| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
(Received for publication, February 12, 1996; and in revised form, March 7, 1996) From the
In mouse preadipocyte Ob1771 cells, transcription of the
insulin-like growth factor-I (IGF-I) gene was stimulated by growth
hormone (GH), and IGF-I protein combined with GH in medium was required
for their differentiation to adipocytes. During induction of the
differentiation, the intracellular expression of each class of IGF-I
mRNA was analyzed by reverse transcriptase-polymerase chain reaction.
When the cells were cultured in the presence of GH, the class 1del.
IGF-I mRNA was a major molecular species among IGF-I mRNAs. In the
presence of both GH and IGF-I, the splicing pattern of IGF-I mRNA
changed from class 1del. to class 1. Moreover, as detected by Western
blotting, the IGF-I protein was present in cells and in the medium only
when the cells were cultured in the presence of both GH and IGF-I. We
found that IGF-I secreted from Ob1771 cells could act in an
autocrine/paracrine fashion and induce the differentiation of other
Ob1771 cells. It was demonstrated that the translation efficiency of
class 1 mRNA was higher than that of class 1del. mRNA in
vitro. These results suggested that stimulation with exogenous
IGF-I in the presence of GH was required for the production of class 1
IGF-I mRNA and that the production of the IGF-I protein was activated
by increasing the translation efficiency through shifting the splicing
pattern of IGF-I mRNA from class 1del. to class 1. Exogenous IGF-I
triggered the differentiation by initiating the synthesis of endogenous
IGF-I.
Insulin-like growth factor-I (IGF-I) ( In mouse and rat(10, 11) ,
the IGF-I genes have two leader exons (exons 1 and 2), resulting in two
kinds of mRNAs (classes 1 and 2) (11, 12, 13) . There is another mRNA species,
class 1del., in which a central region of exon 1 is missing (Fig. 1A)(14, 15) . Exon 5 is also
spliced alternatively, resulting in Ea encoded by exons 4 and 6 and Eb
encoded by exons 4, 5, and 6(10, 16) . These diverse
IGF-I mRNAs eventually give the same mature protein. The biological
significance of the diversity of mRNAs, signal peptides, and E domains
is not understood.
Figure 1:
Structure of mouse IGF-I
gene and expression of each class of IGF-I mRNAs during induction of
differentiation. A, structure of mouse IGF-I gene is shown. Boxes indicate exons, and lines indicate introns and
flanking regions. Solid boxes mark the coding region for the
IGF-I prepropeptide, and a hatched box is the region spliced
out, giving class 1del. mRNA. Half-arrows above the exons
indicate positions and orientations of the primers used for RT-PCR.
Three classes of mature mRNAs are also shown at the bottom of
the panel. Ea and Eb are the splicing variants resulting from
alternative splicing of exon 5. B, Ob1771 cells were grown to
confluence in the standard medium (day 0) and cultured up to day 4 in
the GH differentiation medium or in the GH-IGF-I differentiation
medium. The medium was changed to the standard medium and the cells
were cultured for 2 days. On the day indicated on top of the panel,
total RNA was prepared from the cells. Using 1 µg of RNA, RT-PCR
was done with primers 1 and 6 (class 1), with primers 1-1del.
and 6 (class 1 + class 1del.), and with primers 2 and 6 (class 2). Amplified DNA fragments were analyzed by Southern
hybridization as described under ``Experimental Procedures.''
Similar results were obtained in three independent
experiments.
Mouse preadipocyte Ob1771 cells (17) can
differentiate to adipocytes. GH has a strong adipogenic activity in
Ob1771, 3T3-F442A(18, 19, 20) , and 3T3-L1 (21) preadipocytes. In Ob1771 cells, GH stimulates the
formation of diacylglycerol(22) , modulates the transcription
of the lipoprotein lipase gene (23) and transiently increase
the transcription of the c-fos gene(22) . GH also
stimulates the transcription of the IGF-I gene(6) , and IGF-I
is thought to participate in inducing the differentiation. In
differentiated Ob1771 cells, enzymes for lipid synthesis, such as
glycerophosphate dehydrogenase (GPDH), are activated(24) . Transcription of the IGF-I gene is stimulated by GH, but we observed
that IGF-I combined with GH was essential for the differentiation of
Ob1771 cells. The following interpretations are possible for these
facts. (i) For some reason, IGF-I secreted from Ob1771 cells is not
active enough to induce the differentiation. (ii) The IGF-I mRNA is
translated when cells are cultured in the presence of both GH and
IGF-I, but not when cells are cultured in the presence of GH alone.
(iii) The IGF-I protein is not secreted from Ob1771 cells without the
signal from the IGF-I receptor. To examine these possibilities, we
analyzed the expression of each class of IGF-I mRNA, and the expression
and secretion of IGF-I protein during the induction of differentiation.
Furthermore, we examined the translation efficiency of class 1 and
class 1del. mRNAs in vitro. In this study we show that IGF-I
in the medium changed the splicing pattern of IGF-I mRNA and allowed
the synthesis of IGF-I protein.
To obtain conditioned media and cell
lysates for Western blotting, cells were incubated in the serum free
medium, ASF104 (Ajinomoto), for 24 h. After the medium was removed, the
cells were harvested in the lysis buffer containing 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 10 mM EDTA, 0.5
mM (p-amidinophenyl)methanesulfonyl fluoride
hydrochloride, 2 mM benzamidine, 165 KIU/ml aprotinin, and 1%
Nonidet P-40.
Figure 2:
Secretion and production of IGF-I. Ob1771
cells were cultured to confluence in the standard medium (day 0) and
cultured up to day 4 in the differentiation medium supplemented with 10
nM GH (GH) or with 10 nM GH and 10 nM IGF-I (GH + IGF-I). The medium was changed to the
standard medium, and the cells were cultured for 2 days. On the day
indicated on top of the panel, the medium was changed to the
serum-free medium, and the cells were cultured for 24 h. The cells and
the media were collected separately and the IGF-I proteins in them were
analyzed by Western blotting using the mouse anti-human IGF-I
monoclonal antibody as described under ``Experimental
Procedures.'' Similar results were obtained in three independent
experiments.
Post-confluent Ob1771 cells were cultured for 2
days in the GH differentiation medium or in the GH-IGF-I
differentiation medium followed by the maintenance for 1 day in the
differentiation medium with no supplement, and a medium was finally
obtained which was termed the GH conditioned medium or the GH-IGF-I
conditioned medium, respectively. To analyze the activity of the
secreted IGF-I, we examined the differentiation of another mass of
Ob1771 cells with these two kinds of conditioned media based on the
activation of GPDH. When the cells were cultured in the GH-IGF-I
conditioned medium supplemented with 10 nM GH, the increment
of the GPDH activity was 82% of that of fully differentiated cells
cultured in the GH-IGF-I differentiation medium, and when the cells
were cultured in the GH conditioned medium with GH, the increment of
the GPDH activity was 17% of that of fully differentiated cells (data
not shown). These results showed that the IGF-I protein secreted from
Ob1771 cells had an activity that induced the differentiation of
another mass of Ob1771 cells.
Figure 3:
Translation efficiency of class 1 and
class 1del. mRNAs in vitro. Class 1 mRNAs starting at 303 (lane 2) and 252 (lane 3) nucleotides upstream from
the 3` end of exon1 and class 1del. mRNA (lane 4) were
transcribed in vitro and in vitro translation of four
micrograms each of mRNAs was performed in rabbit reticulocyte lysates
containing biotin-Lys-tRNA. Biotinylated proteins were analyzed by
Western blotting using horseradish peroxidase-labeled streptoavidin as
described under ``Experimental Procedures.'' Lane 1 indicates a blank reaction without added mRNA. Similar results
were obtained in three independent
experiments.
In our studies, class 1 mRNA was
proved to be more efficiently translated into protein than class 1del.
mRNA in vitro. This suggests that exogenous IGF-I activates
the intracellular production of IGF-I protein by shifting the splicing
pattern of IGF-I mRNA from class 1del. to class 1, which is much more
active in translation. The present result also suggests the presence of
specific cis-elements involved in the translational control.
It is reported that the efficiency of translation initiation is
affected by the sequence context near the 5` cap(35) , by the
upstream AUG codons and by the length and secondary structure of the
mRNA leader(36) . Further studies are necessary to identify
specific elements involved in the translational regulation of IGF-I
mRNA. However, we cannot rule out the possibility that exogenous IGF-I
also activates cellular translation machinery in vivo. In
Ob1771 cells, class 2 mRNA may be translationally inactive, since the
time of its appearance and requirement of GH and IGF-I do not coincide
with those for the IGF-I production. However, it is possible that class
2 mRNA is translationally regulated in different ways specified by cell
types and growth stages. We found that the GH-IGF-I conditioned
medium, which contained IGF-I secreted from Ob1771 cells, had an
activity that induced the differentiation of other Ob1771 cells. It is
strongly suggested that the activity was attributed to IGF-I in the
medium. However, we cannot rule out the possibility that another
adipogenic factor is secreted from Ob1771 cells in the presence of GH
combined with IGF-I and regulates the differentiation. Thus, we propose
the following hypothesis. GH stimulates the transcription of the IGF-I
gene, but the produced mRNA is mainly class 1del. mRNA, which is not
efficiently translated into protein. Exogenous IGF-I acts on
preadipocytes in an endocrine fashion to initiate the differentiation
and also to initiate the synthesis and secretion of endogenous IGF-I,
which then acts in an autocrine fashion and stimulates the next round
of the production and secretion of endogenous IGF-I. Therefore once
endogenous IGF-I was produced and secreted, exogenous IGF-I may not be
needed any more in the medium. An Ob1771 cell stimulated by IGF-I
combined with GH synthesizes and secretes many IGF-I molecules, which
act on other Ob1771 cells in a paracrine fashion. Amplified IGF-I acts
on a large number of cells and induces the differentiation and
synthesis of IGF-I to a progressively greater extent. In this way, many
cells can differentiate into adipocytes in response to the initial
stimulation with IGF-I. Although it is not clear whether a similar
mechanism regulates the expression of the IGF-I gene in other cell
types, it is possible that one of the post-transcriptional control
mechanisms of the IGF-I gene expression is the exogenous
IGF-I-dependent regulation of alternative splicing of pre-mRNA
Volume 271,
Number 17,
Issue of April 26, 1996 pp. 9883-9886
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
)is a 70-amino
acid polypeptide similar to proinsulin(1) . Transcription of
the IGF-I gene is regulated by growth hormone (GH), and IGF-I is
thought to mediate many of the biological effects of
GH(2, 3, 4, 5, 6) . IGF-I
has insulin-like activities such as stimulation of glycogen synthesis (7) . IGF-I also functions as a mitogen and as a
differentiation factor for various cell lines, including
preadipocytes(8) . The biological actions of IGF-I begin by
interaction with its cell surface receptor, which is a ligand-activable
tyrosine-specific protein kinase similar to the insulin
receptor(9) .
Cell Culture
Ob1771 cells were maintained in
Dulbecco's modified Eagle's medium supplemented with 200
units of penicillin/ml, 50 µg of streptomycin/ml, 33 µM biotin, 17 µM pantothenate, and 10% (v/v) calf serum
(Sigma). This medium was termed the standard medium. At confluence (day
0), cells were exposed to the standard medium supplemented with 2
nM triiodothyronine (Sigma) and 100 µM 3-isobutyl-1-methylxanthine (Sigma), which was termed the
differentiation medium. If necessary, cells were cultured from day 0 to
day 4 in the differentiation medium that was supplemented with 10
nM recombinant goat GH purified from Escherichia coli and/or with 10 nM recombinant human IGF-I (Bachem). The
differentiation media supplemented with GH, or with both GH and IGF-I,
were termed the GH differentiation medium and the GH-IGF-I
differentiation medium, respectively. Cells were cultured in the
standard medium for 4 additional days (
day 8) and used for the
GPDH assay. Both the standard medium and the differentiation medium
were changed every 2 days.GPDH Assay
After induction of the differentiation
(day 8), the cells were harvested and the GPDH activity was assayed as
described previously (25, 26, 27, 28) by measurement of
oxidation of NADH based on the absorbance at 340 nm. Two independent
experiments were performed.RT-PCR and Southern Hybridization
For detection of
both class 1 and class 1del. mRNAs, we prepared primer 1-1del.
(ATGGGGAAAATCAGCAGTC), the nucleotide sequence of which appears in exon
1. For exclusive detection of class 1 mRNA, we prepared primer 1
(TCAAAATTGAAATGTGAC), the nucleotide sequence of which appears in the
region of exon 1 that is to be removed upon splicing to form class
1del. mRNA. For detection of class 2 mRNA, we prepared primer 2
(CTGCTGTGTAAACGACCCGG), the nucleotide sequence of which appears in
exon 2. We also prepared primer 6 (AGGTCTTGTTTCCTGCAC), the nucleotide
sequence of which appears in the complementary strand in exon 6 (Fig. 1A). Total RNA was prepared from cells by
acid-guanidine thiocyanate-phenol-chloroform methods(29) . One
microgram of the total RNA was transcribed into cDNA with 200 units of
reverse transcriptase from murine leukemia virus (Life Technologies,
Inc.) in 20 µl of a reaction mixture containing 50 mM KCl,
20 mM Tris-Cl (pH 8.4), 2.5 mM MgCl
, 0.1
mg/ml bovine serum albumin, 1 mM each dNTP, 5 mM random hexamer, and 20 units of the ribonuclease inhibitor RNasin
(Promega). The cDNA synthesized during incubation for 1 h at 42 °C
was used as a template for PCR in a reaction mixture containing 5 units
of Taq DNA polymerase, 50 mM KCl, 20 mM Tris-Cl (pH 8.4), 2.5 mM MgCl, 0.1 mg/ml
bovine serum albumin, 0.2 mM each dNTP, and 0.2 mM each of the two primers. After 25 cycles (1 min at 95 °C, 1
min at 55 °C, and 2 min at 72 °C) of the PCR, DNA fragments
were electrophoresed on a 1% agarose gel and transferred to GeneScreen
Plus. Hybridization was done using the mouse IGF-I cDNA as a probe, and
positive signals were detected with a ECL labeling and detection system
(Amersham Corp.).Western Blotting
Cell lysates and conditioned
media were separated on a 15% SDS-polyacrylamide gel and transferred to
cellulose nitrate membranes (Schleicher & Schuell). The membrane
was blocked for 2 h in PBS containing 0.1% Tween 20 (PBS-T) with 5%
skim milk (Difco) and incubated for 1 h with monoclonal anti-human
insulin-like growth factor-I antibody (Upstate Biotechnology, Inc.) in
PBS-T. The membrane was washed twice for 15 min with PBS-T and
incubated for 1 h with goat anti-mouse IgG antibody horseradish
peroxidase conjugate (Bio-Rad) in PBS-T. After washing, the bound
antibody was made visible using an ECL detection system (Amersham).In Vitro Transcription and in Vitro
Translation
Plasmid constructs that contained the cDNAs for
mouse IGF-I class 1 and class 1del. mRNAs at the BamHI site of
pBluescript II KS were linearized and transcribed in vitro using T7 RNA polymerase. Messenger RNAs were synthesized in the
presence of 0.3 mM of the cap analogue m7GpppG (New England
Biolabs). In vitro translation of four micrograms each of in vitro transcribed IGF-I mRNAs was done according to the
manufacture's instructions (Amersham) in rabbit reticulocyte
lysates containing biotin-Lys-tRNA. The decay of individual mRNAs
during in vitro translation was examined by Northern blotting.
Newly synthesized biotinylated proteins were separated on a 13%
SDS-polyacrylamide gel and transferred to cellulose nitrate membranes.
The membrane was probed with horseradish peroxidase-labeled
streptoavidin (Amersham), and the bound streptoavidin was made visible
using an ECL detection system.
Requirement of GH and IGF-I for the Differentiation of
Ob1771 Cells
Based on the activation of GPDH, we analyzed the
differentiation of post-confluent Ob1771 cells that had been cultured
in the GH differentiation medium and in the GH-IGF-I differentiation
medium. In the differentiation medium with no supplement, Ob1771 cells
did not differentiate and GPDH was not activated. Cells that had been
cultured in the GH-IGF-I differentiation medium differentiated to
adipocytes; GPDH was markedly activated and many intracellular oil
droplets were observed. With the cells cultured in the GH
differentiation medium, the GPDH activity was only 5.8% of that of the
cells cultured in the GH-IGF-I differentiation medium (data not shown).
This showed that exogenous IGF-I combined with GH was essential for the
differentiation of Ob1771 cells.Formation of Each Class of IGF-I mRNA during Induction of
the Differentiation
In Ob1771 cells, it was reported that
transcription of the IGF-I gene was stimulated by GH(6) . Here
we analyzed the formation of each class of mRNA when post-confluent
Ob1771 cells were cultured in the GH differentiation medium or in the
GH-IGF-I differentiation medium. Total RNA was prepared from the cells,
and the formation of each class of mRNA was analyzed by RT-PCR (Fig. 1B). In the GH differentiation medium, class
1del. mRNA was a major molecular species. In the GH-IGF-I
differentiation medium, the splicing pattern was changed, resulting in
the formation of class 1 mRNA. In both cases, class 2 mRNA was
expressed transiently on the 4th day in the course of induction. This
result strongly suggested that splicing in exon 1 of the IGF-I gene was
regulated by IGF-I itself.Requirement of Both GH and IGF-I for the Synthesis and
Secretion of IGF-I Protein
Post-confluent Ob1771 cells were
cultured in the GH differentiation medium or in the GH-IGF-I
differentiation medium, and the synthesis and secretion of the IGF-I
protein were analyzed. Cell lysates and conditioned media were
separated by SDS-polyacrylamide gel electrophoresis and the IGF-I
protein was detected by Western blotting using anti-IGF-I antibody (Fig. 2). Neither the cells nor the conditioned medium contained
the IGF-I protein when the cells had been cultured in the GH
differentiation medium. The IGF-I protein was found in the cells from
day 2 to day 4 when the cells had been cultured in the GH-IGF-I
differentiation medium. In this case, IGF-I was found to be secreted
from the cells. On day 4, the medium was changed to the standard medium
that did not contain GH and IGF-I. On day 6, synthesis and secretion of
IGF-I did not stop immediately and IGF-I was detected both in the cells
and in the medium.
Translation Efficiency of IGF-I mRNAs in
Vitro
These results demonstrated that exogenous IGF-I changed
the splicing pattern of IGF-I mRNA from class 1del. to class 1 and that
exogenous IGF-I was also required to synthesize endogenous IGF-I. These
results suggested that the class 1 mRNA was engaged in the synthesis of
IGF-I protein, and the class 1del. mRNA was translationally inactive.
To confirm this, we examined the translation efficiency of class 1 and
class 1del. mRNAs by the in vitro translation assay (Fig. 3). With the rat class 1 IGF-I mRNA, several
transcriptional initiation sites of exon 1 were reported(30) .
Here we obtained two class 1 mRNAs, starting at 252 and 303 nucleotides
upstream from the 3` end of exon 1 and a class 1del. mRNA starting at
177 nucleotides upstream of the 3` end of the truncated exon 1 that
lacked the central region through splicing. The amounts of translation
products of class 1 mRNAs starting at 252 and 303 nucleotides upstream
from the 3` end of exon 1 were 29.4- and 13.7-fold greater than that of
class 1del. mRNA, respectively. This result demonstrated that class
1del. mRNA is much less active in translation in vitro than
the class 1 mRNAs and suggested that the inactivity of class 1del. mRNA
is caused by some structural elements in the RNA molecule. Thus,
translationally inactive class 1del. mRNA most probably results in
little production of the endogenous IGF-I protein in Ob1771 cells in
the GH differentiation medium.
Regulation of the IGF-I Gene Expression and the
Differentiation of Ob1771 Cells
The results in this paper
demonstrated that the IGF-I gene expression was regulated
post-transcriptionally by IGF-I itself. In the case of insulin, it was
reported that insulin regulated the expression of some genes
post-transcriptionally. For example, insulin combined with thrombin
stabilizes c-myc mRNA (31) , and insulin regulates the
relative level of expression of the two mRNA variants of the highly
insulin-induced delayed early gene, hrs, in differentiating
H35 cells(32) . Insulin also regulates the alternative splicing
of exon 11 of the insulin receptor gene in FAO cells (33) and
of the protein kinase C
in BC3H-1 myocytes(34) . Here we
demonstrated that exogenous IGF-I changed the splicing pattern of IGF-I
mRNA from class 1del. to class 1 in Ob1771 cells. In addition, when the
cells were cultured in the GH differentiation medium, class 1del. mRNA
appeared in two bands in the Southern hybridization analysis of the DNA
fragments amplified by RT-PCR (Fig. 1B). It is
suggested that the upper and the lower bands reflect the mRNA species,
including and excluding exon 5, respectively (Fig. 1A).
Thus, the alternative splicing of exon 5 is also regulated by IGF-I.
However, the significance of this regulation is not clear. Although the
growth factor-dependent regulation of the alternative splicing has not
been reported, it is likely that IGF-I regulates factors involved in
the alternative pre-mRNA splicing.
)
We thank Dr. G. Ailhaud and Dr. T. Kawada for
providing us with Ob1771 cells
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  M. Peterfy, J. Phan, and K. Reue Alternatively Spliced Lipin Isoforms Exhibit Distinct Expression Pattern, Subcellular Localization, and Role in Adipogenesis J. Biol. Chem., September 23, 2005; 280(38): 32883 - 32889. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Bachelot, P. Monget, P. Imbert-Bollore, K. Coshigano, J. J. Kopchick, P. A. Kelly, and N. Binart Growth Hormone Is Required for Ovarian Follicular Growth Endocrinology, October 1, 2002; 143(10): 4104 - 4112. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Baixeras, S. Jeay, P. A. Kelly, and M.-C. Postel-Vinay The Proliferative and Antiapoptotic Actions of Growth Hormone and Insulin-Like Growth Factor-1 Are Mediated through Distinct Signaling Pathways in the Pro-B Ba/F3 Cell Line Endocrinology, July 1, 2001; 142(7): 2968 - 2977. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. L. Wajchenberg Subcutaneous and Visceral Adipose Tissue: Their Relation to the Metabolic Syndrome Endocr. Rev., December 1, 2000; 21(6): 697 - 738. [Abstract] [Full Text]
|
|
|
|
 |
|
 J. F. Kuemmerle and T. L. Bushman IGF-I stimulates intestinal muscle cell growth by activating distinct PI 3-kinase and MAP kinase pathways Am J Physiol Gastrointest Liver Physiol, July 1, 1998; 275(1): G151 - G158. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. M. GREGOIRE, C. M. SMAS, and H. S. SUL Understanding Adipocyte Differentiation Physiol Rev, July 1, 1998; 78(3): 783 - 809. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. O'Prey, N. Leslie, K. Itoh, W. Ostertag, C. Bartholomew, and P. R. Harrison Both Stroma and Stem Cell Factor Maintain Long-Term Growth of ELM Erythroleukemia Cells, but Only Stroma Prevents Erythroid Differentiation in Response to Erythropoietin and Interleukin-3 Blood, March 1, 1998; 91(5): 1548 - 1555. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |
