|
|
|
|||||||
|
|||||||||
(Received for publication, December 4, 1995; and in revised form, February 7, 1996) From the
Continuous replication of human immunodeficiency virus type 1
requires the expression of the regulatory protein Rev, which binds to
the Rev response element (RRE) and up-regulates the cytoplasmic
appearance of singly spliced and unspliced mRNA species. It has been
demonstrated that the murine protein YL2 interacts with Rev in vivo and modulates the activity of Rev (Luo, Y., Yu, H., and Peterlin,
B. M.(1994) J. Virol. 68, 3850-3856). Here we show that
the YL2 human homologue, the p32 protein, which co-purifies with
alternative splicing factor ASF/SF2, interacts directly with the basic
domain of Rev in vitro and that the Rev-p32 complex is
resistant to high concentrations of salt or nonionic detergent. Protein
footprinting data suggest that Rev interacts specifically with amino
acids within the 196-208 region of p32. An analysis of the
ternary complex, formed among p32, Rev, and RRE RNA, shows that Rev can
bridge the association of p32 and RRE. Furthermore, we demonstrate that
exogenously added p32 specifically relieves the inhibition of splicing in vitro exerted by the basic domain of Rev. Our data are
consistent with a model in which p32 functions as a link between Rev
and the cellular splicing apparatus.
Human immunodeficiency virus type 1 (HIV-1) (
The co-precipitation assays among GST-p32, Rev,
and radioactive RRE RNA or IIB RNA were performed by mixing 1 µl of
p32 storage buffer, containing 100-600 ng of GST-p32 (or 600 ng
of GST as a control) and 1 µl of Rev storage buffer, containing
0-300 ng of Rev (or 0-100 ng of Rev-(34-50)) with 4
The
protein band shift assay was performed by mixing 1 µl of Rev
storage buffer, containing 0-300 ng of Rev or 0-100 ng of
Rev-(34-50), with 9 µl of Rev binding buffer containing 100
ng of labeled GST-p32-K protein. After a 15-min incubation on ice, the
reactions were loaded on a 4% native polyacrylamide gel, containing 50
mM Tris borate, pH 8.3, 1 mM EDTA and run at 4
°C, followed by autoradiography. In some experiments the binding
was performed in co-precipitation buffer, containing 10% glycerol and
50 ng/µl E. coli tRNA.
Figure 1:
In vitro interaction between
p32 and Rev. A, a Coomassie-stained protein gel showing the
ability of Rev to co-precipitate with immobilized GST-p32 protein. Two
µg of GST-p32 and 0.45 µg of Rev protein (1:1 molar
concentration) were mixed with 2 µg of bovine serum albumin and
used as input for affinity selection on glutathione-Sepharose beads (lane 5). The proteins retained on the beads after binding and
washings in buffers containing the denoted concentrations of NaCl (lanes 8-12) or nonionic detergent Tween 20 (lanes
13-17) were analyzed. Leaving out the GST-p32 protein (lane 6) or replacing it by GST (lane 7) essentially
eliminated Rev binding. GST, GST-p32, and Rev protein were loaded in lanes 2, 3, and 4, respectively, as markers.
Sizes of marker proteins (lane 1) are indicated. B,
autoradiogram of a native polyacrylamide gel showing the protein band
shift analysis of p32-Rev complexes. One hundred ng of radioactively
labeled GST-p32-K protein (corresponding to a concentration of 0.2
µM) was incubated with the indicated concentrations of Rev
protein and analyzed by native gel electrophoresis. The major discrete
bands, corresponding to free GST-p32-K and GST-p32-K
The
interaction between p32 and Rev was also investigated using a protein
mobility shift assay. The GST-p32-K fusion protein was labeled at the
C-terminally positioned HMK site, and its ability to form complexes
with Rev in a native gel electrophoresis assay was investigated (Fig. 1B). In the presence of a 2-fold molar excess of
Rev to p32 fusion protein, approximately half of the p32 was shifted to
a major slower migrating band (Fig. 1B, lane
4). The absence of any major higher order complexes at maximum Rev
concentration (Fig. 1B, lane 7) suggests that
Rev has only one major binding site on p32 and that Rev oligomerization
is limited or not detectable in this assay. No differences in the Rev
binding potential were observed when using GST-p32 or p32-K in the
binding reaction, implying that the GST and HMK tags did not interfere
with Rev interaction (data not shown). The binding of GST-p32-K protein
to a synthetic peptide covering only the basic domain of Rev
(Rev-(34-50)) was also investigated (Fig. 1C).
Addition of a 2-fold molar concentration of Rev-(34-50) to p32
fusion protein resulted in a slower migrating complex (Fig. 1C, lane 3). At larger concentrations of
Rev-(34-50) a second complex appeared, which may represent
binding of multiple Rev-(34-50)s to a single p32 fusion molecule (Fig. 1C, lane 5). The relatively large shift,
caused by the binding of a 17-amino acid peptide to a 518-amino acid
large p32 fusion protein, may be explained by the high positive charge
of the peptide. The binding of Rev-(34-50) to p32 fusion protein
was also investigated in a competition assay in the presence of intact
Rev protein (Fig. 1C, lanes 6-11).
Rev-(34-50) efficiently competed with Rev for p32 binding, and
comparable levels of p32
Figure 2:
Investigating the p32-Rev interaction in
the context of RRE. A, autoradiogram of a denaturing
polyacrylamide gel showing the amount of radioactively labeled RRE RNA
that was retained on glutathione-Sepharose beads in the presence of
increasing amounts of Rev and GST-p32 proteins (lanes
6-11) or GST as a control (lanes 3-5).
GST-p32 protein, at the indicated concentration, was incubated with
increasing concentrations of Rev protein and a fixed amount of
radioactively labeled RRE RNA. The total input of RRE probe in each
lane is shown in lane 1. B, experiment similar to
that in panel A except that Rev was replaced with
Rev-(34-50) at different concentrations. C, RNA band
shift analysis of the effect of GST-p32 on Rev-RRE complex formation.
Two ng of radioactively labeled RRE RNA was complexed with Rev, at the
indicated concentrations and challenged with increasing concentrations
of GST-p32 protein or GST protein as a control, according to the scheme
above. The position of the free RRE probe is
indicated.
Formation of the
GST-p32
Figure 3:
Footprinting the binding site of Rev
protein on p32. A, autoradiogram of a protein gel showing the
protein footprint of Rev on p32. One hundred ng of C-terminally labeled
p32-K protein was digested with Glu-C proteinase at two different
concentrations in the presence of 1 µg of Rev protein
(approximately 18 times molar excess) or the same amount of bovine
serum albumin, indicated by + and -, respectively. C denotes the control lane in which Glu-C proteinase was omitted.
Glu-C cleavages, which were specifically inhibited or enhanced by the
Rev protein, are marked with solid and open arrows,
respectively. The indicated Glu-C-specific cleavage sites were
putatively identified on the basis of their relative mobility of
products from other specific proteinases and from interpolations on a
graph indicating the relationship between the logarithm of the mass of
radioactive C-terminal fragment produced by proteolytic cleavage and
migration of the corresponding band on the gel (data not shown). B, amino acid sequence of pro-p32. Glu-C-specific cleavages,
which are specifically inhibited or enhanced by the Rev protein, are
marked with solid and open arrows, respectively. Dotted lines indicate that the exact identification of
glutamic acids in this region was uncertain, and underlining marks a region that is relatively inaccessible to all tested
proteinases. Glutamic acids are denoted by boldface E, and
amino acid numbering is done according to the pro-p32. The N termini of
pro-p32 and the processed form of p32 are indicated by horizontal
arrows.
Figure 4:
p32 relieves the specific inhibition of
Rev-(34-50) on splicing in vitro. A,
autoradiogram of splicing products. Splicing reactions, containing two
substrates, PIP/B1/RRE transcript (containing the RRE) and PIP7.A
(internal control lacking the RRE), were incubated under splicing
conditions without nuclear extract (NE) (lane 1), or
with nuclear extract in the presence of the indicated amount of
Rev-(34-50) peptide, and GST-p32 protein (lanes
2-7) or GST protein as a control (lanes 8 and 9). The identities of the splicing products are indicated
schematically. RRE is indicated by a black box; open boxes and thin lines correspond to the exons and the introns,
respectively. The splicing products for each of the constructs include
intact pre-mRNAs, lariat introns, and intermediate lariats composed of
intron and 3`-exon. Ligated exons and 5`-exons migrated near the bottom
of the gel and are not shown. B, a graphic representation of
the RRE-specific inhibitory effect of Rev-(34-50) on splicing
shown in panel A. The numbers indicated below correspond to lane numbers in panel A. Black bars and cross-hatched bars indicate the absence and presence
of Rev-(34-50), respectively. The level of specific inhibition of
splicing was calculated as follows. The yield of intron lariat
products, containing the RRE was divided by the yield of intron lariat
products from the control substrate without RRE. The numbers were
normalized to 1 in the absence of Rev-(34-50) and
GST-p32.
Rev plays a major mechanistic role in switching the viral
expression pattern from multiply spliced viral mRNAs to singly spliced
and unspliced mRNA in the cytoplasm. In addition to the viral RNA
target, the RRE, Rev interacts with cellular components in order for
the mRNA to escape from the default splicing and transport pathways
utilized by other mRNAs. It has recently been shown that a number of
nucleoporin-like proteins interact specifically with a leucine-rich
motif in Rev, constituting the nuclear export domain, and that this
interaction is crucial for efficient transport of the mRNAs to the
cytoplasm(9, 10, 11, 12, 13) .
In this report, we characterize a very stable in vitro interaction among another functionally important region of Rev,
the basic domain, and the human ASF/SF2-associated p32 protein. p32 is
an acidic protein, rich in glutamic and aspartic acid residues, which
raises the possibility that p32 interacts with the highly basic region
of Rev protein through unspecific ionic interactions. Although this
possibility is difficult to disprove, particularly since simple ionic
interactions often play an important role in molecular recognition,
several of our observations suggest that the molecular recognition is
specific and biologically relevant: (a) the p32-Rev complex
was resistant to salt concentrations up to 750 mM, which
destabilizes ionic interactions, (b) the p32-Rev complex
appeared as a single major band on a native gel over a large titration
range, and (c) only one short stretch of glutamic acids, out
of several highly acidic regions in p32, was specifically protected by
Rev. Furthermore, in vivo studies have shown that transient
expression of the murine homologue of p32, YL2, potentiated the
function of Rev up to 4-fold and that antisense YL2 transcripts
abolished Rev function(23, 31) . Since both p32 and
the RRE interact with the basic domain of Rev, one may suspect that
simultaneous binding of p32 and RRE to the Rev protein is impaired. The
observation that Rev was capable of bridging p32 to the RRE in a
solution binding assay, therefore suggests that Rev forms oligomers in
such a manner that distinct basic regions can interact with the RRE and
p32 independently. However, in the RNA mobility shift assay we found
that p32 competed with RRE for Rev binding, and we were unable to
detect any ternary complex implying a simultaneous association of p32,
Rev, and RRE. We suspect that a reason for this discrepancy is an
instability of the Rev-Rev interactions under the applied
electrophoresis conditions. In favor of this interpretation is the
previously reported differences between solution binding and gel shift
assays. Whereas Rev tends to form RNA independent oligomers in solution
to a variable extent, when analyzed by gel filtration or chemical
cross-linking (18, 19, 32, 33) only
a single complex is seen between Rev and a high affinity binding site
(IIB RNA), using native gel
electrophoresis(16, 34, 35, 36) . A number of other proteins have been found to interact with p32.
Originally, p32 was characterized as being a component of the ASF/SF2
splicing activity purified from HeLa cells(24) . Subsequently,
it was shown that p32 was dispensable for the general splicing
activity, although the possibility cannot be ruled out that p32 has a
more specialized role in splicing(37) . Recent evidence
suggests that p32 also interacts with the HIV-1 Tat
protein(38, 39, 40) . In one report, a
Tat-binding protein (TAP) was isolated on the basis of Tat affinity
chromatography, and the sequence turned out to be identical to p32
except for a few amino acids in the N-terminal precursor
segment(39) . The same group also found that TAP (p32)
interacts with the C terminus of TFIIB, and it was suggested that TAP
(p32) may function as a cellular co-activator that bridges Tat to the
general transcription machinery(38) . The significance of the
TAP (p32)-Tat interaction was substantiated by a two-hybrid analysis, in vitro binding studies, and a demonstration implying that
TAP (p32) was able to cooperate with Tat to synergistically stimulate
transcription(38, 39) . The region involved in Tat
binding was mapped to amino acids corresponding to 247-282 in
p32, which is outside the region where we see protection by Rev (amino
acids 196-208). Also, it was found that TAP (p32) primarily
interacted with a 17-amino acid conserved core segment of the Tat
activation domain, whereas the basic domain of Tat was dispensable and
by itself unable to bind(38) . Together, these data suggest
that Tat and Rev may interact with p32 in different ways and raises the
possibility that p32 plays multiple roles in HIV-1 replication. Several lines of evidence suggest that the basic domain of Rev plays
a direct functional role other than RNA binding, nuclear localization,
and protein oligomerization. First, it has been demonstrated that, even
when multiple Rev molecules were tethered to the mRNA through
heterogeneous RNA binding sites, the basic domain was not dispensable
for Rev function(41, 42) . Secondly, the basic domain
alone can specifically inhibit splicing of RRE containing transcripts in vitro, suggesting a role in RNA splicing(21) . The
binding potential of the basic domain of Rev for p32 and the RRE
suggests that p32 is a cellular co-factor for Rev. The association of
the p32 protein with ASF/SF2, which binds in a cooperative fashion with
U1 snRNP to the 5`-splice site, theoretically places Rev and p32 on the
same mRNA. It is therefore likely that Rev, sequestered on the RRE, is
able to interact with p32 and directly influence the splicing process (Fig. 5). In this report, we show that equimolar amounts of
GST-p32 and Rev-(34-50) diminished the inhibitory effect of
Rev-(34-50) on splicing. A possible explanation for this
antagonizing effect of p32 in this assay may be that exogenously added
p32 squelches the functional interaction between Rev peptide and
endogenous p32, associated with ASF/SF2, and thereby inhibits Rev
function. An alternative explanation, which cannot be excluded, is that
p32 may disrupt the binding of Rev-(34-50) to the RRE, thereby
relieving the inhibition of splicing.
Figure 5:
Putative functional model for the p32-Rev
interaction. Rev protein, bound to the RRE, interacts with the p32
protein associated with ASF/SF2 at the 5`-splice site. This interaction
could stabilize the interaction of U1 snRNP with the 5`-splice site and
inhibit assembly of functional spliceosomes. The arrested complex may
subsequently function as a substrate for Rev-mediated nuclear
export.
A prediction from the model
shown in Fig. 5would be that Rev may increase the stability of
the U1 snRNP interaction with the 5`-splice site and thereby inhibit
the subsequent displacement of U1 snRNP, which is necessary for
U4/U6.U5 tri-snRNP to enter the spliceosome(43) . In support of
this model, it has previously been shown that Rev specifically
increases the amount of U1 snRNP in prespliceosomes formed on RRE
containing mRNAs and efficiently blocks the entry of the U4/U6.U5
tri-snRNP(22) . Furthermore, in vivo experiments have
demonstrated that Rev regulation of a construct, containing an intron,
requires that the 5`-splice site be recognized by U1 snRNP and probably
also ASF/SF2(44, 45, 46) . In conclusion,
Rev most likely functions both at the level of splicing and at the
level of transport, through the basic domain and the nuclear export
signal, respectively. Further investigations of the functional roles of
the interaction between p32 and the basic domain of Rev and the
association of nucleoporin-like proteins with the nuclear export signal
will be crucial for understanding Rev function and provide a valuable
tool to study the functional interplay between splicing and transport
in general.
Volume 271,
Number 17,
Issue of April 26, 1996 pp. 10066-10072
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
)expresses at least five proteins, Gag, Pol, Env, Tat, and
Rev, which are absolutely essential for viral replication. Gag, Pol,
and Env proteins, which are associated with the virion particle, are
encoded by unspliced and singly spliced mRNA species, characteristic
for the late stage of the viral gene expression. Tat and Rev,
translated from multiply spliced HIV-1 mRNAs characteristic for the
early stage of the gene expression, have regulatory roles in the viral
life cycle. Although Tat and Rev share some structural features, their
functions are distinct. Tat binds to the transactivating region, TAR,
located in the 5`-end of the viral transcript and up-regulates the
viral transcription several hundred-fold. Rev acts at the
posttranscriptional level and stimulates the cytoplasmic appearance of
unspliced and singly spliced viral mRNAs (for reviews, see (1, 2, 3) ). Thus, Rev activity partially
suppresses its own synthesis and shifts the HIV-1 replication cycle
from the early to the late phase. The specificity of Rev activity is
mediated through direct binding to an RNA element, the RRE, which is a cis-component of the unspliced and singly spliced mRNAs (4, 5, 6) . The Rev protein is quite small
(116 amino acids), and two main functional domains have been defined by
mutational analysis. A cluster of leucine residues around positions
78-83 constitutes the nuclear export
signal(7, 8, 9, 10) , which
interacts directly with nuclear proteins implicated in RNA
export(11, 12, 13) . A highly basic region at
positions 34-50 is responsible for specific RNA
binding(14, 15, 16, 17, 18) ,
nuclear localization, and contributes to the oligomerization
process(18, 19, 20) . This domain has also
been shown to inhibit the splicing of RRE-containing mRNAs in
vitro(21, 22) . It was recently shown in a yeast
two-hybrid screen that the murine protein, YL2, interacts with the
basic domain of Rev and that overexpression of YL2 potentiates Rev
function in vivo(23) . The human homologue of YL2 is
the p32 protein, which copurifies with the essential splicing factor
ASF/SF2(24) . In this report, we investigate the interaction of
p32 with Rev protein and test its function in a Rev-dependent in
vitro splicing assay. We demonstrate that Rev interacts strongly
with p32 in vitro and map the binding site by protein
footprinting. Together, our data suggest that p32 functions as a
mediator of Rev activity in RNA splicing.
Construction of Plasmids
The full-length p32
clone was a gift from Henrik Leffers and has been described
previously(25) . Plasmids used for expression of pro-p32,
containing amino acids 1-282 (pGEX-2TK-pro-p32 and
pGEX-GTH-pro-p32), and the processed form of p32, containing amino
acids 74-282 (pGEX-2TK-p32 and pGEX-GTH-p32), were constructed by
inserting the corresponding open reading frames, prepared by polymerase
chain reaction synthesis, between the BamHI and EcoRI
sites of the pGEX-2TK vector (Pharmacia Biotech Inc.) and the pGEX-GTH
vector(26) . Expression of these constructs in bacteria, e.g. for the processed version, gave rise to GST-T-HMK-p32
(denoted GST-p32) and GST-T-p32-HMK (denoted GST-p32-K) types of
proteins, respectively. GST denotes a glutathione S-transferase fusion, enabling rapid purification on
immobilized glutathione-Sepharose 4B beads (Pharmacia), T marks the
position of a cleavage site for thrombin proteinase, and HMK denotes
the recognition site for the catalytic subunit of cAMP-dependent heart
muscle kinase, enabling specific radioactive labeling of the
recombinant protein. The polymerase chain reaction fragments encoding
pro-p32 and p32 were obtained using upstream primers
GAGGATCCATGCTGCCTCTGCTGC and GAGGATCCCTGCACACCGACGGAG, respectively,
and a common downstream primer, GAGAATTCCCTGGCTCTGACAAAACTC
(restriction sites used for cloning are underlined). The expression
plasmid for His-tagged Rev protein was a gift from Alan W. Cochrane and
produces Rev preceded by 6 histidine residues(27) .Expression and Labeling of Proteins
The pro-p32
protein and the processed form of p32 were expressed in Escherichia
coli strain AD202(28) , purified, and labeled at the HMK
site as described in (26) . p32 was eluted as a GST fusion
protein (GST-p32 or GST-p32-K) by reduced glutathione or cleaved off
the column by thrombin, yielding p32 attached to an HMK site at the C
terminus (p32-K), followed by dialysis against p32 storage buffer (10
mM Tris/HCl, pH 7.5, 100 mM NaCl). Expression and
purification of His-tagged and wild type Rev proteins were performed as
described previously(27, 29) . His-tagged Rev was
purified in a denatured form and renatured by dialysis at 4 °C
against Rev storage buffer (50 mM Tris/HCl, pH 7.5, 500 mM NaCl, 1 mM EDTA). The activity of Rev was assessed by RNA
band shift assays described elsewhere in this section. We observed no
difference in RNA binding activity between His-tagged and wild type Rev
proteins (data not shown). Generally, His-tagged Rev was used in all
experiments, except from the footprinting analysis, in which wild type
Rev was used. Rev-(34-50) peptide was made as described
previously (21) .Co-precipitation Assay
The Rev-p32
co-precipitation assay was performed by mixing 1 µl of p32 storage
buffer, containing 2 µg GST-p32 (or 2 µg GST as a control), 1
µl of Rev storage buffer, containing 0.45 µg Rev (approximately
1:1 molar ratio) and 8 µl of co-precipitation buffer (50 mM Tris/HCl, pH 7.5, 150 mM NaCl, 0.2% Tween 20, and 0.2
µg/µl bovine serum albumin), followed by incubation at 4 °C
for 1 h. In some experiments, either the NaCl or the Tween 20
concentration was varied. Twenty µl of a 50% slurry of
glutathione-Sepharose beads, equilibrated in co-precipitation buffer,
were added to each binding reaction, and incubation continued with
rocking for 1 h at 4 °C. Beads were washed five times in
co-precipitation buffer without bovine serum albumin, and retained
proteins were released by incubating the beads in 10 µl of 1
SDS loading buffer (58 mM Tris/HCl, pH 6.8, 6%
glycerol, 1.7% SDS, 0.0025% Serva Blue W, 0.8% 
-mercaptoethanol)
at 95 °C for 5 min. The samples were loaded on 0.1% SDS, 16.3%
polyacrylamide gels (7% stacking gels), and proteins were visualized by
Coomassie staining. 10
cpm (approximately 2 ng) of body-labeled,
renatured RRE or IIB RNA in 8 µl of Rev binding buffer (10 mM HEPES/KOH, pH 7.9, 100 mM KCl, 2 mM MgCl
, 0.5 mM EDTA, 1 mM dithiothreitol, 10% glycerol, 0.5 units/µl RNasin (Promega),
50 ng/µl E. coli tRNA) containing 0.2% Tween 20 and 0.2
µg/µl bovine serum albumin, followed by incubation at 4 °C
for 1 h. Twenty µl of a 50% slurry of glutathione-Sepharose beads
equilibrated in Rev binding buffer (including Tween 20 and bovine serum
albumin) were added to each binding reaction, and incubation was
continued with rocking at 4 °C for 1 h. Beads were washed five
times in Rev binding buffer (with Tween 20 and without bovine serum
albumin) and mixed with 100 µl of RNA elution buffer (0.3 M NaCH
COO, 1 mM EDTA, 50 ng/µl E. coli tRNA), and bound RNA was eluted by extraction with phenol and
phenol/chloroform followed by ethanol precipitation. The RNA pellet was
resuspended in 80% formamide, incubated at 95 °C for 3 min, and
analyzed on 4% (RRE) or 8% (IIB) denaturing polyacrylamide gel followed
by autoradiography.RNA Band and Protein Band Shift Assays
Preparation
of RRE and IIB RNAs and the RNA band shift assays were done as
described in (16) . One µl of Rev storage buffer,
containing 0-150 ng of Rev, was mixed with 4 10 cpm (approximately 2 ng) of body-labeled and renatured RRE in 8
µl of Rev binding buffer. After 15 min of incubation on ice, 1
µl of p32 storage buffer, containing 0-1500 ng of GST-p32 (or
GST as a control) was added to each of the Rev titrations, and the
incubation was continued on ice for an additional 15 min. In some
experiments, the GST-p32 was incubated with Rev prior to the addition
of the RNA. The total reactions were loaded on 4% native polyacrylamide
gels containing 50 mM Tris borate, pH 8.3, 1 mM EDTA
and run at 4 °C, followed by autoradiography. The same protocol was
utilized when using body-labeled IIB RNA as probe, except that the
reactions were analyzed on 8% native polyacrylamide gels.Protein Footprinting
The protein footprinting
approach has been described previously(30) . For each protease
digestion 0.1 µg of labeled p32-K protein and 1 µg of Rev (18
times molar excess), were mixed in 10 µl of buffer (50 mM NaCl, 5 mM Tris/HCl pH 7.5, 1 mM EDTA, 0.025%
(v/v) Nonidet P-40, and 0.1 µg/µl bovine serum albumin, final
concentrations) and preincubated at room temperature for 10 min. In the
control binding reactions, Rev was replaced with the same amount of
bovine serum albumin. Proteolytic digestions were initiated by adding
10 µl of HO containing 2 or 6 ng/µl of proteinase
Glu-C (Sigma), 0.3 or 1 ng/µl of proteinase Lys-C (Sigma), or 0.03
or 0.1 unit/µl of proteinase Arg-C (Sigma). These proteinases
cleave at the C terminus of glutamic acids, lysines, and arginines,
respectively. The mixtures were incubated at 37 °C for 15 min, and
the reactions were stopped on ice and by adding 6.7 µl of 4
SDS loading buffer, followed by incubation at 95 °C for 5 min. The
cleavage products were resolved on 30 40-cm, 0.4-mm-thick 0.1%
SDS, 20% polyacrylamide gels (7% stacking gels), containing
Tris/Tricine buffer(30) .In Vitro Splicing
Transcripts of radioactively
body-labeled and capped PIP7.A and PIP/B1/RRE RNAs, used for in
vitro splicing analysis, were prepared and purified as described
previously (21) . In vitro splicing was performed in
20-µl reactions containing 1 µl of HO containing or
not containing 0.3 µg/µl of a Rev basic domain peptide
(Rev-(34-50)), 0.5 µl of bulk E. coli tRNA (20
µg/µl in HO), 4 µl of 5 splicing buffer
(5 mM ATP, 25 mM creatine phosphate, 12.5 mM MgCl, 1.5 mM dithiothreitol, 5 units/µl
RNasin (Promega)), 7 µl of nuclear extract (containing
approximately 10 µg/µl protein in 20 mM HEPES/KOH, pH
7.5, 100 mM KCl, 1 mM EDTA, 1 mM dithiothreitol, 10% glycerol), 6.5 µl of p32 storage buffer,
containing variable amounts of GST-p32, and 1 µl of 4
10 cpm of both uniformly 
P-labeled PIP7.A and
PIP/B1/RRE pre-mRNAs in HO, followed by incubation at 30
°C for 2 h. After phenol/chloroform extractions and ethanol
precipitation, the samples were resuspended in 80% formamide, incubated
at 95 °C for 3 min, and fractionated on a 6% polyacrylamide gel
containing 8 M urea, 75 mM Tris borate, pH 8.3, and
1.5 mM EDTA. Gels were autoradiographed and quantitated using
a Molecular Dynamics PhosphorImager and ImageQuant
software.
Pro-p32 Is Processed in Bacteria
The p32 protein
is synthesized as a 282-amino acid-long pro-protein that is
post-transcriptionally processed in human cells by removal of the
N-terminal 73 amino acids to form the 209-amino acid-long mature p32
protein(25) . Both forms of the protein were expressed as
fusion proteins, containing the GST tag at the N terminus. In addition,
the constructs contained the recognition sequence for the catalytic
subunit of cAMP-dependent HMK, either between the GST-tag and p32
(GST-p32), or at the C terminus of the p32 protein (GST-p32-K). The
advantage of the latter construct is that only full-length
affinity-purified protein becomes labeled, which is particularly
important for protein mobility shift analysis and footprinting
applications(26) . The pro-p32 fusion proteins were highly
unstable when expressed in bacteria. A major band co-migrating with the
processed form of the recombinant p32 protein suggested that the
precursor protein was processed in bacteria near or at the same site as
observed in human cells (data not shown). In all our investigations
only the constructs expressing the processed form of p32 (amino acids
74-282) were used.p32 Interacts Strongly with Rev in Vitro
To study
the interaction between p32 and Rev we investigated the ability of Rev
to co-precipitate with GST-p32 protein on glutathione beads in the
presence of increasing concentrations of NaCl or the nonionic
detergent, Tween 20 (Fig. 1A). High ionic strength
binding and washing buffers preferably destabilize ionic interactions,
whereas increased concentrations of nonionic detergents destabilize
hydrophobic interactions. Rev was specifically and quantitatively
co-purified with p32 on glutathione beads under stringent conditions (Fig. 1A, lanes 8-17). The p32-Rev
interaction remained fully stable in binding and washing solutions
containing 500 mM NaCl and in the highest tested Tween 20
concentration at 5% (Fig. 1A, lanes 10 and 17). At 750 mM NaCl, a slight decline in retained Rev
was observed, and at 1 M NaCl most of the Rev was removed from
GST-p32 (Fig. 1A, lanes 11 and 12).
GST-p32 remained stably associated with the glutathione beads at all
conditions (Fig. 1A, lanes 8-17). In
control reactions, in which GST-p32 was omitted or replaced with GST
alone, only negligible amounts of Rev were retained on the beads after
washing in a buffer containing 150 mM NaCl (Fig. 1A, lanes 6 and 7).
Rev complex,
are indicated. C, protein band shift analysis similar to that
in panel B. The complexes formed between GST-p32-K
(concentration of 0.2 µM) and the indicated concentration
of Rev-(34-50) were analyzed in the absence (lanes
2-5) or presence of Rev (lanes 7-11). Lanes 1 and 6 are control lanes showing GST-p32-K
alone. The asterisks in panels B and C indicate a complex that appeared in variable amounts depending on
the p32 preparation. We suspect that it originates from the binding of
Rev to a truncated p32 lacking the GST part, which is a common
degradation product from GST-p32 (T. Ø. Tange, T. H. Jensen, and
J. Kjems, unpublished observation).
Rev-(34-50) and p32-Rev complexes
were formed in the presence of similar molar concentrations of
Rev-(34-50) to Rev (Fig. 1C, lanes 9 and 10). This result implies that Rev-(34-50) and intact Rev
protein bind with comparable affinities to p32.Binding of p32 to Rev in the Presence of RRE
RNA
The basic domain of Rev is likely to be involved both in the
binding of the RRE RNA and the p32 protein(16, 23) .
To study the binding of p32 to Rev in the context of the RRE, we
investigated the ability of glutathione beads to retain radioactively
labeled RRE in the presence of increasing amounts of GST-p32 and Rev (Fig. 2A). Co-precipitation of RRE was only observed
when both GST-p32 and Rev were present, and increasing the Rev
concentration stoichiometrically increased the amount of RRE RNA
retained on the beads. Essentially the same result was obtained when
replacing the RRE probe with IIB RNA, which contains only one high
affinity binding site for Rev (data not shown). These experiments imply
that Rev is capable of bridging the RRE or IIB RNA to the p32 protein.
This may either be accomplished by a single Rev molecule, interacting
with the RRE and the p32 protein simultaneously or, more likely, by
multiple Rev molecules bridging the two ligands by Rev oligomerization.
RRE also co-precipitated with GST-p32 in the presence of
Rev-(34-50), albeit with lower efficiency than observed for
intact Rev (Fig. 2B). This suggests that the Rev
peptide, when present at elevated concentrations, is also able to
bridge the RRE RNA specifically to the p32 protein.
RevRRE complex was also analyzed by a gel mobility
shift assay (Fig. 2C). Rev forms multiple complexes
with RRE in this type of assay (Fig. 2C, lanes 5 and 10)(29) . The GST-p32 protein, by itself,
exhibited no measurable affinity for the RRE (Fig. 2C, lanes 1-3). The addition of increasing amounts of
GST-p32 protein together with a constant amount of Rev protein
gradually inhibited formation of the larger Rev-RRE complexes (Fig. 2C, lanes 6-8 and 11-13). This effect was specific to GST-p32 and was not
observed with GST alone (Fig. 2C, lanes 9 and 14) or with human TATA-box binding protein (data not shown).
Changing the order of addition of p32 and RNA to Rev protein or
replacing the RRE probe with a single high affinity Rev binding site
(IIB), gave a similar result (data not shown). Surprisingly, we were
not able to observe any novel complexes that could represent the
ternary complexes among GST-p32, Rev, and RRE or IIB, predicted from
the co-precipitation experiment (Fig. 2A). This
suggests that such complexes are unstable under gel electrophoresis
conditions.Mapping of the Rev Binding Site on p32 by Protein
Footprinting
The results from the protein band shift assay of
Rev-p32 complexes suggested that Rev only has one major binding site on
p32. To analyze this binding site in more detail, we used a protein
footprinting assay, which we have previously applied successfully to
map the RRE binding site on the Rev protein(30) . In this
approach, radioactively end-labeled protein is cleaved partially by a
set of proteinases, which attack the surface of a protein. Adding a
ligand to the reaction will sterically hinder the proteinase cleavages
at the site of interaction. In addition, conformational changes,
induced by the binding, may yield additional effects including enhanced
cleavages. To map the protection of Rev on p32, C-terminally labeled
p32-K protein, lacking the GST-fusion part, was probed with the
glutamic acid-specific proteinase, Glu-C, in the absence and presence
of Rev protein (Fig. 3A). In the reaction without Rev,
a similar amount of bovine serum albumin protein was added as a
control. The addition of bovine serum albumin by itself had no effect
on the proteinase cleavage pattern. Since only the C-terminal fragments
were visualized on the autoradiogram of the protein gel, each cleavage
site could generally be assigned to a specific amino acid position in
p32 on the basis of its apparent mobility in the SDS gel. Two major
bands and one minor band, assigned as
Glu
/Glu
, Glu
, and
Glu
, respectively, were partially protected by Rev (Fig. 3, A and B). In addition, several Glu-C
cleavages were specifically enhanced upon Rev binding. In particular,
the two glutamic acids, Glu
and Glu
,
appearing as a double band just below the protected sites, were
strongly enhanced, suggesting that this region undergoes a
conformational change upon Rev binding. Interestingly, enhancements
were also observed at two (at the primary sequence level) distantly
positioned regions, which probably correspond to regions encompassing
Glu
/Glu
and Glu
/Glu
(Fig. 3, A and B). These two regions
flank a portion of p32 encompassing amino acids 98-152, which is
relatively inaccessible to all tested proteinases, suggesting that it
may form a core domain. p32 was also cleaved with Lys-C and Arg-C in
the absence and presence of Rev, but no specific protections were
observed using these proteinases (data not shown).
p32 Modulates the Effect of Rev on Splicing in
Vitro
It has previously been demonstrated that Rev and
Rev-(34-50) specifically inhibit splicing of RRE containing
mRNA(21) . Since the p32 protein forms a complex with the
essential splicing factor ASF/SF2, it is possible that the inhibitory
effect of Rev on splicing is mediated by an interaction between Rev and
p32. To approach this question, we investigated the effect of GST-p32
protein on the ability of Rev-(34-50) to inhibit splicing of an
RRE containing mRNA in vitro (Fig. 4). In the absence
of GST-p32, Rev-(34-50) specifically inhibited splicing of a
pre-mRNA transcript containing the RRE (PIP7.A/B1/RRE) by 5-fold as
compared with an internal control transcript lacking the RRE (PIP7.A) (Fig. 4, panel A, lanes 2 and 3, and panel B). Adding GST-p32 to the splicing reaction specifically
restored splicing of RRE containing pre-mRNA in the presence of
Rev-(34-50), without affecting the splicing efficiency of the
construct lacking an RRE (Fig. 4A, lanes
4-7). At equimolar amounts of GST-p32 and Rev-(34-50),
the specific inhibition of splicing dropped to about 2-fold, and at 2
times molar excess of GST-p32, splicing of the RRE containing mRNA was
almost independent of Rev-(34-50) (Fig. 4B). The
effect was specific to the GST-p32 protein, since adding GST protein
alone had no effect (Fig. 4A, lanes 8 and 9).
)
We are grateful to Henrik Leffers for providing the
p32 cDNA clone, to Alan W. Cochrane for the His-Rev plasmid, and to T.
Saito for providing the AD202 E. coli strain. We thank Rita
Rosendahl for technical assistance and Finn Skou Pedersen and Anne B.
Tolstrup for discussions and critical reading of the manuscript.
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  H. C. T. Groom, E. C. Anderson, and A. M. L. Lever Rev: beyond nuclear export J. Gen. Virol., June 1, 2009; 90(6): 1303 - 1318. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Heyd, M. Carmo-Fonseca, and T. Moroy Differential Isoform Expression and Interaction with the P32 Regulatory Protein Controls the Subcellular Localization of the Splicing Factor U2AF26 J. Biol. Chem., July 11, 2008; 283(28): 19636 - 19645. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Berro, K. Kehn, C. de la Fuente, A. Pumfery, R. Adair, J. Wade, A. M. Colberg-Poley, J. Hiscott, and F. Kashanchi Acetylated Tat Regulates Human Immunodeficiency Virus Type 1 Splicing through Its Interaction with the Splicing Regulator p32. J. Virol., April 1, 2006; 80(7): 3189 - 3204. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Marschall, A. Marzi, P. a. d. Siepen, R. Jochmann, M. Kalmer, S. Auerochs, P. Lischka, M. Leis, and T. Stamminger Cellular p32 Recruits Cytomegalovirus Kinase pUL97 to Redistribute the Nuclear Lamina J. Biol. Chem., September 30, 2005; 280(39): 33357 - 33367. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Matsumoto, K. J. Tanaka, and M. Tsujimoto An Acidic Protein, YBAP1, Mediates the Release of YB-1 from mRNA and Relieves the Translational Repression Activity of YB-1 Mol. Cell. Biol., March 1, 2005; 25(5): 1779 - 1792. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Chattopadhyay, D. Hawke, R. Kobayashi, and S. N. Maity Human p32, interacts with B subunit of the CCAAT-binding factor, CBF/NF-Y, and inhibits CBF-mediated transcription activation in vitro Nucleic Acids Res., July 8, 2004; 32(12): 3632 - 3641. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Laine, A. Thouard, J. Derancourt, M. Kress, D. Sitterlin, and J.-M. Rossignol In Vitro and In Vivo Interactions between the Hepatitis B Virus Protein P22 and the Cellular Protein gC1qR J. Virol., December 1, 2003; 77(23): 12875 - 12880. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. T. Hall, M. S. Giles, M. A. Calderwood, D. J. Goodwin, D. A. Matthews, and A. Whitehouse The Herpesvirus Saimiri Open Reading Frame 73 Gene Product Interacts with the Cellular Protein p32 J. Virol., October 11, 2002; 76(22): 11612 - 11622. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. V. Rozanov, B. Ghebrehiwet, T. I. Postnova, A. Eichinger, E. I. Deryugina, and A. Y. Strongin The Hemopexin-like C-terminal Domain of Membrane Type 1 Matrix Metalloproteinase Regulates Proteolysis of a Multifunctional Protein, gC1qR J. Biol. Chem., March 8, 2002; 277(11): 9318 - 9325. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Yi, H. P. Bogerd, and B. R. Cullen Recruitment of the Crm1 Nuclear Export Factor Is Sufficient To Induce Cytoplasmic Expression of Incompletely Spliced Human Immunodeficiency Virus mRNAs J. Virol., March 1, 2002; 76(5): 2036 - 2042. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. R. Reddy, M. Suhasini, W. Xu, L.-y. Yeh, J.-P. Yang, J. Wu, K. Artzt, and F. Wong-Staal A Role for KH Domain Proteins (Sam68-like Mammalian Proteins and Quaking Proteins) in the Post-transcriptional Regulation of HIV Replication J. Biol. Chem., February 15, 2002; 277(8): 5778 - 5784. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Hayman, M. M. Miller, D. M. Chandler, C. C. Goulah, and L. K. Read The trypanosome homolog of human p32 interacts with RBP16 and stimulates its gRNA binding activity Nucleic Acids Res., December 15, 2001; 29(24): 5216 - 5225. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. E. Bryant, D. A. Matthews, S. Wadd, J. E. Scott, J. Kean, S. Graham, W. C. Russell, and J. B. Clements Interaction between Herpes Simplex Virus Type 1 IE63 Protein and Cellular Protein p32 J. Virol., December 1, 2000; 74(23): 11322 - 11328. [Abstract] [Full Text]
|
|
|
|
 |
|
 T. Okagaki, A. Nakamura, T. Suzuki, K. Ohmi, and K. Kohama Assembly of Smooth Muscle Myosin by the 38k Protein, a Homologue of a Subunit of Pre-mRNA Splicing Factor-2 J. Cell Biol., February 21, 2000; 148(4): 653 - 664. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Jiang, Y. Zhang, A. R. Krainer, and R.-M. Xu Crystal structure of human p32, a doughnut-shaped acidic mitochondrial matrix protein PNAS, March 30, 1999; 96(7): 3572 - 3577. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Askjaer, T. H. Jensen, J. Nilsson, L. Englmeier, and J. Kjems The Specificity of the CRM1-Rev Nuclear Export Signal Interaction Is Mediated by RanGTP J. Biol. Chem., December 11, 1998; 273(50): 33414 - 33422. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Muta, D. Kang, S. Kitajima, T. Fujiwara, and N. Hamasaki p32 Protein, a Splicing Factor 2-associated Protein, Is Localized in Mitochondrial Matrix and Is Functionally Important in Maintaining Oxidative Phosphorylation J. Biol. Chem., September 26, 1997; 272(39): 24363 - 24370. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |