Translocation across the cytoplasmic membrane is the first step of protein targeting to the cell surface in bacterial cells. This complex biochemical reaction involving topological change of molecules has been analyzed by combined approaches of genetics and biochemistry in Escherichia coli (for reviews, see (1, 2, 3, 4) ). The biochemical studies, notably purification and reconstitution of protein translocation machinery, have revealed key players of the translocation, translocation ATPase (SecA), a secretory protein-specific chaperone (SecB), and an integral membrane component (SecY-SecE-SecG complex)(5, 6, 7, 8, 9) . From in vitro analyses using inverted bacterial plasma membrane vesicles, several subprocesses in the protein translocation reaction can be envisaged: 1) recognition of preproteins by chaperones (like SecB) that retain ``translocation-competent conformation'' of the secretory protein precursors, 2) targeting of the preprotein-SecB complex to SecA bound to the high affinity site of the plasma membrane, 3) ATP binding-dependent partial insertion of the precursors into a translocation channel, and 4) ATP hydrolysis-coupled and -dependent bulk protein translocation(9, 10, 11, 12, 13) . Translocating secretory proteins are surrounded by SecA and SecY, but not by lipid molecules(14) . Recently, Economou and Wickner (15) found that the movement of the secretory protein is coupled with insertion and de-insertion of a 30-kDa segment of SecA. Deep insertion of SecA into the membrane is also detected in vivo(16) .

During the course of these analyses, several systems have been developed to trap translocation intermediates during post-translational protein translocation. Except for the cases of kinetic trapping of intermediates by low ATP concentration (12) and formation of a disulfide bond loop of precursor protein in the absence of proton-motive force(11) , most of the methods rely on some ``tightly folded'' structures that block further penetration of the preproteins into the translocase. For instance, translocation of epitope-tagged preprotein was blocked by epitope-specific antibody(13) . Covalent attachment of stable structures such as bovine pancreas trypsin inhibitor (12) or methotrexate-binding dihydrofolate reductase (14) moieties to the precursor protein also generates translocation intermediates. But, in all of these cases, the blockades were exerted during the events that occur in the middle of translocation of the bulk of the mature domain.

In the cotranslational translocation system in the eukaryotic endoplasmic reticulum, the ribosome-nascent chain complex offers an ideal experimental tool to define various translocation intermediate states, including those in quite early stages in translocation(17) . On the other hand, early biochemical events in the bacterial post-translational system have only insufficiently been investigated due to the lack of convenient methods to accumulate ``early intermediates.''

Mutants affected in the translocation processes provide useful clues about the early events in vivo. Especially the prl mutations in secY and secE loci, which broaden the specificity of signal sequence recognition, suggested a direct interaction between signal sequence and SecY/SecE, the main membranous subunits of the E. coli translocase. Silhavy and co-workers (18, 19) found a striking clustering of prlA mutations in the first periplasmic domain and in the seventh and tenth transmembrane domains, which they proposed are essential for SecY's recognition of signal sequence and SecE. Our isolation of cold-sensitive and dominant sec mutations in secY suggested that the region C-terminal to transmembrane domain 8 is important for translocation facilitation and that the fourth cytoplasmic region is required for interaction with SecE(20, 21, 22) . To obtain an integrated picture of translocation in molecular terms, it is essential to analyze the nature of the early interaction between precursors and the SecY-SecE-SecG complex on the membrane in vitro. More specifically, it is highly desired to devise a new method to ``trap'' translocation intermediates in the early stages in vitro.

In this report, we exploited the technique of hexahistidine tagging to use His-tagged precursor proteins for easy purification as well as for generation of a new type of translocation intermediates. We found that the pro-OmpA derivatives with a His tag in their N-terminal regions of their mature proteins could not be translocated in the presence of a low concentration of Ni. Ni acted only on pro-OmpA derivatives with a His tag in the N-terminal region of the mature sequence. This inhibition occurs only at an early stage(s) of the translocation reaction and can be released by adding histidine, which competes for chelating Ni with the His tag in the preprotein. Ni did not inhibit, but rather enhanced, membrane association of His-tagged OmpA, suggesting that it acts just after the membrane targeting step. This system will be suitable for dissecting the early events in bacterial protein translocation.

EXPERIMENTAL PROCEDURES

Bacterial Strains

Materials

()

Plasmid Constructions

To construct pTYE005, a His fusion vector, the ``His oligonucleotides'' 5`-GGAATTCATCGAAGGCCGTCACCATCACCATCACCACATCGATGG-3` and 5`-CCATCGATGTGGTGATGGTGATGGTGACGGCCTTCGATGAATTCC-3` were annealed, digested with EcoRI and ClaI, and cloned into pBluescript SK(-) digested with the same enzymes. For the construction of a c-Myc fusion vector, pTYE006, the ``c-Myc oligonucleotides'' 5`-CCATCGATGAAGAACAGAAACTCATCTCCGAAGAGGACCTGCTGCGCAAACGTTAAGGTACCC-3` and 5`GGGTACCTTAACGTTTGCGCAGCAGGTCCTCTTCGGAGATGAGTTTCTGTTCTTCATCGATGG-3` were annealed and cloned between the ClaI and KpnI sites of pBluescript SK(-). pTYE007, a His-c-Myc fusion vector, was then constructed by ligating a 1.12-kb ClaI-ScaI fragment of pTYE005 and a 1.84-kb ClaI-ScaI fragment of pTYE006. The His and c-Myc oligonucleotides are designed to encode IEGRHHHHHH (factor Xa site followed by a His tag) and EEQKLISEEDLLRKR-ocher (c-Myc monoclonal antibody 9E10 epitope(24) ), respectively. When these double-strand oligonucleotides were cloned into pBluescript SK(-) as described above, they did not disrupt the lacZ open reading frame, and the tags were encoded on another reading frame. Therefore, the lacZ assay can be used for cloning an exogenous DNA fragment into these three vectors.

To construct the OmpA-His-Myc-expressing plasmid, a 1.23-kb SspI-PstI fragment of pRD87 covering the ompA open reading frame was cloned into pTYE007 to obtain pTYE008. A 0.25-kb BglII-EcoRI fragment of pTYE008 was replaced with a 0.15-kb fragment of the 3`-terminal region of the ompA gene amplified by polymerase chain reaction with the primers 5`-AAAGGTATCCCGGCAGAC-3` and 5`-GGAATTCAGCCTGCGGCTGAGTTAC-3` and digested with BglII and EcoRI. The resulting plasmid, pTYE009, encoded an in-frame fusion between OmpA and the His-c-Myc tag. A 2.94-kb EcoRI-ScaI fragment from pTYE009 was ligated with a 1.16-kb EcoRI-ScaI fragment from pTYE006 to yield pTYE018, encoding OmpA-c-Myc (abbreviated as OmpA`) fusion protein. To insert a His tag at various locations in the OmpA mature domain, pTYE018 was mutagenized with the mutagenic primers described below. 5`-GTAGCGCAGGCCGCTCCGAAACACCATCACCATCACCATATCGATAACACCTGGTACACTGG-3` was used for the construction of pTYE050, encoding 3His-OmpA`, which has a His-Ile insert after the third amino acid of the OmpA mature sequence; 5`-GATAACACCTGGTACCACCATCACCATCACCATAGTACTGGTGCTAAACTG-3` for pTYE086, encoding 8His-OmpA`, which has His-Ser after the eighth amino acid; 5`-TCCCAGTACCATGATCACCATCACCATCACCATAGTACTGGTTTCATCAAC-3` for pTYE098, encoding 20His-OmpA`, which has His-Ser after the 20th amino acid; and 5`-CGTTTATGGTAAAAACCACCATCACCATCACCATGTCGACACCGGCGTTTCTCC-3` for pTYE112, encoding 114His-OmpA`, which has His-Val after His-114. Mutations were confirmed by the presence of new restriction sites, underlined in the oligonucleotides (ClaI, ScaI, ScaI, and SalI, respectively). To construct SecB-overproducing plasmid pTYE025, a 1.24-kb BamHI-PvuII secB fragment derived from pAK330 (43) was subcloned into pBluescript KS(-) digested with BamHI and EcoRV.

Materials for in Vitro Translocation Assays

SecA was prepared from CU148/pKY173, ()a SecA overproducer, by a combination of Matrex gel red A dye binding column and DEAE-Sepharose Fast Flow chromatography. SecB was overproduced in TYE126 (JM109(DE3)/pTYE025) from the T7 promoter and purified as described (26) up to the Q-Sepharose column step, and the sample was further purified by butyl-Sepharose column chromatography. S-Labeled pro-OmpA derivatives were prepared by in vitro transcription and translation using appropriate plasmids, E. coli S130, and [S]Met(27) . Proteins were then precipitated with 5% trichloroacetic acid (final concentration) and dissolved in HU buffer (50 mM HEPES/KOH, pH 8.0, 1 M NaCl, 8 M urea, 10 mM -mercaptoethanol).

Purification of Pro-OmpA Derivatives

Iodination of Pro-OmpA Derivatives

In Vitro Translocation Assay

Binding of Pro-3His-OmpA` and Pro-OmpA-His` to INV

Protein Techniques

SecA ATPase was assayed as described in (7) . Protein concentration was determined by the Bio-Rad protein assay solution with bovine -globulin as a standard.

RESULTS

Purification of Precursors of OmpA Derivatives

Figure 1: His- and c-Myc-tagged OmpA derivatives. The OmpA derivatives used in this study are summarized. Hatched and open boxes represent signal and mature domains of OmpA, respectively. Shaded and filled boxes indicate c-Myc and His tags, respectively. Numbers above the filled boxes indicate insertion positions of the His tag. a. a. r., amino acid residues.

Figure 2: Accumulation, purification, and translocation of His-tagged pro-OmpA derivatives. Pro-3His-OmpA` and pro-OmpA-His` were expressed from pTYE050 and pTYE009, respectively, in TYE055, a secY24 strain that overproduces Syd, a strong secretion inhibitor in this strain. A, the cells expressing 3His-OmpA` were disrupted by sonication in the presence of 8 M urea and fractionated by centrifugation at 100,000 g for 1 h. Materials equivalent to 0.66 Klett unit of culture were subjected to Western blotting with anti-c-Myc epitope antibody. Lane 1, total lysate; lane 2, supernatant; lane 3, pellet. Similar results were obtained for OmpA-His`. p, precursor; m, mature protein. B, pro-OmpA-His` and pro-3His-OmpA` were purified as described under ``Experimental Procedures,'' and 0.2 µg each was analyzed on 12.5% SDS-polyacrylamide gel and stained with Coomassie Brilliant Blue. Lane M, molecular mass standards; lane 1, pro-OmpA-His`; lane 2, pro-3His-OmpA`. There is a slight contamination of mature OmpA-His` in lane 1. C, translocation of purified pro-OmpA-His` was tested using INV prepared from TYE024. Precursor protein (1.32 µg in 8 M urea) was diluted into translocation reaction mixture (40 µg/ml SecA, 20 µg/ml SecB, 1.6 mg/ml INV in standard assay buffer) and incubated at 37 °C for 30 min. Lanes indicated +ATP received an ATP/ATP regeneration system and 5 mM NADH (final concentration). After the incubation, three 7-µl aliquots were withdrawn and subjected to mock treatment, trypsin treatment (0.25 mg/ml TPCK-treated trypsin), or trypsin/Triton X-100 treatment (0.25 mg/ml TPCK-treated trypsin, 0.2% Triton X-100), as indicated, at 0 °C for 10 min. The trypsin-resistant portions of OmpA derivatives were visualized by Western blotting with anti-c-Myc antibody.

Effects of Ni on Translocation of His-tagged OmpA Precursors

Figure 3: In vitro translocation of pro-3His-OmpA`, but not of pro-OmpA-His`, is sensitive to Ni. A, S-labeled pro-OmpA`, pro-OmpA-His`, and pro-3His-OmpA` were synthesized in vitro and post-translationally translocated into INV in the presence of various concentrations of NiCl and/or NTA/Na. In lanes 1-3, 20, 10, and 0% of the in vitro translated precursors used in the reactions were run, respectively. Each reaction mixture contained the reagents indicated above the panel. Portions of translocation reactions were treated either with trypsin (lanes 4-11) or with buffer (lanes 12-19). Lanes 4 and 12 show negative controls of the reaction without ATP, and lanes 5 and 13 represent positive controls of the standard reaction mixture without NiCl or NTA/Na. p, precursor; m, mature protein. B, purified pro-3His-OmpA` (lanes 1-8) and pro-OmpA-His` (lanes 9-16) were translocated in the absence (lanes 1, 5, 9, and 13) or presence (lanes 2, 6, 10, and 14) of 100 µM NiCl. Lanes 3, 7, 11, and 15 are the minus-ATP controls, and lanes 4, 8, 12, and 16 are reactions without INV. Samples were subjected to SDS-PAGE with (lanes 1-4 and 9-12) or without (lanes 5-8 and 13-16; one-fourth of the trypsinized samples were used) trypsinization, and OmpA species were visualized by Western blotting. Asterisks represent unrelated bands.

The above results suggested that the inhibition of translocation by Ni was dependent on the position of the His tag in the OmpA protein. We constructed a series of OmpA derivatives with a His tag at various positions in the mature domain of the OmpA protein (Fig. 1). The Ni sensitivities of their translocation were compared using in vitro translated preproteins (Fig. 4). Translocation of pro-3His-OmpA` (Fig. 4A, ) and pro-8His-OmpA` () with His tags after the third and eighth amino acids of the mature domain, respectively, was completely inhibited by 120 µM Ni (Fig. 4A). The same concentration of Ni did not inhibit translocation of pro-OmpA`, pro-OmpA-His`, or pro-114His-OmpA`. Pro-20His-OmpA` showed an intermediate sensitivity to Ni (Fig. 4A, ). Although 400 µM Ni somewhat inhibited translocation of even pro-OmpA-His` and pro-114His-OmpA`, but not of pro-OmpA`, we did not pursue this Ni effect further. We conclude that 20-100 µM Ni affects translocation of only precursor proteins with a His tag in the N-terminal region of the mature domain.

Figure 4: Ni sensitivity of various His-tagged OmpA derivatives. The pro-OmpA derivatives listed in Fig. 1were translated in vitro and post-translationally translocated into INV in the presence of 0, 12, 40, 120, or 400 µM NiCl. After a 15-min reaction, samples were trypsin-treated and run on 12.5% SDS-polyacrylamide gel, and the amounts of the trypsin-protected species were quantified. A, translocation is expressed as percent of trypsin-protected OmpA species against input. , pro-OmpA`; , pro-OmpA-His`; , pro-3His-OmpA`; , pro-8His-OmpA`; , pro-20His-OmpA`; , pro-114His-OmpA`. B, inhibition efficiency of NiCl at 120 µM on translocation of various pro-OmpA derivatives is plotted against position of the His tag.

The spectrum of the positional effect in the His tag and the Ni-dependent translocation block (Ni inhibition at 120 µM; summarized in Fig. 4B) reminds us of the results of Andersson and von Heijne(31) , who found that the first 30 amino acid residues of the mature domain of the secretory precursor are particularly sensitive to introduction of positive charges (6 consecutive lysines). They proposed to call this region the ``translocation initiation domain.'' The inhibitory effect of Ni on translocation of N-terminally His-tagged pro-OmpA` may also result from introduction of positive charges in the translocation initiation domain by chelating Ni. Consistent with this notion, protein translocation of pro-3His-OmpA` in the presence of 80 µM NiCl was restored by adding NTA (Fig. 3A, lower panel, compare lanes 6 and 10), which should interact with the His tag with high affinity through chelating Ni(30) . Because an NTA molecule has two minus charges at pH 8.0, at which we performed the translocation assay, the antagonistic activity of NTA on Ni inhibition may simply be explained by its charge neutralization effect. Still other explanations remain. For instance, a steric effect caused by introduction of Ni in the His tag portion may prevent the conformational change required for the molecular movement through the translocation channel.

Ni Affects Only Early Event(s) in Translocation

Figure 5: Ni affects only early step(s) of translocation reaction. Two types of translocation reactions were performed as summarized above the graph. In reaction scheme I, a 150-µl reaction was started at 37 °C by adding 0.6 µg (14.6 pmol) of I-labeled pro-3His-OmpA`. At the indicated times, a 10-µl aliquot was withdrawn and transferred to a new tube containing 1 µl of 1.1 mM NiCl and further incubated for a total of 25 min. Another 150-µl reaction was carried out as described above, and a 10-µl aliquot was cooled in ice water to measure the amounts of translocated 3His-OmpA` at each time point (scheme II). After the reaction, samples were trypsin-treated and subjected to SDS-PAGE. A, translocation efficiencies of the two reaction schemes at each time point are plotted. , scheme I; , scheme II. Translocation efficiency is expressed by the amount of trypsin-resistant pro-OmpA and mature OmpA derivatives in a 25-µl standard reaction for comparison with other experiments. B, efficiency of Ni inhibition after its addition was calculated from the data at each time point in A by the following formula: % inhibition efficiency = (((scheme I value) - (scheme II value))/((scheme I value at 25 min) - (scheme II value))) 100.

Although it has not been established to what extent the in vitro translocation reaction using the E. coli INV system is synchronized and how long it takes for a single precursor molecule to complete translocation, the following considerations will be useful for interpretation of the data obtained. If one assumes that a single cycle reaction occurs synchronously and that an inhibitory action is exerted at a specific substep of the reaction, addition of the inhibitor prior to the inhibition step in the scheme I reaction completely blocks the final yield of translocation, whereas after the inhibition step, the inhibitor is totally ineffective in lowering the final yield. As shown in Fig. 5A (), the total amount of translocation (scheme II) increased steadily up to the 25-min incubation period examined. The translocation yields in the scheme I reaction () were significantly higher that those in scheme II, except for the 0- and 1-min time points. The effectiveness of the Ni inhibition after its addition is shown in Fig. 5B. It was found that the inhibitory action was gradually lost during the course of this in vitro reaction. This indicates that Ni does not inhibit the reaction uniformally at every step or, at least, the final step of translocation. Rather, the inhibition point(s) should be located early in the translocation pathway. This interpretation is also supported by the fact that Ni blocked the signal cleavage of pro-3His-OmpA`, which occurs early in translocation(12) . The lack of a clear ``cutoff'' point in Fig. 5B may be due to asynchrony in the initial process as well as to possible random slowing down during late steps of translocation. Therefore, we conclude that Ni acts early in the translocation event(s).

Ni Does Not Inhibit Recruitment of Precursor to INV

Figure 6: Ni does not inhibit, but rather enhances, membrane targeting of pro-His-OmpA`. 1 µg of pro-3His-OmpA` or pro-OmpA-His` was incubated in 100 µl of translocation reaction mixture at 0 °C for 15 min in the presence (+Nilanes) or absence (control lanes) of 100 µM NiCl. Preproteins associated with urea-treated INV were recovered by sedimentation through a 20% sucrose cushion (see ``Experimental Procedures''). Localization of preproteins, SecA, and SecY (INV marker) in soluble (upper phase of the gradient) and membrane (pellet) fractions was analyzed by Western blotting. T, total; S, soluble fraction; P, pellet (membrane fraction).

We then subjected the membrane-targeted pro-OmpA preparation to the translocation reaction. Pro-3His-OmpA` that had been targeted to the membrane in the presence of Ni was competent for the subsequent translocation. This translocation was Ni-sensitive as shown in Fig. 7. Slight translocation of pro-3His-OmpA` was noted in the presence of Ni; possibly a small fraction of pro-3His-OmpA` had escaped from the Ni-sensitive step during sample manipulations. These results imply that NiCl inhibits a step that occurs subsequent to the recruitment of the precursor to the membrane. It might result in the apparent accumulation of pro-3His-OmpA` in INV through stabilizing or ``locking'' the membrane-bound state of the precursor.

Figure 7: Membrane-targeted pro-3His-OmpA` in presence of Ni is competent for subsequent translocation in absence of NiCl. I-Labeled pro-3His-OmpA` (0.35 µg, 8.5 pmol) was fist incubated with INV in a 175-µl reaction mixture at 0 °C for 15 min in the presence (1st incubation, +Ni) or absence (1st incubation, control) of 100 µM NiCl. The vesicles were recovered as described in the legend of Fig. 6; resuspended in standard reaction mixture; and further incubated with ATP (control), with ATP and 100 µM NiCl (+Ni), or without ATP (-ATP) at 37 °C for 15 min (2nd incubation). The amounts of the translocated OmpA species were assessed by trypsin treatment, SDS-PAGE, autoradiography, and its quantification. Translocation is expressed as the increase in trypsin-resistant OmpA species (femtomoles)/minute/standard 25-µl reaction volume.

Effect of Ni Is Reversible

Figure 8: Translocation inhibition by Ni is released by histidine. A 150-µl reaction was started by adding 0.6 µg (14.6 pmol) of I-labeled pro-3His-OmpA` in the absence () and presence ( and ) of 100 µM NiCl (final concentration). As marked by the arrows, a final concentration of 30 mM histidine HCl, pH 8.0, was added to the reactions with Ni at 4 min () or at 10 min (). Also shown is a 25-min reaction in the presence of 100 µM NiCl without receiving histidine (). 10-µl aliquots were withdrawn at each time point, and the amounts of translocated 3His-OmpA` were determined after trypsin treatment, SDS-polyacrylamide gel electrophoresis, and quantitative autoradiography.

We do not believe, however, that the apparent translocation rates shown in Fig. 5and Fig. 8represent the kinetics of translocation of individual precursor molecules. They must represent a sum of the heterogeneous population at different stages of the reactions. The fact that the Ni trap only shortened the initial lag period but did not enhance the apparent translocation rate upon release may suggest that there are multiple ``bottleneck'' processes in vitro and that some of them occur after the Ni-sensitive step. Although we need a further investigation of the molecular nature of the Ni-trapped intermediate, it is a new type of ``reversible'' inhibition of an early event of translocation in the bacterial system.

DISCUSSION

In this study, we made use of the His tag method developed by Bush et al.(29) not only to purify chemical amounts of E. coli pro-OmpA derivatives, but also to dissect their translocation across INV of E. coli in vitro. Our system using a combination of secY24 mutation and overexpression of syd(28) will be useful to accumulate bacterial precursor proteins in E. coli cells. We found that a His tag introduced into the N-terminal region of the OmpA mature domain confers Ni sensitivity to its translocation. Ni inhibits only the early step(s) of the translocation reaction, which is after the association of precursor with the membrane, but before the signal cleavage. Inhibition can be released by addition of histidine, which breaks the HisNi chelating complex.

It is likely that the effect of Ni is due to introduction of positive charges to the N-terminal mature region of the precursor protein. The position-specific Ni effects are difficult to explain in terms of nonspecific jamming of the translocation machinery, damage to the µgenerating system by heavy metal ion, or the molecular size of the HisNi chelating complex. The fact that Ni inhibition was observed only when the His tag was positioned within the first 20 residues or so of the mature domain of pro-OmpA suggests that the chelating complex affects some specific event(s) where the translocase interacts with this particular N-terminal region of the precursor protein. Toxicity of positively charged amino acids in the N-terminal mature domain has been reported in several secretory proteins in vivo and in vitro(32, 33, 34, 35) . Systematic insertion of Lys after the first or second transmembrane domain of leader peptidase indicates that the 30-40 amino acid residues following the signal sequence or the signal anchor sequence form a special domain that cannot tolerate the positive charges(31) . Andersson and von Heijne (31) termed this region the translocation initiation domain. The location of the His tag that confers Ni-sensitive translocation on OmpA coincided well with the translocation initiation domain. The antagonistic effect of NTA can be explained by its minus charges and ability to form a ternary complex with the His motif and Ni, although we do not have direct evidence of the translocation of this ternary complex. Another possibility might be that the N-terminal region of the mature protein is quite sensitive to a conformational constraint. For instance, the initial formation of the hairpin loop structure in the N terminus of preproteins could be important for translocation initiation, and the local conformation of the HisNi complex may prevent the formation of such a structure.

Previously, the effect of positive charges in the translocation initiation domain had been discussed from the point of view of the electrochemical nature of the membrane, such as interaction of the N-terminal region of preprotein with acidic phospholipids and determination of its orientation according to the ``positive inside rule''(31, 32, 33, 34, 35) . However, the existence of positive charges themselves in this domain, but not charge balance flanking the signal sequence core, is essential for inhibition(34) . Both in the bacterial plasma membrane and in the eukaryotic endoplasmic reticulum, which have homologous translocation machinery, compelling evidence suggests that proteinaceous pores composed of SecY-SecE-SecG or Sec61-Sec61-Sec61 complexes lead preproteins across the membrane(14, 36, 37, 38, 39) . A tempting and serious possibility is that the translocation initiation domain directly interacts with some part of the translocase and that this interaction itself is sensitive to positively charged amino acids in this domain.

The existence of prlA and prlG mutants is one piece of strong evidence for direct interaction between membranous translocase subunits and precursor protein(2, 18, 19) . Certain prlA mutants can also translocate mutant preprotein with positive charges in the translocation initiation domain in vivo(33) . We found that pro-3His-OmpA` translocation in vitro was less sensitive to Ni when INV prepared from the prlA3 mutant was used. ()We suppose that Ni affects translocation of N-terminally His-tagged pro-OmpA through the step of precursor protein recognition by the SecY-SecE-SecG complex. A similar signal sequence recognition event by translocase is also proposed in the mammalian Sec61 system, as revealed in a reaction in the absence of signal recognition particle(40) . Actually, translocation across the endoplasmic reticulum is also sensitive to positives charges in the N-terminal portion of the mature protein albeit its lower sensitivity compared with the prokaryotic system(41) .

While signal sequence recognition by SecY could be regarded as essentially a proofreading activity that rejects nonfunctional precursor proteins(18) , the fact that histidine addition can restore translocation without a short lag may indicate that a translocon-associated precursor can be reactivated on site, i.e. no rejection occurs on the membrane. We detected efficient cross-linking between pro-3His-OmpA` on the membrane with SecA irrespective of the existence of Ni, supporting this notion. Interaction of SecY(-SecE-SecG) with the signal sequence and the N-terminal portion of the mature protein may be required for some intrinsic mechanism of translocation, such as gate opening of the translocation channel(18, 40) . It is interesting to point out that the prlA3 and other prlA alleles that suppress the translocation defects caused by the basic amino acids (33) or the HisNi conjugate (this study) reside in the first periplasmic domain of the SecY protein(18, 42) . The idea that this region of SecY acts to accept or reject the early mature part (3) is reasonable in terms of topological consideration of SecY and preprotein; this SecY domain may recognize preprotein during or after the insertion of its hairpin loop structure composed of the signal sequence and the translocation initiation domain. But our results imply that the Ni-inhibited precursor can still remain associated with the membrane. On the other hand, the His tag portion of the Ni-trapped precursor on the membrane should not be completely buried in the translocation machinery. It is accessible to exogenous histidine added from the cytoplasmic surface. Either the intermediate-bearing translocation channel may be open to the cytoplasmic side, or this intermediate is in a fast equilibrium between a membrane-embedded state and a water-accessible state.

Since most translocation intermediate traps developed so far confer a translocation block at its middle or late stages(11, 12, 13, 14) , the HisNi-tagged precursor system is a novel tool for analyzing initial translocation events. It will be useful for investigating the nature of signal recognition by the SecY-SecE-SecG complex through in vitro analysis of translocon mutants, especially prlA mutants. Also in vitro characterization of the secY mutants with lowered secretory efficiency (22) with the HisNi-tagged precursor system will be promising in identifying secY mutants with a deficiency in the early events.

FOOTNOTES

*

This work was supported by grants-in-aid from the Ministry of Education, Science, and Culture of Japan and the Human Frontier Science Program Organization. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§

To whom correspondence and reprint requests should be addressed. Tel.: 81-75-751-4015; Fax: 81-75-771-5699 or 761-5626; kito{at}virus.kyoto-u.ac.jp(forK.I.) and tyoshihi{at}virus.kyoto-u.ac.jp(forT.Y.)

()

The abbreviations used are: NTA, nitrilotriacetic acid; kb, kilobase(s); INV, inverted inner membrane vesicle(s); TPCK, L-1-tosylamido-2-phenylethyl chloromethyl ketone; PAGE, polyacrylamide gel electrophoresis.

()

C. Ueguchi, unpublished results.

()

T. Yoshihisa and K. Ito, unpublished results.

ACKNOWLEDGEMENTS

REFERENCES

1. Wickner, W., Driessen, A. J. M., and Hartl, F.-U. (1991) Annu. Rev. Biochem. 60, 101-124 [CrossRef][Medline] [Order article via Infotrieve]
2. Schatz, P. J., and Beckwith, J. (1990) Annu. Rev. Genet. 24, 215-248 [CrossRef][Medline] [Order article via Infotrieve]
3. Ito, K. (1992) Mol. Microbiol. 6, 2423-2428 [Medline] [Order article via Infotrieve]
4. Tokuda, H. (1994) FEBS Lett. 346, 65-68 [CrossRef][Medline] [Order article via Infotrieve]
5. Akimaru, J., Matsuyama, S., Tokuda, H., and Mizushima, S. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 6545-6549 [Abstract/Free Full Text]
6. Brundage, L., Hendrick, J. P., Schiebel, E., Driessen, A. J. M., and Wickner, W. (1990) Cell 62, 649-657 [CrossRef][Medline] [Order article via Infotrieve]
7. Lill, R., Dowhan, W., and Wickner, W. (1990) Cell 60, 271-280 [CrossRef][Medline] [Order article via Infotrieve]
8. Hanada, M., Nishiyama, K., Mizushima, S., and Tokuda, H. (1994) J. Biol. Chem. 269, 23625-23631 [Abstract/Free Full Text]
9. Hartl, F.-U., Lecker, S., Schiebel, E., Hendrick, J. P., and Wickner, W. (1990) Cell 63, 269-279 [CrossRef][Medline] [Order article via Infotrieve]
10. Arkowitz, R. A., Joly, J. C., and Wickner, W. (1993) EMBO J. 12, 243-253 [Medline] [Order article via Infotrieve]
11. Tani, K., Tokuda, H., and Mizushima, S. (1990) J. Biol. Chem. 265, 17341-17347 [Abstract/Free Full Text]
12. Schiebel, E., Driessen, A. J. M., Hartl, F.-U., and Wickner, W. (1991) Cell 64, 927-939 [CrossRef][Medline] [Order article via Infotrieve]
13. Kato, M., and Mizushima, S. (1993) J. Biol. Chem. 268, 3586-3593 [Abstract/Free Full Text]
14. Joly, J. C., and Wickner, W. (1993) EMBO J. 12, 255-263 [Medline] [Order article via Infotrieve]
15. Economou, A., and Wickner, W. (1994) Cell 78, 835-843 [CrossRef][Medline] [Order article via Infotrieve]
16. Kim, Y. J., Rajapandi, T., and Oliver, D. (1994) Cell 78, 845-853 [CrossRef][Medline] [Order article via Infotrieve]
17. Görlich, D., Prehn, S., Hartmann, E., Herz, J., Otto, A., Kraft, R., Wiedmann, M., Knespel, S., Dobberstein, B., and Rapoport, T. A. (1990) J. Cell Biol. 111, 2283-2294 [Abstract/Free Full Text]
18. Osborne, R. S., and Silhavy, T. J. (1993) EMBO J. 12, 3391-3398 [Medline] [Order article via Infotrieve]
19. Flower, A. M., Osborne, R. S., and Silhavy, T. J. (1995) EMBO J. 14, 884-893 [Medline] [Order article via Infotrieve]
20. Baba, T., Taura, T., Shimoike, T., Akiyama, Y., Yoshihisa, T., and Ito, K. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 4539-4543 [Abstract/Free Full Text]
21. Shimoike, T., Akiyama, Y., Baba, T., Taura, T., and Ito, K. (1992) Mol. Microbiol. 6, 1205-1210 [Medline] [Order article via Infotrieve]
22. Taura, T., Akiyama, Y., and Ito, K. (1994) Mol. & Gen. Genet. 243, 261-269
23. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
24. Munro, S., and Pelham, H. R. B. (1987) Cell 48, 899-907 [CrossRef][Medline] [Order article via Infotrieve]
25. Yamato, I., Anraku, Y., and Hirosawa, K. (1975) J. Biochem. (Tokyo) 77, 705-718
26. Weiss, J. B., Ray, P. H., and Bassford, P. J., Jr. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 8978-8982 [Abstract/Free Full Text]
27. Baba, T., Jacq, A., Brickman, E., Beckwith, J., Taura, T., Ueguchi, C., Akiyama, Y., and Ito, K. (1990) J. Bacteriol. 172, 7005-7010 [Abstract/Free Full Text]
28. Shimoike, T., Taura, T., Kihara, A., Yoshihisa, T., Akiyama, Y., Cannon, K., and Ito, K. (1995) J. Biol. Chem. 270, 5519-5526 [Abstract/Free Full Text]
29. Bush, G. L., Tassin, A.-M., Fridén, H., and Meyer, D. I. (1991) J. Biol. Chem. 266, 13811-13814 [Abstract/Free Full Text]
30. Gentz, R., Chen, C.-H., and Rosen, C. A. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 821-824 [Abstract/Free Full Text]
31. Andersson, H., and von Heijne, G. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 9751-9754 [Abstract/Free Full Text]
32. Summers, R. G., Harris, C. R., and Knowles, J. R. (1989) J. Biol. Chem. 264, 20082-20088 [Abstract/Free Full Text]
33. Puziss, J. W., Strobel, S. M., and Bassford, P. J., Jr. (1992) J. Bacteriol. 174, 92-101 [Abstract/Free Full Text]
34. Li, P., Beckwith, J., and Inouye, H. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 7685-7689 [Abstract/Free Full Text]
35. Yamane, K., and Mizushima, S. (1988) J. Biol. Chem. 263, 19690-19696 [Abstract/Free Full Text]
36. Crowley, K. S., Reinhart, G. D., and Johnson, A. E. (1993) Cell 73, 1101-1115 [CrossRef][Medline] [Order article via Infotrieve]
37. Crowley, K. S., Liao, S., Worrell, V. E., Reinhart, G. D., and Johnson, A. E. (1994) Cell 78, 461-471 [CrossRef][Medline] [Order article via Infotrieve]
38. Görlich, D., Prehn, S., Hartmann, E., Kalies, K.-U., and Rapoport, T. A. (1992) Cell 71, 489-503 [CrossRef][Medline] [Order article via Infotrieve]
39. Mothes, W., Prehn, S., and Rapoport, T. A. (1994) EMBO J. 13, 3973-3982 [Medline] [Order article via Infotrieve]
40. Jungnickel, B., and Rapoport, T. A. (1995) Cell 82, 261-270 [CrossRef][Medline] [Order article via Infotrieve]
41. Johansson, M., Nilsson, I., and von Heijne, G. (1993) Mol. & Gen. Genet. 239, 251-256
42. Sako, T., and Iino, T. (1988) J. Bacteriol. 170, 5389-5391 [Abstract/Free Full Text]
43. Kumamoto, C. A., and Nault, A. K. (1989) Gene (Amst.) 75, 167-175

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit