|
|
|
|||||||
|
|||||||||
(Received for publication, December 8, 1995; and in revised form, February 13, 1996) From the
We have identified a novel protein, p22, required for
``constitutive'' exocytic membrane traffic. p22 belongs to
the EF-hand superfamily of Ca
The processes of vesicle formation and fusion occur by conserved
mechanisms acting at various steps of exocytic and endocytic pathways (1) . Transport vesicles bind to their cognate target membranes
via a specific interaction mediated by the formation of
v-SNARE
To identify novel proteins involved in membrane traffic, we
generated a polyspecific rabbit serum against proteins present in a
homogeneous population of specialized exocytic vesicles(12) ,
TCVs, isolated from polarized epithelial cells. This serum recognizes
predominantly a 108-kDa protein named
TAP/p115(10, 12, 13) , but also interacts
with other proteins of smaller molecular mass (data not shown). We used
this antibody to screen a rat liver
Figure 1:
Sequence homology and
distribution of p22. A, alignment of rat p22 sequence with
sequences of calcineurin B from Naegleria and rat. The p22
cDNA contains a single open reading frame (ORF) of 585 nucleotides,
encoding 195 amino acids. The N-myristoylation site is double underlined (residues 2-7), and the four EF-hands
are boxed (p22EF-1, residues 30-58; p22EF-2,
62-90; p22EF-3, 114-142; and p22EF-4, 155-183). The
peptide used for polyclonal antibody production is underlined (residues 151-170). The amino acid sequences of calcineurin
B (CLNB) from rat (GenBank
BLAST searches of data bases revealed that p22 shares extensive
amino acid sequence similarity with the regulatory subunit of protein
phosphatase 2B (also known as calcineurin B, CLNB) from various
organisms (Fig. 1A, shaded residues). The
highest sequence similarity was observed with a CLNB from the protozoan Naegleria gruberi (51.4% identity; 72.3% similarity), slightly
less with CLNB from mammalian sources (43.5% identity; 65.9% similarity
with rat CLNB), and with CLNB from Drosophila melanogaster and
yeast Saccharomyces cerevisiae (40-44% identity;
63-65.8% similarity). p22 shows lower but significant similarity
(25-30% identity; 50-60% similarity) with other members of
the EF-hand superfamily, such as recoverins, visinins, frequenin,
centrins, and calmodulins. The primary sequence of p22 is completely
congruent with those of CLNBs from various species, i.e. p22EF-1 is more closely related to the EF-1 domain of all the CLNB
subfamily members than to the other EF-hands in p22. This suggests that
p22 and CLNB evolved from a precursor four-domain protein in an
ancestral organism. However, congruency is not sufficient for inclusion
into a subfamily(16) . Two characteristics of p22's
primary structure appear to place it in a separate subfamily: 1)
p22EF-2 is inferred not to bind Ca p22
mRNA (2.2-2.4 kilobases) was specifically detected in all tissues
that contained detectable amounts of the control mRNA, rpL32 (18) (Fig. 1D), using high stringency Northern
blot analysis. p22 Northern blot analysis was consistent with
immunoblotting analysis of p22 protein levels in the same tissues (data
not shown). To facilitate further studies, anti-p22 antibodies were
raised in rabbits against a 20-residue peptide (pep1) (residues
151-170; Fig. 1A, underlined), selected
using the GCG Peptide Structure program from the GCG package, for high
antigenicity and surface exposure. The antibodies were
affinity-purified (AP) on a pep1 column. The APpep1 antibodies
immunoprecipitate
Figure 2:
Characterization of anti-p22 APpep1
antibody. A, APpep1 recognizes in vitro translated
p22. In vitro transcribed and translated p22 was subjected to
immunoprecipitation using APpep1 anti-p22 antibodies (lane
APpep1), or preimmune serum (lane PI). Immunoprecipitated
proteins were analyzed by SDS-PAGE and fluorography. The molecular
masses in kDa are indicated on the left. B, p22
expression in bacteria. p22 was expressed in E. coli JM101 and
purified from bacterial lysates using standard chromatographic
techniques. A Coomassie Blue-stained SDS-PAGE of the purified material (lane p22-rec) is shown. The molecular masses in kDa are on
the left. C, APpep1 recognizes recombinant and
endogenous p22. Purified bacterially expressed p22 (lane
p22-rec), cell lysate of bacteria not expressing p22 (lane
-p22) and rat liver cytosol (lane cyt) were
subjected to SDS-PAGE and transferred to nitrocellulose. Nitrocellulose
was immunoblotted with APpep1 antibodies. A chemiluminescence image is
shown. The molecular masses in kDa are indicated on the right.
Since another protein, TAP/p115, identified using the polyspecific
anti-TCV serum has been shown to be required for membrane
traffic(13, 19) , we examined whether p22 is required
in a cell-free assay that reconstitutes the targeting/fusion of TCVs
with the apical plasma membrane (PM)(10) . We have shown
previously that NSF and TAP/p115 are required for transcytotic
targeting/fusion(10, 13) . Membrane fusion in this
assay is measured as the proteolytic cleavage of the 120-kDa polymeric
IgA receptor (pIgA-R) to a 90-kDa fragment, which occurs when TCVs
containing pIgA-R fuse with the apical PM, which contains a serine
ecto-protease. When donor TCVs and acceptor PM fractions are mixed with
10 µl of cytosol and an ATP-regenerating system and incubated at 37
°C for 1 h, fusion proceeds normally as evidenced by the conversion
of
Figure 3:
p22 is required for transcytotic
targeting/fusion. A, APpep1 inhibits transcytotic
targeting/fusion. Fusion reaction mixtures containing untreated cytosol (lane 1) or cytosol treated with increasing amounts of APpep1 (lanes 2-5) were incubated for 1 h at 37 °C. Fusion
was terminated and pIgA-R was immunoprecipitated and analyzed by
SDS-PAGE. A fluorograph is shown. The uncleaved 120-kDa form of pIgA-R
and its 90-kDa proteolytic fragment (arrowhead) are visible. B, p22 is required for transcytotic targeting/fusion. The
following fusion reactions were incubated for 1 h at 37 °C. Lane 1, reaction mixture containing donor, acceptor,
ATP-regenerating system, and 10 µl of cytosol; lane 2, as
in lane 1 but supplemented with 0.25 µg/ml APpep1
antibodies; lane 3, as in lane 2 but supplemented
with additional 10 µl of fresh cytosol; lane 4, as in lane 2 but supplemented with purified recombinant N-myristoylated p22, p22-myr (amount corresponding to the
amount of p22 present in 10 µl of cytosol). Fusion was terminated
and pIgA-R was immunoprecipitated and analyzed by SDS-PAGE. A
fluorograph is shown. The uncleaved 120-kDa form of pIgA-R and its
proteolytic fragment (arrowhead) are
visible.
To ensure that the inhibitory activity of
the APpep1 antibody was due to its specific binding to p22 and not
general inactivation of the reaction, we tested whether addition of
fresh cytosol or recombinant N-myristoylated p22 (p22-myr) to
the APpep1-inhibited fusion reaction could restore fusion. As shown in Fig. 3B, lane 1, in the absence of APpep1,
fusion proceeds normally, while the addition of 0.25 µg/ml APpep1
drastically inhibits fusion (lane 2). Addition of 10 µl of
fresh cytosol reverses that inhibition (lane 3) to the level
of fusion observed in the absence of APpep1. To show that p22 was
responsible for the reversal of inhibition, p22-myr was produced in E. coli JM101 using a coupled bacterial expression system
where yeast myristoyl-CoA:protein N-myristoyltransferase (NMT)
and p22 were co-induced from distinct promoters in the presence of
myristic acid(8, 9, 20) . p22-myr was
purified by standard chromatographic techniques to homogeneity as
described for p22-rec. Addition of purified p22-myr (in an amount
corresponding to the amount of p22 present in 10 µl of cytosol,
data not shown) reversed the APpep1 inhibition (Fig. 3B, lane 4) to the same extent as
addition of 10 µl of fresh cytosol. These results indicate that p22
is required for the exocytic targeting/fusion of TCVs with the PM. The role of Ca
Figure 4:
p22
calcium binding and N-myristoylation are required for
transcytotic targeting/fusion. A, p22 binds calcium. p22 was
expressed in E. coli using the 6
CLNB(29) , members of the recoverin
family(20, 30, 31, 32, 33) ,
and some annexins (34) are N-myristoylated, and this
modification appears functionally relevant, as shown for the
interaction between the Recently, it has been shown
that Ca
Volume 271,
Number 17,
Issue of April 26, 1996 pp. 10183-10187
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
-binding Protein, p22, Is Required for Constitutive
Membrane Traffic (*)
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
-binding proteins and
shows extensive similarity to the regulatory subunit of protein
phosphatase 2B, calcineurin B. p22 is a cytosolic N-myristoylated protein that undergoes conformational changes
upon binding of Ca. Antibodies against a p22 peptide
block the targeting/fusion of transcytotic vesicles with the apical
plasma membrane, but recombinant wild-type p22 overcomes that
inhibition. Nonmyristoylated p22, or p22 incapable of undergoing
Ca-induced conformational changes, cannot reverse the
antibody-mediated inhibition. The data suggest that p22 may act by
transducing cellular Ca signals to downstream
effectors. p22 is ubiquitously expressed, and we propose that its
function is required for membrane trafficking events common to many
cells.
t-SNARE complexes(2) . Subsequent membrane fusion
requires the assembly of the 
-SNAPNSF SNAREs complex
and the ATPase activity of NSF(
)(3) . Superimposed
on this basic paradigm is the regulation by Ca, by
GTP-binding proteins, and the involvement of various SEC products, the
function of which are still unresolved. Here we report the
identification of a novel p22 EF-hand Ca-binding
protein required for ``constitutive'' membrane traffic.
Cloning and Sequencing
A rat liver 
GT11
cDNA expression library (kindly provided by Dr. J. Schwarzbauer) was
screened with a polyspecific rabbit serum raised against rat
transcytotic vesicles (TCVs). A partial cDNA clone was isolated and
sequenced. A 170-base pair PCR amplified and gel-purified fragment of
the 5` end coding sequence of this partial cDNA was used to screen a
random-primed rat liver cDNA in pUEX (kindly provided by Dr. G.
Banting). Several overlapping cDNA clones were isolated, cloned into
pBluescript, and sequenced using standard techniques(4) . A
mutation which disrupts the third EF-hand calcium binding loop of p22
was introduced by PCR site-directed mutagenesis. A PCR primer that
spans p22's termination codon and has an 3` added XbaI
restriction site was paired with primer E134A
(5`GACAAGATCTCCCGCGATGCGCTG3`) in PCR reactions using p22 cDNA as a
template. p22-E134A was gel-purified and digested with BglII
and XbaI. The DNA fragments were then subcloned into the
appropriate sites in the p22 cDNA clone resulting in the construct
p22-E134A. The mutation was confirmed by DNA sequencing (4) .Northern Blot
Tissues were dissected from freshly
killed rats. Total RNA was extracted as described
previously(5) . RNA samples (20 µg) were loaded on a
formaldehyde-1% agarose gel, electrophoresed, and transferred to nylon
membranes (GeneScreen Plus, DuPont NEN) as described
previously(4) . The p22 and rpL32 cDNAs were gel-purified and 
P-labeled using a random prime labeling kit (Boehringer
Mannheim).Anti-p22 Antibodies
Anti-p22 antibodies were
raised in rabbits to a synthetic peptide (CQLGSAIDRTIQEADQDGDS;
residues 151-170 in p22 amino acid sequence) coupled to keyhole
limpet hemocyanin (Pierce). Immune serum was affinity-purified (APpep1)
using the peptide immobilized on Sulfolink coupling gel
(Pierce)(6) .Preparation of Recombinant p22
p22 cDNA was cloned
as a NdeI-KpnI PCR fragment into pMON2670 (7) (kindly provided by Dr. J. I. Gordon) under the recA
promoter and transformed into Escherichia coli JM101.
Transformant cultures were grown in LB in the presence of ampicillin
(100 µg/ml) and induced at an A
=
0.8-1.0 with 50 µg/ml nalidixic acid. After 90 min, cells
were collected and pelleted. Cell lysates were prepared by sonication
and precipitated with 40% ammonium sulfate for 1 h at 4 °C.
Precipitates were resuspended in 20 mM Tris, pH 8.0, 0.5
mM EDTA, and 0.5 mM dithiothreitol (TDE), dialyzed
against the same buffer, and applied to an DEAE-Sepharose column
equilibrated with TDE containing 50 mM KCl. The column was
eluted with a 50-500 mM KCl gradient. Fractions were
analyzed by immunoblotting with APpep1. The fractions containing p22
were collected, dialyzed against TDE, and applied to a Q-Sepharose Fast
Flow column equilibrated with TDE containing 50 mM KCl, and
fractions containing p22 were eluted with a 50-500 mM KCl gradient. The protein fraction containing p22 was dialyzed and
applied to a gel filtration column (Superdex 75, Pharmacia). The
fractions were analyzed by SDS-PAGE Coomassie Blue staining and
immunoblotting with APpep1 and the fractions containing p22 were
collected.Preparation of Recombinant N-Myristoylated
p22
p22-myr and p22-E134A were produced in a coupled bacterial
system, where p22 or p22-E134A (cloned into pMON2670 as described
above) and NMT (pBB131(8, 9) , kindly provided by Dr.
J. I. Gordon and Monsanto, Corp.) were co-transformed into E. coli JM101. Double transformants bacterial cultures were shaken at 37
°C till A = 0.4-0.5 in LB with
100 µg/ml ampicillin and kanamycin.
Isopropyl-1-thio-
-D-galactopyranoside was then added to a
final concentration of 0.5 mM to induce NMT production.
Cultures were shaken at 37 °C for another 20 min, and then myristic
acid (5 µg/ml) and nalidixic acid (50 µg/ml), to induce p22
production, were added to the cultures. After 1.5-2 h of
induction, cells were harvested and p22-purified using standard
chromatographic techniques as described under Preparation of
Recombinant p22.Cell-free Transcytotic Targeting/Fusion
Assay
In vivo radiolabeled donor fraction and unlabeled
target fractions and cytosol were prepared from rat livers as
described(10) . Targeting/fusion assays and analysis of pIgA-R
were performed as described(10) . Fusion is scored as the
amount of proteolytic cleavage of pIgA-R which occurs when TCVs
containing pIgA-R fuse with apical PM containing a serine
ecto-protease. The cleavage results in a shift in mobility of pIgA-R
from 120 kDa to 90 kDa (arrowhead) and is detected by
fluorographs of SDS-PAGE gels. In some experiments, reaction mixtures
were centrifuged and supernatant and pellets were separated. To
quantitate p22 wild-type and mutant proteins for addition to the fusion
reactions, increasing amounts (0.1-1 µl) of cytosol (12
mg/ml) were compared to that of recombinant p22s (p22-rec, p22-myr, and
p22-E134A) by immunoblotting. An amount of each of the recombinant p22s
corresponding to the amount of p22 present in 10 µl of cytosol was
added to fusion reactions.SDS-PAGE, Immunoblotting, and in Vitro
Transcription/Translation
Samples were processed for SDS-PAGE
and immunoblotting as described(11) . Immunoblots were
processed by chemiluminescence (Renaissance, DuPont NEN) and
nitrocellulose filters were exposed to x-ray film. p22 cDNA was in
vitro transcribed using ``mCAP'' mRNA capping kit
(Stratagene Cloning Systems). The mRNA transcript was translated in the
presence of [
S]methionine using an In Vitro Express rabbit reticulocyte translation kit (Stratagene Cloning
Systems).
gt11 cDNA expression library.
A 5` end PCR-amplified fragment from a positive clone was then used to
screen a rat liver cDNA library. Several overlapping cDNA clones were
identified revealing a single open reading frame (ORF). The ORF
contains 585 nucleotides encoding a novel 195-amino acid polypeptide
with a calculated molecular mass of 22.4 kDa (p22) (GenBank
accession number U39875). Subsequent work showed that the ORF
encodes a protein with an apparent molecular mass of 27 kDa. p22 is
predicted to be acidic with a pI of 4.82. Analysis of the predicted
amino acid sequence revealed an N-myristoylation consensus
site (14) (Fig. 1A, double underlined)
and four regions (residues 30-58, 62-90, 114-142, and
155-183; Fig. 1A, boxed) that conform to
the consensus sequence of the EF-hand motif (15, 16) (Fig. 1B). The
helix-loop-helix domain of the EF-hand includes a 12-residue loop,
involved in the coordination of the Ca ion, flanked
by two -helices(16) . Although all four EF-hands of p22
show homology to the consensus EF-hand motif, p22EF-2 contains a Phe
residue in position 10 (the X position is required for the
coordination of the Ca ion and can be only Glu, Gln,
Asp, Ser, or Thr) and is predicted not to bind Ca.
The other three EF-hands conform to the required consensus for
Ca binding but show several amino acid variations.
p22EF-1 and p22EF-2 contain an Asp and a Gly residue, respectively, at
position 21 (-Z) of the EF-hand, instead of the more
conserved Glu residue present in p22EF-3 and p22EF-4. Another variation
occurs at position 15 in which the conserved Gly residue is present
only in p22EF-1, while an Asp residue is present in p22EF-3 and a Ser
residue is present in p22EF-4 (Fig. 1B). These
variations, shown to occur in other members of the EF-hand superfamily,
are likely to play functional roles since selectivity for residues in
coordinating positions of the EF-hand correlates with the
Ca ion affinity of the EF-hand (17) .
accession number L03554) and N. gruberi (GenBank accession number U04380) are
aligned with the rat p22 sequence (top line; GenBank accession number U39875) for maximal homology using the PILEUP
routine from the GCG package. Amino acids identical between p22 and rat
CLNB or Naegleria CLNB are shaded. The 5
Ca-coordinating residues (X, Y, Z, -X, and -Z) are indicated above the p22
sequence. Numbers refer to the p22 amino acid sequence. B, the EF-hand domains of p22. The canonical EF-hand domain
consists of a 12-amino acid Ca binding loop flanked
on both sides by 8-9-amino acid stretches predicted to form
-helices. Residues 1-11 comprise the first helix,
11-20 the Ca-binding loop, and 19-29 the
second -helix. The consensus sequence includes: E, Glu; n, any hydrophobic residue; *, variable; G, Gly; I, Ile, Leu, or Val; X, Y, Z,
-X, and -Z (bold) are five of the six
Ca-coordinating residues and can be: Glu, Gln, Asp,
Ser, Thr; # can be any amino acid and coordinates the Ca ion through its carbonyl oxygen. The four EF-hand domains of p22
are shown beneath the consensus sequence. The nonconserved amino acid
in position X of the p22EF-2 is underlined. C,
relationship alignments. Dendogram illustrating the relationship
between rat p22 and other members of the EF-hand superfamily. These
clustering relationships are based on the PILEUP program which
compares a group of related sequences with each other using progressive
pairwise alignments. Distance along the horizontal axis is
proportional to the difference between sequences. Entire protein
sequences were used for these comparisons. D, tissue
distribution of p22 mRNA. Northern blot analysis of total RNA from
various rat tissues (B, brain; L, lung; T,
testes; K, kidney; S, spleen; and H, heart).
The p22 panel shows hybridization of a p22 cDNA P-labeled probe. The blot was stripped and hybridized to a
control probe (kindly provided by J. Saam and Dr. S. Tilghman)
corresponding to the ribosomal protein gene, rpL32 (18) (rpl 32 panel).
while the second
EF-hand domain of CLNB does bind Ca; 2) p22 contains
a 23-residue linker domain localized between p22EF-2 and p22EF-3 (RPI .
. . RSN) while the linker between domains 2 and 3 of CLNB is only eight
residues long (KEQ . . . KLR). Therefore, relationships based on
sequence similarities between p22 and other members of the EF-hand
superfamily suggest that p22 belongs to a separate subfamily that is
closely related to the CLNB subfamily (Fig. 1C).S-labeled p22 generated by in vitro transcription/translation of the p22 ORF cloned into pBluescript (Fig. 2A, lane APpep1). Recombinant p22
(p22-rec) was expressed in E. coli JM101 under a recA promoter
and purified to homogeneity from bacterial lysates using standard
chromatographic techniques (Fig. 2B, lane
p22-rec). APpep1 antibodies recognize the recombinant p22 (Fig. 2C, lane p22-rec) by immunoblotting but
not cell lysate of E. coli not expressing p22 (Fig. 2C, lane -p22). Significantly, the
APpep1 antibodies also recognize a protein of the same molecular weight
in rat liver cytosol (Fig. 2C, lane cyt).
80% of the 120-kDa pIgA-R to the 90-kDa fragment (Fig. 3A, lane 1). Addition of 0.05 µg/ml
or 0.1 µg/ml APpep1 to the fusion reaction has no apparent effect
on fusion efficiency (lanes 2 and 3). However, a
dramatic reduction in fusion is observed when APpep1 is added to the
fusion reaction at a concentration of 0.25 or 0.5 µg/ml (lanes
4 and 5).
in constitutive exocytosis is
disputed (21, 22) , although it has been suggested
that Ca might be required for exocytic secretion in
all cell types(23, 24, 25) . p22 contains
four EF-hands, three of which (p22EF-1, p22EF-3, and p22EF-4) are
predicted to bind Ca (Fig. 1B). To
test directly whether p22 binds Ca, the protein was
expressed in E. coli using 6 
His-tagged QIAexpress expression vector (Qiagen Inc., Chatsworth, CA), purified by
passing it through a nickel affinity column, and assayed for
Ca binding by the 
Ca overlay technique(26) . As shown in Fig. 4A, p22 binds Ca.
The majority of Ca-binding regulatory proteins
undergo Ca-dependent conformational changes (27) that modulate their function or influence the activity of
their effectors. To examine whether p22 undergoes
Ca-mediated conformational changes, we assayed
p22's electrophoretic migration on native acrylamide gel (28) under a range of Ca concentrations. At
0.4-0.5 µM Ca concentration,
native p22 undergoes an electrophoretic mobility shift (Fig. 4B, panel p22), indicating a
conformational change. To examine the functional significance of
p22's Ca-mediated conformational changes, we
constructed a p22EF-3 mutant in which a Glu residue
(-Z), involved in the coordination of the Ca ion, was replaced by an Ala residue (p22-E134A) and tested its
ability to undergo an electrophoretic mobility shift and to support
targeting/fusion. As shown in Fig. 4B, panel
p22-E134A, the p22-E134A mutant does not show altered
electrophoretic mobility when Ca concentrations reach
0.4-0.5 µM, suggesting that p22EF-3 needs to bind
Ca for p22 to undergo Ca-mediated
conformational changes. Addition of bacterially produced, purified N-myristoylated p22-E134A to the APpep1-treated transcytotic
fusion reaction (in an amount corresponding to the amount of p22
present in 10 µl of cytosol, data not shown), was not able to
restore transcytotic targeting/fusion to normal levels (Fig. 4C, lane 6). These results indicate that
p22's ability to undergo Ca-mediated
conformational changes is required for exocytic traffic.
His-tagged
QIAexpress expression vector (Qiagen Inc.) and the soluble
fraction either analyzed directly (lane Lysate) or after
purification over Ni-NTA columns (Qiagen Inc.) prior
to SDS-PAGE (lane Ni-NTA). The gel was transferred to
nitrocellulose and either immunoblotted with APpep1 antibodies or
incubated with Ca(25) . A
chemiluminescence image (panel APpep1) and an autoradiograph (panelCa) are shown. B, p22 undergoes Ca-dependent conformational
changes. In vitro transcribed and translated p22 (panel
p22) or a mutant containing a Glu to Ala substitution in the
-Z position (amino acid 134) of p22EF3 (panel
p22-E134A) were incubated with increasing concentrations of free
Ca (0.005-5.0 µM) for 10 min at 25
°C prior to electrophoresis on a native acrylamide
gel(28) . Ca/EGTA buffers were prepared
according to (49) . A fluorograph is shown. C, N-myristoylation and Ca-mediated
conformational shifts of p22 are required for transcytotic
targeting/fusion. The following fusion reactions were incubated for 1 h
at 37 °C. Lane 1, reaction mixture containing donor,
acceptor, ATP-regenerating system, and 10 µl of cytosol; lane
2, as in lane 1 but supplemented with 0.25 µg/ml
APpep1 antibodies; lane 3, as in lane 2 but
supplemented with an additional 10 µl of fresh cytosol; lane
4, as in lane 2 but supplemented with purified
recombinant N-myristoylated p22, p22-myr (amount corresponding
to the amount of p22 present in 10 µl of cytosol); lane 5,
as in lane 2 but supplemented with recombinant
nonmyristoylated p22, p22-rec (amount corresponding to the amount of
p22 present in 10 µl of cytosol); lane 6, as in lane 2 but supplemented with recombinant N-myristoylated EF-hand
mutant, p22-E134A (amount corresponding to the amount of p22 present in
10 µl of cytosol). Fusion was terminated and pIgA-R was
immunoprecipitated and analyzed by SDS-PAGE. A fluorograph is shown.
The uncleaved 120-kDa form of pIgA-R and its proteolytic fragment (arrowhead) are visible. D, p22 is N-myristoylated in vivo. Cell lysates of E. coli JM101 co-expressing p22 and NMT (lane NMT+p22) in
the presence of [
H]myristic acid were analyzed by
SDS-PAGE and fluorography. Control bacteria expressing only p22 (lane p22) or NMT (lane NMT) in the presence of
[H]myristic acid are also
shown.
and 
subunits of trimeric
G
(35) and for the membrane association of
p60
(36) . p22 contains an N-myristoylation consensus sequence and to assay directly
whether p22 is N-myristoylated, we co-expressed p22 and NMT in E. coli JM101 in the presence of
[H]myristic
acid(8, 9, 20) . When p22 and NMT are
co-expressed, a 27-kDa protein is specifically labeled by
[H]myristic acid (Fig. 4D, lane NMT+p22). However, if p22 (lane p22) or NMT (lane NMT) is expressed alone, no myristoylated p22 is
produced. Immunoblot analysis of these samples showed that p22 is
detected in all the samples expressing p22 (data not shown). The
functional significance of the N-myristoylation was determined
by adding purified nonmyristoylated p22 (p22-rec) produced in bacteria
to the APpep1-inhibited fusion reaction to determine whether p22-rec
could restore transcytotic targeting/fusion to normal levels. As shown
in Fig. 4C, lane 5, addition of p22-rec (in
amounts corresponding to the amount of p22 present in 10 µl of
cytosol, data not shown) to the APpep1-treated transcytotic fusion
reaction does not restore fusion to normal levels. These results
strongly suggest that both N-myristoylation and
Ca-mediated conformational changes are essential for
the function of p22 in exocytic traffic.-dependent neurotransmitter release shares a
common SNAP/SNARE-mediated mechanism with constitutive membrane
fusion(2, 37, 38) . Synaptotagmin has been
proposed to be the Ca sensor at the synapse, but
whether synaptotagmin functions as a Ca sensor
promoting vesicle fusion or as a Ca-dependent
negative regulator of exocytosis is not yet
resolved(39, 40, 41, 42) .
Ca is also required for several constitutive membrane
fusion events (ER to Golgi(43) , endosomal fusion(44) ,
ER to Golgi in yeast(45) , constitutive exocytosis in
yeast(46) , nuclear fusion(47) , transcytotic traffic,
data not shown), and we propose that p22 is part of the molecular
mechanism that mediates the Ca regulation of
constitutive exocytic membrane traffic. Recently, it was shown that the
endosomal recycling pathway can be up-regulated by elevating the
Ca concentration(42) . Evidence presented
here suggests that p22 might act as a general Ca sensor for constitutive exocytosis: p22 is widely expressed, it
is required for transcytotic targeting/fusion cell-free assay, it
undergoes conformational changes upon binding of concentrations of
Ca within the range of those shown for other
constitutive fusion events (42, 43, 44, 47) (0.1-1
µM), and specific mutations render it unable to function
in transcytotic targeting/fusion. Thus, it is possible that, as with
the rab superfamily of GTP-binding proteins, proteins belonging to the
EF-hand superfamily of Ca-binding proteins might have
an important role in regulating membrane traffic. Recently, frequenin,
a Drosophila member of the recoverin family of EF-hand
Ca-binding proteins, was shown to facilitate
neurotransmitter release in neuromuscular junctions(48) . The
molecular mechanism of p22's action is unknown. However, we
speculate that, like other members of the EF-hand superfamily, it uses
conformational changes to transduce cellular Ca signals to other protein(s) involved in membrane trafficking. p22
might act directly in membrane traffic or alternatively, by indirectly
modulating an essential component of the membrane traffic machinery.
)
We thank the members of the Sztul laboratory for
helpful discussions. We are grateful to Dr. J. Schwarzbauer, Dr. G.
Banting, J. Saam, Dr. S. Tilghman, Dr. J. I. Gordon, and the Monsanto
Corp. for their generous gifts of cDNA libraries and plasmids. We thank
Emily Jackson-Machelski for her help with the N-myristoylation
of proteins in E. coli. We appreciate the helpful comments and
discussions with Dr. R. Kretsinger and Dr. K. Howell.
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  H. C. Zaun, A. Shrier, and J. Orlowski Calcineurin B Homologous Protein 3 Promotes the Biosynthetic Maturation, Cell Surface Stability, and Optimal Transport of the Na+/H+ Exchanger NHE1 Isoform J. Biol. Chem., May 2, 2008; 283(18): 12456 - 12467. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. LaFerriere, D. J. Guarnieri, D. Sitaraman, S. Diegelmann, U. Heberlein, and T. Zars Genetic Dissociation of Ethanol Sensitivity and Memory Formation in Drosophila melanogaster Genetics, April 1, 2008; 178(4): 1895 - 1902. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Matsushita, Y. Sano, S. Yokoyama, T. Takai, H. Inoue, K. Mitsui, K. Todo, H. Ohmori, and H. Kanazawa Loss of calcineurin homologous protein-1 in chicken B lymphoma DT40 cells destabilizes Na+/H+ exchanger isoform-1 protein Am J Physiol Cell Physiol, July 1, 2007; 293(1): C246 - C254. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Mishima, S. Wakabayashi, and C. Kojima Solution Structure of the Cytoplasmic Region of Na+/H+ Exchanger 1 Complexed with Essential Cofactor Calcineurin B Homologous Protein 1 J. Biol. Chem., January 26, 2007; 282(4): 2741 - 2751. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H.-C. Wan, R. C. N. Melo, Z. Jin, A. M. Dvorak, and P. F. Weller Roles and origins of leukocyte lipid bodies: proteomic and ultrastructural studies FASEB J, January 1, 2007; 21(1): 167 - 178. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Y. Covarrubias, R. L. Khan, R. Vadigepalli, J. B. Hoek, and J. S. Schwaber Chronic alcohol exposure alters transcription broadly in a key integrative brain nucleus for homeostasis: the nucleus tractus solitarius Physiol Genomics, December 14, 2005; 24(1): 45 - 58. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Naoe, K. Arita, H. Hashimoto, H. Kanazawa, M. Sato, and T. Shimizu Structural Characterization of Calcineurin B Homologous Protein 1 J. Biol. Chem., September 16, 2005; 280(37): 32372 - 32378. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Fang, D. Choi, R. P. Searles, and W. D. Mathers A Time Course Microarray Study of Gene Expression in the Mouse Lacrimal Gland after Acute Corneal Trauma Invest. Ophthalmol. Vis. Sci., February 1, 2005; 46(2): 461 - 469. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Umlauf, E. Csaszar, M. Moertelmaier, G. J. Schuetz, R. G. Parton, and R. Prohaska Association of Stomatin with Lipid Bodies J. Biol. Chem., May 28, 2004; 279(22): 23699 - 23709. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Mitsui, F. Ochi, N. Nakamura, Y. Doi, H. Inoue, and H. Kanazawa A Novel Membrane Protein Capable of Binding the Na+/H+ Antiporter (Nha1p) Enhances the Salinity-resistant Cell Growth of Saccharomyces cerevisiae J. Biol. Chem., March 26, 2004; 279(13): 12438 - 12447. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Andrade, H. Zhao, B. Titus, S. Timm Pearce, and M. Barroso The EF-Hand Ca2+-binding Protein p22 Plays a Role in Microtubule and Endoplasmic Reticulum Organization and Dynamics with Distinct Ca2+-binding Requirements Mol. Biol. Cell, February 1, 2004; 15(2): 481 - 496. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Di Sole, R. Cerull, V. Babich, H. Quinones, S. M. Gisler, J. Biber, H. Murer, G. Burckhardt, C. Helmle-Kolb, and O. W. Moe Acute Regulation of Na/H Exchanger NHE3 by Adenosine A1 Receptors Is Mediated by Calcineurin Homologous Protein J. Biol. Chem., January 23, 2004; 279(4): 2962 - 2974. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Nagita, H. Inoue, N. Nakamura, and H. Kanazawa Two Nuclear Export Signals Specify the Cytoplasmic Localization of Calcineurin B Homologous Protein 1 J. Biochem., December 1, 2003; 134(6): 919 - 925. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Knoblach, B. O. Keller, J. Groenendyk, S. Aldred, J. Zheng, B. D. Lemire, L. Li, and M. Michalak ERp19 and ERp46, New Members of the Thioredoxin Family of Endoplasmic Reticulum Proteins Mol. Cell. Proteomics, October 1, 2003; 2(10): 1104 - 1119. [Abstract] [Full Text] [PDF]
|
|