of the G60A mutation on the NF1-stimulated GTPase was also examined. A GST fusion protein containing 367 residues of the NF1 catalytic domain was used in the study(40) . This fusion NF1 fragment was able to promote GTP hydrolysis, but its activity was lower than that of the full-length GAP under the assay condition. The k for the NF1-stimulated GTP hydrolysis was estimated to be 10.7 min, as compared with 432 min for the GAP-stimulated reaction (Table 2). On the other hand, NF1 appears to have higher affinity for H-Ras than GAP as indicated by the K(m) of the reaction. Similar to the GAP-stimulated reaction, the G60A mutation drastically reduced the NF1-stimulated GTP hydrolysis (Fig. 4). In fact, we were unable to detect GTP hydrolysis stimulated by NF1 under the assay condition. In order to measure the affinity of the G60A mutant for NF1, an indirect competition assay was performed(29, 41) . In this assay, either cold RasbulletGDP or RasbulletGTP was used as the competing agent for the activity of NF-1. Fig. 4shows that both v-H-RasbulletGTP and v-H-Ras(G60A)bullet GTP display comparable levels of inhibitory activity against GST-NF1, whereas v-H-RasbulletGDP and v-H-Ras(G60A)bulletGDP were much less effective. This observation indicates that the G60A mutation does not perturb the binding of H-Ras and NF-1.


Figure 4: Inhibition of GST-NF1 activity by v-H-Ras and v-H-Ras(G60A). The experiments were performed by measuring the GST-NF1-stimulated GTP hydrolysis of c-H-Ras bullet[-P]GTP in the presence of the indicated amounts of competitor H-Ras p21. The experiments were performed similarly as described in the legend to Fig. 3in a 50-µl reaction mixture containing constant amounts of substrate (25 nM [-P]GTP labeled H-Ras; specific activity, 450 Ci/mmol) and GST-NF1 (6 nM). H-Ras species used as the competitor were v-H-RasbulletGDP (bullet), v-H-Ras(G60A)bulletGDP (), v-H-Ras bulletGTP (circle), and v-H-Ras(G60A)bulletGTP (box).



The G60A Mutation Moderately Reduces the Interaction of H-Ras with Raf-1

The G60A mutation was found to reduce the amount of H-Ras co-precipitated by GST-Raf-N275 approximately 3-fold at high molar excess of GST-Raf-N275(29) . Here, we show that this moderate Raf-1 binding reduction persisted over a range of Raf-N275 concentrations (Fig. 5). The dissociation constants were subsequently determined for the v-H-RasbulletRaf-1 complex (K(d) = 47 nM) and for v-H-Ras(G60A)bullet Ra-1 complex (K(d) = 236 nM) and found to have a 5-fold difference (Table 3). It should be pointed out that the Scatchard plot of H-Ras and GST-Raf-N275 binding shows a biphasic data distribution at high GST-Raf-N275 concentrations (data not shown). This biphasic data distribution was found in all co-precipitation binding assay experiments. The dissociation constant for the weaker and apparently nonspecific interaction was approximately 100-fold greater than that of the specific one. The nature for the weaker interaction is not clear.


Figure 5: The Interaction of H-Ras and Raf-1. H-Ras and Raf-1 binding was determined by a co-precipitation assay as described(29) . The reactions were carried out in a 200-µl reaction mixture containing 50 mM Hepes, pH 7.5, 100 mM KCl, 20 µM ZnCl(2), 5 mM MgCl(2), 1 mg/ml BSA, 62.5 nM H-Rasbullet[-P]GTP (specific activity, 450 Ci/mmol) and indicated amounts of GST-Raf-N275. The binding was allowed to proceed for 30 min at 4 °C and followed by an additional 30-min incubation interval with glutathione-Sepharose. The bound H-Ras was then separated from the reaction mixture by passage through glass fiber filter and quantified. The percent bound was calculated by dividing the amounts of radioactivities collected on glass fiber filter by the total amounts of input H-Ras as determined by nitrocellulose binding assay. bullet, c-H-Ras; , c-H-Ras(G60A).





The effect of the G60A mutation on H-Ras and Raf-1 interaction was further examined by the two-hybrid system(42) . This assay uses vectors containing the full-length H-Ras fused to the Gal4 DNA-binding domain and Raf-N275 to the Gal4 activation domain. In addition, an intragenic C186S mutation, a mutation that blocked the membrane association of H-Ras(3) , was incorporated into the H-Ras gene. This mutation has been shown to enhance the sensitivity (beta-galactosidase activity) of the assay employing H-Ras and Raf-1(43) . The results of the two-hybrid system expressed in Miller units showed that the G60A mutation reduced the interaction of v-H-Ras and Raf-N275 in vivo by about 3-fold (Table 4), a result similar to that of the in vitro binding assay(29) .



We then examined the effect of the G60A mutation on Raf-1 binding in c-H-Ras background. The in vitro binding assay indicated that c-H-Ras bound more tightly to Raf-N275, and it was comparatively less affected by the G60A mutation than v-H-Ras (Table 3). The dissociation constants were found to be 29 and 64 nM, respectively, for the c-H-RasbulletRaf-1 and v-H-Ras(G60A)bulletRaf-1 complexes, a difference of about 2-fold (Table 3). This observation is in agreement with the result of the two-hybrid system, in which c-H-Ras was also found to interact more strongly with Raf-1 than v-H-Ras and the effect of the G60A mutation on Raf-1 binding reduction was smaller (30% versus 3-fold) (Table 4).

The Interaction of H-Ras and ralGDS RBD Is Drastically Reduced by the G60A Mutation

We examined the effects of the G60A mutation on the interaction of H-Ras with the ralGDS RBD. The C-terminal 127 residues of mouse ralGDS (ralGDS-C127) containing the entire RBD was fused to GST and used in the study. The in vitro binding assay demonstrated that this ralGDS fragment was capable of binding to H-Ras with an affinity slightly higher than that of GST-Raf-N275 (Table 5). This finding differs from an earlier report showing that a ralGDS-like gene product, RGL, bound Ras p21 weaker than Raf-1 (6) .



Interestingly, in contrast to GAP and Raf-N275 binding, the binding of ralGDS-C127 to H-Ras is drastically reduced by the G60A mutation (Table 5). The reduction is about 30- and 57-fold for c-H-Ras and v-H-Ras, respectively. These levels of reduction were about an order of magnitude greater than that of Raf-N275 binding reduction (Table 3). The interaction of H-Ras and ralGDS-C127 was further examined by the two-hybrid system (Table 6). The experiment was performed similarly to that of H-Ras and Raf-N275 assay, except that the Gal4 activation domain contained the ralGDS-C127 instead of Raf-N275. Table 6shows that the difference in signal output between the wild type and the G60A mutant in vivo paralleled that of in vitro binding. Again, the results show that the G60A mutation more significantly reduces ralGDS-C127 binding than Raf-N275 binding. However, our construct of Gal4 activation domain-ralGDS-C127 fusion vector displayed a relatively low signal when compared with the same vector harboring Raf-N275 fusion. The difference in readout signal is not necessarily reflecting the strength of binding when heterologous vectors are used for the assay because the output signal of the two-hybrid system depends not only on the distance but also on proper juxtaposition of the Gal4 DNA binding and transcription activation domains.



Finally, the effect of the G60A mutation on the interaction between H-Ras and ralGDS-C127 was examined in a competition assay. The experiment was performed by measuring the amounts of v-H-Ras precipitated by GST-Raf-N275 in the presence of increasing concentrations of MBP fusion protein of ralGDS-C127. This MBP-ralGDS-C127 construct contains the same ralGDS-C127 fragment as the GST-ralGDS-C127 fusion and binds H-Ras with an affinity that was about one-third that of the GST-fusion counterpart (Table 5). Similar to GST fusion ralGDS-C127, the G60A mutation also strongly reduced the binding of H-Ras to MBP-ralGDS-C127 (Table 5). Unfortunately, the binding of v-H-Ras(G60A) to MBP-ralGDS-C127 was too low to be measured reliably by the co-precipitation assay (Table 5). Fig. 6shows that the binding of v-H-Ras to GST-Raf-N275 gradually diminished with increasing concentrations of MBP-ralGDS-C127; this indicates that the binding of Raf-N275 and ralGDS-C127 to H-Ras is mutually exclusive. Nevertheless, under the same condition, MBP-ralGDS-C127 was unable to displace GST-Raf-N275 for binding to v-H-Ras(G60A). This result further confirms that the binding of v-H-Ras to ralGDS-C127 is significantly impaired by the G60A mutation.


Figure 6: Competition of ralGDS and Raf-1 for binding to H-Ras. The assay were performed in a 200-µl reaction mixture containing 62.5 nM H-Rasbullet[-P]GTP, 167 nM GST-Raf-N275 (precipitating agent), and various amounts (0.3-4.8 µM) of MBP-ralGDS-C127 (competing agent) similarly as described in the legend to Fig. 5. The percent of H-Ras bound to Raf-1 was calculated by using the amounts of H-Rasbullet[-P]GTP precipitated without MBP-ralGDS-C127 as 100%. bullet, c-H-Ras; , c-H-Ras(G60A).




DISCUSSION

The glycine residue of the conserved DXXG motif plays a pivotal role in GTP-induced conformational change. Substitution of this residue by alanine has been shown to disrupt the normal functions of regulatory GTPases(26, 27, 28, 29, 30) . Specifically, the G60A mutation was found to hinder GTP-induced conformational change and to eliminate the biological activity of v-H-Ras. Among the regions that respond to GTP, the switch II domain appears to be the region affected by the G60A mutation. In this study, we examined the effects of the G60A mutation on the GTPase activity and the ability of H-Ras to interact with four cellular factors, GAP, NF1, Raf-1, and ralGDS. All of these factors interact with the GTP-bound form of H-Ras.

The G60A mutation did not significantly alter the GTP/GDP binding affinity of H-Ras. This result was somewhat surprising, considering that the Gly-60 residue has to reorient in order to accept the -phosphate of GTP, and the Gly to Ala substitution should curtail this process(23) . Nevertheless, the G60A mutant is not unique in its position because the corresponding mutants of other regulatory GTPases also exhibit GTP/GDP binding affinity that is not significantly different from those of the wild types(26, 27, 28, 30) .

In contrast to GTP/GDP binding, the GTPase activity of H-Ras was greatly attenuated by the G60A mutation. The reduction in GTP hydrolysis was most dramatic when the rates of GAP- and NF1-stimulated GTP hydrolysis were compared ( Table 2and Fig. 2-3). NF1 had no measurable activity toward the G60A mutant under our assay condition. Although GAP was still able to stimulate GTP hydrolysis on the G60A mutant, the reduction was so great that it was equivalent to a total elimination of GAP activity. These results suggest that proper positioning of the switch II region is required for the GTP hydrolysis, particularly the factor-stimulated GTP hydrolysis. The reduction of GTPase activity by the G60A mutation was in sharp contrast to that of the corresponding mutation in G or EF-Tu. In G(G226A), the intrinsic GTPase was unchanged as long as enough Mg was provided to support a stable binding of GTP to the protein(27) . In EF-Tu, the G83A mutation actually enhanced the intrinsic GTPase by about 10-fold(30) . These differences in GTPase activities indicate that different members of regulatory GTPase employ different mechanisms for hydrolyzing GTP. Another example of the possible nonconserved mechanism of GTP hydrolysis is that Rad (Ras-related protein associated with diabetes) has similar intrinsic GTPase activity regardless of whether the residue in question is a Gly or a Glu(44) .

Despite the reduction in GAP- and NF1-stimulated GTP hydrolysis, the actual physical interaction between H-Ras and GAP (or NF1) is not affected by the G60A mutation ( Table 2and Fig. 4). In fact, the affinity for GAP and NF1 was slightly elevated by the G60A mutation. This situation is not uncommon because many mutations in the loop 4 region are known to heighten the affinity for binding GAP(36, 39) . Furthermore, the interaction of the G60A mutant with GAP and NF1 still displays the GTP-dependent characteristic. This result indicates that not all aspects of GTP-induced conformational change is abolished by the G60A mutation. Because the G60A mutation perturbs only the switch II region, it is also indicates that the binding of H-Ras to GAP or NF1 may not involve switch II region. However, without the involvement of the switch II region, GAP- or NF1-stimulated GTPase cannot proceed. This conclusion is further supported by the findings of another switch II domain mutation Y64W, which binds but has no GAP-stimulated GTPase(45, 46) . Intriguingly, H-Ras harboring a Gly substitution at the same Tyr-64 residue produces a protein that fails to associate NF1(47) . At present, we do not have an explanation for this discrepancy.

The G60A mutant was found to moderately reduce the interaction of H-Ras and the Raf-N275 fragment (Table 3-4). Similar results were obtained with Raf-1 fragment containing the first 150 residues (data not shown). This result is expected because the interaction between H-Ras and the Raf-1 has been shown to involve the switch I domain of H-Ras and Raf-1 RBD, a fragment containing Raf-1 residues 50-130(43, 48, 49, 50, 51, 52, 53, 54) . Similarly, the switch I domain of H-Ras also appears to be essential for binding the ralGDS RBD(6, 7) . However, unlike the Raf-1 RBD, the interaction of the ralGDS RBD with H-Ras is severely reduced by the G60A mutation (Table 5-6). This finding supports the importance of the switch II domain in the interaction with ralGDS RBD. Therefore, it appears that tight binding of H-Ras to the ralGDS RBD requires the cooperation of both switch I and II domains, whereas the interaction of H-Ras with the Raf-1 RBD may need only the switch I domain. These results indicate that although GAP, NF1, Raf-1, and ralGDS all interact with H-RasbulletGTP and they are able to compete against each other for binding to H-Ras, the binding sites of these factors on H-Ras are not identical. A similar conclusion has also been reached by a recent study using switch II domain mutations at positions 64, 65, and 71(47) . Because the role of the ralGDS in the Ras signaling pathway has not been established, it is not known whether the reduction in ralGDS binding by the G60A mutation is the basis for its lack of transforming activity associated with the G60A mutant. The ability to differentiate different downstream effector is not a property solely associated with the switch II domains, the switch I domain mutation Glu-37 to Gly substitution is also able to differentiate different downstream effectors, such as Raf-1 and Byr2, a structural homolog to mammalian MEK kinase(55, 56) .

Several lines of evidence suggest that Raf-1 is the cellular effector of Ras p21(5, 13) . The function of Ras is to recruit Raf-1 to the cell membrane, and such process by itself appears to be sufficient for the activation of Raf-1 and subsequent events(57, 58) . However, the properties of the G60A mutant are not consistent with that view; the G60A mutant is capable of binding Raf-1 to a significant level, but it lacks transforming activity(29) . These observations imply that the contribution of H-Ras to the activation of Raf-1 may be more than membrane recruitment. Recently, a second Raf-1 RBD (residues 130-196), which is capable of independent binding to H-Ras, was identified(59) . The binding affinity for the second Raf-1 RBD is weaker than that of the first RBD (residues 50-128) and can be masked by the first Raf-1 RBD when combined. In contrast to the first Raf-1 RBD, the binding of the second Raf-1 RBD to H-Ras was abolished by the G60A and Y64W mutations(60) . This finding offers an interesting possibility that the activation of Raf-1 by Ras may require at least two distinct steps: an initial interaction between switch I and the first Raf-1 RBD and a subsequent interaction between switch II and the second Raf-1 RBD. The reason for the failure of the G60A mutant to exhibit biological activities may be due to its inability to complete the second step. The situation may be similar to when the G60A mutation uncouples the GAP and NF1 catalytic activity from their binding to H-Ras. Consistent with the two-step hypothesis of Raf-1 activation, we have found that the G60A mutant can sequester and inhibit Raf-1 activity. (^3)With its ability to differentiate the switch I and II domains of H-Ras and possibly to block the progress of target activation, the G60A mutant will provide a valuable tool for elucidating the interaction and activation of H-Ras downstream effectors.


FOOTNOTES

*
This work is supported in part by the New York State Office of Mental Retardation and Developmental Disabilities and by National Institutes of Health Grant CA53782. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: Molecular Biology Dept., NYS Inst. for Basic Research in Developmental Disabilities, 1050 Forest Hill Rd., Staten Island, NY 10314. Tel.: 718-494-5337; Fax: 718-494-5287.

(^1)
The abbreviations used are: GAP, Ras GTPase activating protein; c-H-Ras, cellular H-Ras; EF-Tu, elongation factor Tu; GAD, Gal4 activation domain; GST, glutathione S-transferase; MBP, maltose binding protein; NF1, neurofibromin 1; Raf-N275, Raf-1 N-terminal 275 residues fragment; ralGDS, ral guanine nucleotide dissociation stimulator; RBD, Ras binding domain; v-H-Ras, viral H-Ras; PCR, polymerase chain reaction; BSA, bovine serum albumin.

(^2)
S. Campbell-Burk, personal communication.

(^3)
Y.-J.Sung, M.-C. C. Hwang, and Y.-W. Hwang, submitted for publication.


ACKNOWLEDGEMENTS

We thank Drs. Gideon Bollag and Frank McCormick of Onyx Pharmaceuticals for providing GAP, Ulf R. Rapp for Raf-1 clone, Fuyuhiko Tamanoi for the GST-NF1 construct, and Robert A. Weinberg for the mouse ralGDS clone.


REFERENCES

  1. Bourne, H. R., Sanders, D. A., and McCormick, F. (1990) Nature 348, 125-132 [CrossRef][Medline] [Order article via Infotrieve]
  2. Bourne, H. R., Sanders, D. A., and McCormick, F. (1991) Nature 349, 117-127 [CrossRef][Medline] [Order article via Infotrieve]
  3. Lowy, D. R., and Willumsen, B. M. (1993) Annu. Rev. Biochem. 62, 851-891 [CrossRef][Medline] [Order article via Infotrieve]
  4. Polakis, P., and McCormick, F. (1993) J. Biol. Chem. 268, 9157-9160 [Abstract/Free Full Text]
  5. Avruch, J., Zhang, X. F., and Kyriakis, J. M. (1994) Trends Biochem. Sci. 19, 279-283 [CrossRef][Medline] [Order article via Infotrieve]
  6. Kikuchi, A., Demo, S. D., Ye, Z. H., Chen, Y. W., and Williams, L. T. (1994) Mol. Cell Biol. 14, 7483-7491 [Abstract/Free Full Text]
  7. Hofer, F., Fields, S., Schneider, C., and Martin, S. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 11089-11093 [Abstract/Free Full Text]
  8. Russell, M., Lange-Carter, C. A., and Johnson, G. L. (1995) J. Biol. Chem. 270, 11757-11760 [Abstract/Free Full Text]
  9. Han, L., and Colicelli, J. (1995) Mol. Cell Biol. 15, 1318-1323 [Abstract]
  10. Pai, E. F., Kabsch, W., Krengel, U., Holmes, K. C., John, J., and Wittinghofer, A. (1989) Nature 341, 209-214 [CrossRef][Medline] [Order article via Infotrieve]
  11. Milburn, M. V., Tong, L., De Vos, A. M., Brunger, A., Yamaizumi, Z., Nishimura, S., and Kim, S. -H. (1990) Science 247, 939-945 [Abstract/Free Full Text]
  12. Jurnak, F., Heffron, S., and Bergmann, E. (1990) Cell 60, 525-528 [CrossRef][Medline] [Order article via Infotrieve]
  13. Moodie, S. A., and Wolfman, A. (1995) Trends in Genet. 10, 44-48
  14. Mistou, M. Y., Jacquet, E., Poullet, P., Rensland, H., Gideon, P., Schlichting, I., Wittinghofer, A., and Parmeggiani, A. (1992) EMBO J. 11, 2391-2397 [Medline] [Order article via Infotrieve]
  15. Howe, L. R., and Marshall, C. J. (1993) Oncogene 8, 2583-2590 [Medline] [Order article via Infotrieve]
  16. Segal, M., Willumsen, B. M., and Levitzki, A. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 5564-5568 [Abstract/Free Full Text]
  17. Mosteller, R. D., Han, J., and Broek, D. (1994) Mol. Cell Biol. 14, 1104-1112 [Abstract/Free Full Text]
  18. Quilliam, L. A., Kato, K., Rabun, K. M., Hisaka, M. M., Huff, S. Y., Campbell-Burk, S., and Der, C. J. (1994) Mol. Cell Biol. 14, 1113-1121 [Abstract/Free Full Text]
  19. Willumsen, B. M., Papageorge, A. G., Kung, H.-F., Bekesi, E., Robins, T., Johnsen, M., Vass, W. C., and Lowy, D. R. (1986) Mol. Cell Biol. 6, 2646-2654 [Abstract/Free Full Text]
  20. Noda, M. (1993) Biochim. Biophys. Acta 1155, 97-109 [Medline] [Order article via Infotrieve]
  21. Valencia, A., Kjeldgaard, M., Pai, E. F., and Sanders, C. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 5443-5447 [Abstract/Free Full Text]
  22. Dever, T. E., Glynias, M. J., and Merrick, W. C. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 1814-1818 [Abstract/Free Full Text]
  23. Richardson, J. S. (1981) Adv. Protein Chem. 34, 167-339 [Medline] [Order article via Infotrieve]
  24. Reynet, C., and Kahn, C. R. (1993) Science 262, 1441-1444 [Abstract/Free Full Text]
  25. Maguire, J., Santoro, T., Jensen, P., Siebenlist, U., Yewdell, J., and Kelly, K. (1994) Science 265, 241-244 [Abstract/Free Full Text]
  26. Miller, R. T., Masters, S. B., Sullivan, K. A., Beiderman, B., and Bourne, H. R. (1988) Nature 334, 712-715 [CrossRef][Medline] [Order article via Infotrieve]
  27. Lee, E., Taussig, R., and Gilman, A. G. (1992) J. Biol. Chem. 267, 1212-1218
  28. Hwang, Y. W., Jurnak, F., and Miller, D. L. (1989) in The Guanine Nucleotide Binding Proteins, Common Structural, and Functional Properties (Bosch, L., Kraal, B., and Parmeggiani, A., eds) pp. 77-85, Plenum Press, New York
  29. Sung, Y. J., Carter, M., Zhong, J. M., and Hwang, Y. W. (1995) Biochemistry 34, 3470-3477 [CrossRef][Medline] [Order article via Infotrieve]
  30. Kjaersgard, I. V., Knudsen, C. R., and Wiborg, O. (1995) Eur. J. Biochem. 228, 184-190 [Medline] [Order article via Infotrieve]
  31. Kunkel, T. A., Roberts, J. D., and Zakour, R. A. (1987) Methods Enzymol. 154, 367-382 [Medline] [Order article via Infotrieve]
  32. Albright, C. F., Giddings, B. W., Liu, J., Vito, M., and Weinberg, R. A. (1993) EMBO J. 12, 339-347 [Medline] [Order article via Infotrieve]
  33. Hwang, Y. W., Zhong, J. M., Poullet, P., and Parmeggiani, A. (1993) J. Biol. Chem. 268, 24692-24698 [Abstract/Free Full Text]
  34. Cunningham, P. R., Weitzmann, C. J., Nurse, K., Masurel, R., Van Knippenberg, P. H., and Ofengand, J. (1990) Biochim. Biophys. Acta 1050, 18-26 [Medline] [Order article via Infotrieve]
  35. Crystal, R. G., Elson, N. A., and Anderson, W. F. (1974) Methods Enzymol. 30, 101-127 [Medline] [Order article via Infotrieve]
  36. Gideon, P., John, J., Frech, M., Lautwein, A., Clark, R., Scheffler, J. E., and Wittinghofer, A. (1992) Mol. Cell Biol. 12, 2050-2056
  37. Bartel, P. L., Chien, C. T., Sternglanz, R., and Fields, S. (1993) in Cellular Interactions in Development: A Practical Approach (Hartley, D. A., ed) pp. 153-179, Oxford University Press, Oxford
  38. Miller, J. H. (1972) Experiments in Molecular Genetics , pp. 352-355, Cold Spring Habor Laboratory, Cold Spring Harbor, NY
  39. Gibbs, J. B., Schaber, M. D., Schofield, T. L., Scolnick, E. M., and Sigal, I. S. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 6630-6634 [Abstract/Free Full Text]
  40. Xu, G., Lin, B., Tanaka, K., Dunn, D., Wood, D., Gesteland, R., White, R., Weiss, R., and Tamanoi, F. (1990) Cell 63, 835-841 [CrossRef][Medline] [Order article via Infotrieve]
  41. Vogel, U. S., Dixon, R. A. F., Schaber, M. D., Diehl, R. E., Marshall, M. S., Scolnick, E. M., Sigal, I. S., and Gibbs, J. B. (1988) Nature 335, 90-93 [CrossRef][Medline] [Order article via Infotrieve]
  42. Fields, S., and Song, O. (1989) Nature 300, 245-247 [CrossRef]
  43. Van Aslet, L., Barr, M., Marcus, S., Polverino, A., and Wigler, M. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 6213-6217 [Abstract/Free Full Text]
  44. Zhu, J., Reynet, C., Caldwell, J. S., and Kahn, C. R. (1995) J. Biol. Chem. 270, 4805-4812 [Abstract/Free Full Text]
  45. Nur-E-Kamal, M. S. A., Sizeland, A., D'Abaco, G., and Maruta, H. (1992) J. Biol. Chem. 267, 1415-1418 [Abstract/Free Full Text]
  46. Antonny, B., Chardin, P., Roux, M., and Chabre, M. (1991) Biochemistry 30, 8287-8295 [CrossRef][Medline] [Order article via Infotrieve]
  47. Moodie, S. A., Paris, M., Villafranca, E., Kirshmeier, P., Willumsen, B., and Wolfman, A. (1995) Oncogene 11, 447-454 [Medline] [Order article via Infotrieve]
  48. Vojtek, A. B., Hollenberg, S. M., and Cooper, J. A. (1993) Cell 74, 205-214 [CrossRef][Medline] [Order article via Infotrieve]
  49. Warne, P. H., Viciana, P. R., and Downward, J. (1993) Nature 364, 352-355 [CrossRef][Medline] [Order article via Infotrieve]
  50. Zhang, X. F., Settleman, J., Kyriakis, J. M., Takeuchi-Suzuki, E., Elledge, S. J., Marshall, M. S., Bruder, J. T., Rapp, U. R., and Avruch, J. (1993) Nature 364, 308-313 [CrossRef][Medline] [Order article via Infotrieve]
  51. Scheffler, J. E., Waugh, D. S., Bekesi, E., Kiefer, S. E., LoSardo, J. E., Neri, A., Prinzo, K. M., Tsao, K. W., Wegrzynski, B., Emerson, S. D., and Fry, D. C. (1994) J. Biol. Chem. 269, 22340-22346 [Abstract/Free Full Text]
  52. Koide, H., Satoh, T., and Kaziro, Y. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 8683-8686 [Abstract/Free Full Text]
  53. Shirouzu, M., Koide, H., Fujita-Yoshigaki, J., Oshio, H., Toyama, Y., Yamasaki, K., Fuhrman, S., Villafranca, E., Kaziro, Y., and Yokoyama, S. (1994) Oncogene 9, 2153-2157 [Medline] [Order article via Infotrieve]
  54. Nassar, N., Horn, G., Hermann, C., Scherer, A., McCormick, F., and Wittinghofer, A. (1995) Nature 375, 554-560 [CrossRef][Medline] [Order article via Infotrieve]
  55. White, M. A., Nicolette, C., Minden, A., Polverino, A., Van Aelst, L., Karin, M., and Wigler, M. H. (1995) Cell 80, 533-541 [CrossRef][Medline] [Order article via Infotrieve]
  56. Lange-Carter, C. A., Pleiman, C. M., Gardner, A. M., Blumer, K. J., and Johnson, G. L. (1993) Science 260, 315-319 [Abstract/Free Full Text]
  57. Leevers, S. J., Paterson, H. F., and Marshall, C. J. (1994) Nature 369, 411-414 [CrossRef][Medline] [Order article via Infotrieve]
  58. Stokoe, D., Macdonald, S. G., Cadwallader, K., Symons, M., and Hancock, J. F. (1994) Science 264, 1463-1467 [Abstract/Free Full Text]
  59. Brtva, T. R., Drugan, J. K., Ghosh, S., Terrell, R. S., Campbell-Burk, S., Bell, R. M., and Der, C. J. (1995) J. Biol. Chem. 270, 9809-9812 [Abstract/Free Full Text]
  60. Drugan, J. K., Khosravi-Far, R., White, M. A., Der, C. J., Sung, Y. J., Hwang, Y. W., and Campbell-Burk, S. L. (1996) J. Biol. Chem. 271, 233-237 [Abstract/Free Full Text]

©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
B. Ford, K. Skowronek, S. Boykevisch, D. Bar-Sagi, and N. Nassar
Structure of the G60A Mutant of Ras: IMPLICATIONS FOR THE DOMINANT NEGATIVE EFFECT
J. Biol. Chem., July 8, 2005; 280(27): 25697 - 25705.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Fiegen, L.-C. Haeusler, L. Blumenstein, U. Herbrand, R. Dvorsky, I. R. Vetter, and M. R. Ahmadian
Alternative Splicing of Rac1 Generates Rac1b, a Self-activating GTPase
J. Biol. Chem., February 6, 2004; 279(6): 4743 - 4749.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-J. Sung, M.-C. C. Hwang, and Y.-W. Hwang
The Dominant Negative Effects of H-Ras Harboring a Gly to Ala Mutation at Position 60
J. Biol. Chem., November 29, 1996; 271(48): 30537 - 30543.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Fridman, H. Maruta, J. Gonez, F. Walker, H. Treutlein, J. Zeng, and A. Burgess
Point Mutants of c-Raf-1 RBD with Elevated Binding to v-Ha-Ras
J. Biol. Chem., September 22, 2000; 275(39): 30363 - 30371.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. R. Legate, D. Falcone, and D. W. Andrews
Nucleotide-dependent Binding of the GTPase Domain of the Signal Recognition Particle Receptor beta -Subunit to the alpha -Subunit
J. Biol. Chem., August 25, 2000; 275(35): 27439 - 27446.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend </