| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
(Received for publication, November 29, 1995; and in revised form, February 9, 1996) From the
The cystic fibrosis transmembrane conductance regulator (CFTR)
gene exhibits a tightly regulated pattern of expression in human
epithelial cells. The mechanism of this regulation is complex and is
likely to involve a number of genetic elements that effect temporal and
spatial expression. To date none of the elements that have been
identified in the CFTR promoter regulate tissue-specific expression. We
have identified a putative regulatory element within the first intron
of the CFTR gene at 181+10kb. The region containing this element
was first identified as a DNase I hypersensitive site that was present
in cells that express the CFTR gene but absent from cells not
transcribing CFTR. In vitro analysis of binding of proteins to
this region of DNA sequence by gel mobility shift assays and DNase I
footprinting revealed that some proteins that are only present in
CFTR-expressing cells bound to specific elements, and other proteins
that bound to adjacent elements were present in all epithelial cells
irrespective of their CFTR expression status. When assayed in transient
expression systems in a cell line expressing CFTR endogenously, this
DNA sequence augmented reporter gene expression through activation of
the CFTR promoter but had no effect in nonexpressing cells.
The cystic fibrosis transmembrane conductance regulator (CFTR) ( Analysis of the DNA sequence of
the basal CFTR promoter reveals a number of elements that may be
involved in regulation of transcription. There are several potential
binding sites for the AP-1 transcription factor (GGAGTCAG) and three
putative binding sites for the transcription factor Sp1 (GGGCGG). There
is evidence for in vitro regulation of CFTR gene expression by
phorbol esters (Trapnell et al., 1991). A cAMP-response
element (TGACATCA) has been defined within the CFTR promoter at
-48 to -41 with respect to the transcription start site
defined by Yoshimura et al. (1991a) (McDonald et al.,
1995). Two purine/pyrimidine repeat elements have been identified in
the 5`-flanking region of the CFTR gene, one of which has been shown to
be S1 nuclease-sensitive in supercoiled plasmids, suggesting a non-B
DNA structure (Hollingsworth et al., 1994; McDonald et
al., 1994). There is little data on the control of cell
specificity of CFTR expression, although there is ample evidence for
such regulation. The human CFTR gene is expressed at significant levels
mainly in the epithelia lining the pancreas, intestine, bile ducts,
male genital ducts, and certain regions of the airway epithelium
including the inferior turbinate of the nose, the trachea, and the
serous portion of submucosal glands (Crawford et al., 1991;
Denning et al., 1992; Engelhardt et al., 1993). There
is evidence that expression of the CFTR gene may be hormonally
regulated in epithelia within the reproductive system (Trezise et
al., 1992; Rochwerger et al., 1994). Some degree of cell
type-specific control has been inferred for uncharacterized elements
within the immediate 5`-untranslated region. A number of DNase I
hypersensitive sites that show some degree of correlation with CFTR
expression have been observed between -3,000 bp relative to the
transcription start site and +100 bp into intron 1 (Yoshimura et al., 1991b; Koh et al., 1993). However, these
sites have only been examined in a few long term cell lines that either
do or do not express CFTR mRNA and protein and hence may not adequately
reflect cell-specific regulation of expression of the CFTR gene in
vivo. Transgenic mouse experiments in which 19 kb of genomic DNA
5` to the CFTR gene were placed 5` of a reporter gene failed to achieve
expression (Griesenbach et al., 1994). Because the
expression control elements of the CFTR gene had not been well defined,
we screened a larger region of genomic DNA than had been analyzed
previously in an attempt to identify these elements. The chromatin
structure of 120 kb of genomic DNA 5` to the CFTR gene was analyzed in
a number of CFTR expressing and nonexpressing cell types, including
primary genital duct epithelial cells in addition to long term cell
lines. We identified DNase I hypersensitive sites within this region by
screening with probes isolated from cosmid and phage clones (Rommens et al., 1989). Novel DNase I hypersensitive sites were
observed at -79.5 and -20.5 kb 5` to the ATG translation
start codon of the CFTR coding sequence (Smith et al., 1995).
Neither of these sites showed strong correlation with CFTR expression
in the cell types investigated. Although they may play an important
role in the complex series of events involved in the regulation of CFTR
transcription, these data do not support the existence of cell-specific
control elements at these sites. Another DNase I hypersensitive site
was observed within intron 1 of the CFTR gene. Detection of this site
correlated well, quantitatively and qualitatively, with the levels of
expression of the CFTR gene in both long term cell lines and primary
genital duct epithelial cells. Nuclear extracts from cells that
transcribe the CFTR gene contain specific proteins that bind to DNA in
the region of this hypersensitive site. Further, analysis of the
putative regulatory element through transient assays of reporter gene
constructs showed a positive effect on the activity of the CFTR
promoter in cells that express the CFTR gene endogenously.
Figure 1:
A, long range map of 70 kb of genomic
DNA flanking exon 1 of the CFTR gene. The restriction map for relevant
sites for the enzymes BamHI(B), EcoRI(R), HindIII(H), and XhoI(X) is shown on the solid
line. The scale is in kilobases, where zero denotes the position
of the ATG start codon of the CFTR coding sequence. I denotes
the location of exon 1. The cosmid cW44 used as a source of probes is
indicated by the horizontal arrow. The solid boxes represent the cW44 XB5.0, H4.0, and EB1.7 probes used to detect
the novel DNase 1 hypersensitive site at 181+10kb shown in Fig. 2. The vertical arrow marks the location of this
site. B, the restriction map of 800 bp flanking the
181+10kb DNase I hypersensitive site. The sites of the primers
used to amplify segments 3/4, 5/6, and 7/8 and the BS0.7 fragment are
shown by arrows. The HindIII (H) and EcoRI (R) restriction sites shown close to the
hypersensitive site in A are shown as well as the Scrf1 (Sc), Sau3a (Sa), and Alu (A) restriction sites in the 7/8 fragment. C,
oligonucleotides used in competition experiments are shown as follows.
ASTM1F/R and ASTM2F/R are in italics; ASTM3F/R are in bold
italics; ASTM4F/R and ASTM6F/R are underlined; and
ASTM5F/R are overlined. The PUT2 and inf.1 transcription
factor binding motifs located within the 7/8 element are shaded.
Figure 2:
Detection of a DNase I hypersensitive site
at 181+10kb. Figure shows autoradiographs of Southern blots of
genomic DNA extracted from nuclei treated with DNase I, digested with BamHI, and probed with the cW44 H4.0 fragment shown in Fig. 1. For each cell type (Caco2, MCF7, RVP, primary fetal vas
deferens cells, Capan1, HT29, primary fetal epididymis cells, and
37566), lane 1 shows DNA prepared from nuclei that had not
been treated with DNase I. Lanes 2-5 show DNA prepared
from nuclei treated with increasing amounts of DNase I: lane
2, 15 units; lane 3, 30 units; lane 4, 60 units; lane 5, 120 units DNase I. The cW44 H4.0 probe hybridizes to
an approximately 22-kb BamHI restriction fragment. A
subfragment of approximately 8 kb can be seen in lanes 2-5 in the cells lines that express the CFTR gene endogenously. This
indicates the presence of a DNase I hypersensitive site in this region,
located at approximately 181+10kb of the CFTR gene, lying within
intron 1 (shown by the arrow in Fig. 1).
In all transfection experiments the pGL2B 245 constructs were
co-transfected with the amount of DNA of pdolCMVcat (Ma et
al., 1992) as a transfection control. Luciferase and CAT assays
were carried out by standard procedures. Each transfection experiment
was carried out 6 times (5 for MCF7) with individual constructs being
assayed in quintuplicate in each experiment. The results are expressed
as relative luciferase activity, with the pGL2B 245 CFTR promoter
construct equal to 1, corrected for transfection efficiency as measured
by CAT activity. Statistical analyses of results were performed using
Minitab Statistical Software, Release 7 (1989, Minitab Inc. 3081
Enterprise Drive, State College, PA 16802).
Figure 3:
Gel mobility shift profiles of the 205-bp
7/8 fragment with nuclear extracts from CFTR+ and CFTR- cell
lines and competition with the 5/6 and 7/8 DNA fragments. Lanes
1, no nuclear extract; lanes 2, MCF7 (CFTR-); lanes 3, HPAF (CFTR-); lanes 4, HT29
(CFTR+); lanes 5, Caco2 (CFTR+). Complexes a1, c1,
and c2 are marked.
Figure 4:
Gel mobility shift profiles of the 205-bp
7/8 fragment with nuclear extracts from CFTR+ and CFTR- cell
lines and competition with the subfragments of the 7/8 DNA fragment as
shown. A and B, lanes 1, no nuclear extract; lanes 2, MCF7 (CFTR-); lanes 3, 37566
(CFTR-); lanes 4, primary epididymis (CFTR+); lanes 5, Caco2 (CFTR+). Complexes a1, a2, b1, b2, c1, and
c2 are marked. C, restriction map of the 7/8
fragment.
Further
mapping of the location of the DNA-protein complexes detected by gel
mobility shift analysis was achieved by competition with subfragments
of the 7/8 element (see Fig. 4C). In each case the
labeled probe was the entire 7/8 fragment, and all complexes were
abolished by the presence of excess unlabeled 7/8 fragment (Fig. 4A). The 38-bp AluI fragment did not
compete with any of the protein-DNA complexes (not shown). All
protein-DNA complexes were eliminated by an excess of 112-bp ScrfI (Fig. 4B) and 74-bp AluI/ScrfI fragments (not shown), suggesting that all
proteins causing gel shifts were binding between the ScrfI and AluI sites. In some competition experiments (not shown) the
93-bp ScrfI fragment showed weak competition with the a1, a2,
b1, and b2 complexes, suggesting the relevant protein complex might
also involve sites close to the 3` end of this fragment The addition of
excess unlabeled 130-bp Sau3a fragment blocked the formation
of complexes seen at bands a1, a2, b1, and b2 (Fig. 4A). Adding an excess of the 75-bp Sau3a
fragment eliminated the complexes seen at bands c1 and c2 (Fig. 4B). Hence, the complexes a1, a2, b1, and b2
detected in CFTR-expressing cells probably include proteins that bind
to DNA sequences lying 5` to the Sau3a site (Fig. 4C), and the complexes seen in all cell lines, c1
and c2, involve DNA-protein interactions primarily 3` to the Sau3a site.
Figure 5:
DNase I footprint of the 7/8 element.
Protected sequences are shown on the right. Lanes 1 and 14, AG ladder; lane 2, no DNase I; lanes
3 and 8, no nuclear extract; lane 4, 20 µg
of nuclear extract from MCF7 (CFTR-); lane 5, 40 µg
of nuclear extract from MCF7 (CFTR-); lane 6, 20 µg
of nuclear extract from HPAF (CFTR-); lane 7, 40 µg
of nuclear extract from HPAF (CFTR-), lane 9, 20 µg
of nuclear extract from Caco2 (CFTR+); lane 10, 40 µg
of nuclear extract from Caco2 (CFTR+); lane 11, 20 µg
of nuclear extract from primary epididymis cell culture i (CFTR+); lane 12, 40 µg of nuclear extract from primary epididymis
cell culture i (CFTR+); lane 13, 40 µg of nuclear
extract from primary epididymis cell culture ii
(CFTR+).
The
DNase I footprint data suggest a complex pattern of DNA-protein
interactions within this region of the 7/8 fragment. The results
obtained with nuclear extracts from the primary cells suggest that the
complex of protein(s) may be altering chromatin structure as revealed
by the presence of DNase I hypersensitive sites. It is probable, given
the complexity of the DNase I footprint and gel mobility shift data,
that a number of proteins are interacting with this region of genomic
DNA.
Competition with
a 100-fold molar excess of oligonucleotides ASTM2F/R resulted in a
reduction in the amounts of band a1 on gel mobility shift reactions in
Caco2 (Fig. 6A). This suggested that the 20 base pairs
of ASTM2F/R encompassed at least one site of DNA-protein interaction
for the a1 complex. However, when oligonucleotide ASTM2F/R was labeled
and used in gel mobility shift assays (not shown), it was inefficient
(in comparison with the whole 7/8 fragment) at generating a DNA-protein
complex with nuclear extracts from Caco2 cells, suggesting that
nucleotides lying outside this 20-bp sequence (presumably 5` to it, on
the basis of the 7/8 restriction fragment competition experiments
above) may be important for the formation of complex a1. Further
evidence for this was provided by gel mobility shift experiments with
the ASTM5F/R oligonucleotide, which generated the a1 complex more
efficiently than ASTM2F/R (not shown). ASTM2F/R was also seen to
inhibit formation of the a2/b1/b2 complexes seen with primary
epididymis cell nuclear extracts (Fig. 6C). Here again,
the competition was incomplete, suggesting that other elements outside
this sequence (presumably 5` to it) were important in the generation of
these complexes. The ASTM5F/R oligonucleotide was also effective in
competition of the a1/a2/b1/b2 complexes (competition of a1 is shown in Fig. 6B) with little effect on the noncell-specific c1
and c2 complexes.
Figure 6:
Gel mobility shift profiles of the 205-bp
7/8 fragment with nuclear extracts from Caco2 and primary epididymis
cells and competition with oligonucleotides ASTM1F/R, ASTM2F/R,
ASTM3F/R, ASTM4F/R, and ASTM5F/R as shown. A, Caco2 nuclear
extract and competition with 100
Competition with oligonucleotides ASTM4F/R showed
no inhibition of the a1 complex (Fig. 6B), hence it is
likely that the a1/a2/b1/b2 complexes are interacting with DNA 5` to
the end of oligo 4. This was confirmed by gel mobility shift
experiments (not shown) using the MseI fragment lying between
720 and 748 (see Fig. 6D) as a probe, which only
generated the c1 and c2 complexes. Competition with oligonucleotides
ASTM4F/R showed inhibition (though incomplete) of formation of the c1
and c2 complexes seen in all cell types analyzed (Fig. 6B). Further, the ASTM4F/R oligonucleotide alone
was effective at forming the c1 and c2 complexes when used as a probe
in gel mobility shift assays (not shown). However, oligonucleotide
ASTM3F/R, which overlaps the 3` 19 bp of ASTM4F/R, was only able to
cause slight inhibition of the c1 and c2 complex in Caco2 at 500-fold
excess (Fig. 6A), suggesting that the important
DNA-protein interactions required for generating the c1 and c2
complexes are close to the Sau3a site. Neither
oligonucleotides ASTM1F/R nor ASTM6F/R showed competition with any of
the DNA-protein complexes detected in the primary epididymis cell
nuclear extracts or those from any of the other cell lines (not shown).
Hence the precise nature of the DNase I footprint observed in the
region of ASTM1F/R (GTACTTTGGAATC) with the epididymis cell nuclear
extracts (Fig. 5) remains obscure. In summary (Fig. 6D) the DNA-protein interactions that generate
the gel mobility shifts c1 and c2 seen with nuclear extracts from all
the cell types that we have analyzed occur between the MseI
site at 720 and the MseI site at 748 with the key sites in the
complex lying closer to the 5` half of this fragment. The DNA-protein
interactions that generate the gel mobility shifts a1, seen in Caco2
and HT29 and a2, b1, and b2 seen in primary epididymis nuclear extracts
(none of these complexes being seen in the cell lines Panc-1, HPAF, and
MCF7 that do not transcribe CFTR) are 5` to the MseI site at
720 but 3` to the end of oligonucleotide ASTM6F/R at 699. The
efficiency of the ASTM5F/R oligonucleotide in generating the a1 complex
in Caco2 nuclear extracts confirms this localization. The ability of
the ASTM2F/R oligonucleotide to form the a1 complex, even if
inefficiently, suggests that the base pairs involved in this
interaction do not extend greatly to the 5` end of this oligonucleotide
at 711.
Figure 7:
Transient transfection experiments. The
bar chart shows the luciferase activities for each construct relative
to the 245 CFTR promoter only construct (=1) in the MCF7,
16HBE14o-, and Caco2 cell lines.
The results
of the luciferase assays showed that none of the cloned fragments from
intron 1 had an effect on the CFTR promoter when transfected into MCF 7
cells. Similar results were obtained in the 16HBEO14o- cell line
that while transcribing CFTR at a high level as a result of SV40
Ori- transformation, does not show the DNase I hypersensitive
site at 181+10kb that is seen in the other cell types that express
CFTR endogenously. However the 7/8 fragment had a positive effect on
CFTR promoter activity in the Caco2 cell line. Although the 5/6
fragment had essentially no effect, 1.1 (S.E.= 0.176) The identification and isolation of element(s) that control
expression of the CFTR gene are of particular importance in the context
of potential targeted gene therapy for CF. Previous analyses of
chromatin structure (and methylation status) of the CFTR gene promoter
region have identified a number of DNase 1 hypersensitive sites in a
small number of cell lines that show some correlation with CFTR
expression in those lines (Koh et al., 1993; Yoshimura et
al., 1991a); however, to date the picture is incomplete. We have
identified DNase 1 hypersensitive sites at -20.5kb and
-79.5kb to the translational start codon of the CFTR gene (Smith et al., 1995); these sites are seen in all cell types we have
analyzed. Hence, the search for elements and factors that mediate
tissue-specific expression continues. It is likely that regulation of
expression of the CFTR gene is complex and involves the interaction of
a number of different regulatory factors and elements. We describe here
one element that appears to play a role in controlling expression of
the CFTR gene.
Through a combination
of DNase I footprint analysis and gel mobility shift assays using
subfragments of the region (7/8) containing this element and
oligonucleotides, we have determined that the regulatory element is
located within a sequence of about 40 bp. The 40-bp sequence contains
two distinct sites of DNA-protein interactions as illustrated in Fig. 6D. The 5` side of the MseI site at 720
bp contains the sequence AATCCTAACTCTGTCACTTAT. A minimum of 9
bases (in bold) at the end of this sequence are crucial for the binding
of the proteins found specifically in the nuclear extracts of the
CFTR-expressing Caco2 and primary epididymal cells. It is probable that
additional base pairs may be involved in the interaction. On the 3`
side of the same MseI site is the sequence
TAACAATGTGATCTTAGGCAATTTACTT. A minimum of 13 base pairs (in
bold) are likely to be involved in DNA binding of the proteins that
generate the c1 and c2 complexes detected in CFTR expressing and
nonexpressing cells. Analysis of the DNA sequence shown in Fig. 1C reveals the presence of consensus binding
motifs for several known transcription factors within the 7/8 region.
These include PUT2 ATGTACTT (Siddiqui and Brandriss, 1988) and inf.1
AAGTGA (Fujita et al., 1987). The PUT2 protein functions in
concert with the proline utilization pathway of Saccharomyces
cerevisiae. The regulatory element lies upstream of the TATA box
of this gene and is essential in proline induction of the PUT2 gene.
The PUT2 homology within the 7/8 region lies within the sequence
671-683 that shows protection on DNase I footprints solely with
the primary epididymal cell nuclear extracts (see Fig. 5). The
relevance of this putative element to regulation of CFTR gene
expression is not inherently obvious. A region of homology with
inf.1 lies at the 5` end of the ASTM2R oligonucleotide on the reverse
strand and is coincident with the base pairs that appear to be
responsible for binding of the a1 complex observed in Caco2 nuclear
extracts. The inf.1 element is a 6-bp unit of a repeated sequence that
mediates virus-induced transcription of interferon
The pattern of expression of these proteins in different cell
types is of interest. All cell types we have analyzed contain proteins
that generate the c1 and c2 complexes that bind to oligonucleotide
ASTM4F/R. On the basis of gel mobility shifts, these proteins would
appear to be the same in all cells. However, the proteins that bind to
the region of the ASTM2F/R and ASTM5F/R oligonucleotides in different
cell types are likely not to be all the same. Nuclear extracts from
intestinal carcinoma cell lines Caco2 and HT29 and the pancreatic
adenocarcinoma cell line Capan1 all produce the same prominent gel
mobility shift designated a1. The abundance of this complex is greater
in the intestinal carcinomas, and this may reflect the CFTR expression
levels in these cells (see Table 1). Nuclear extracts from
primary epididymis cells show at least three gel mobility shift bands
(a2, b1, and b2) with mobilities differing from the single predominant
complex seen in Caco2 nuclear extracts. Oligonucleotide competition
experiments have shown that the proteins that cause the a1/a2/b1/b2 gel
shifts are all interacting with the sequence of ASTM2F/R and ASTM5F/R.
However, the DNase1 footprinting data show a greater region of
protection of the DNA backbone by nuclear extracts from the primary
cells. We have not determined whether the other proteins are in fact
binding directly to the DNA or to other proteins in the DNA-protein
complex. We are further characterizing the nature of these proteins. The data from the gel mobility shift assays (taken together with the
data showing that the DNase I hypersensitive site at 181+10kb is
only seen in cell types that express the CFTR gene) lead us to propose
the following model for DNA-protein interactions in this region of the
gene. Some protein factors that bind to this region are present in
nuclear extracts from most cell types, regardless of their status with
respect to CFTR expression, and their presence alone does not create a
DNase I hypersensitive site. Additional proteins that bind to the DNA
in this region and cause conformational changes in the chromatin
structure to expose a DNase I hypersensitive site are expressed in many
cell types that endogenously transcribe the CFTR gene. There is
evidence for such a mechanism existing in regulatory elements
associated with other genes (Jenuwein et al., 1993). At this
stage the nature of any interactions between the individual proteins
themselves and between each of them and the DNA backbone remains to be
elucidated.
The nucleotide
sequence(s) reported in this paper has been submitted to the
GenBank(TM)/EMBL Data Bank with accession number(s)
U47863[GenBank].
Volume 271,
Number 17,
Issue of April 26, 1996 pp. 9947-9954
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
)gene (Rommens et al., 1989; Riordan et
al., 1989) shows a tightly regulated pattern of temporal and
spatial expression (Crawford et al., 1991; Harris et
al., 1991; Denning et al., 1992; Trezise et al.,
1993). Very little is known about the genetic elements and
transcription factors that regulate CFTR expression. The basal promoter
of the CFTR gene has been analyzed in some detail (Chou et
al., 1991; Yoshimura et al., 1991a, 1991b; Koh et
al., 1993), although the data are somewhat inconsistent. The
minimal promoter sequence found between -226 and +98 bp with
respect to the transcription start site defined by Chou et
al.(1991) is sufficient to drive low levels of expression of a
reporter gene (Chou et al., 1991; Koh et al., 1993).
However, Chou et al.(1991) also identified an element
immediately upstream of -277 that repressed reporter gene
transcription in several cell lines.
Cell Culture
The following cell lines were
analyzed: primary human mid-trimester fetal vas deferens and epididymis
epithelial cells (Harris and Coleman, 1989) and SV40 Ori-
transformed vas deferens (RVP) and epididymis (REP) cell lines (Coleman
and Harris, 1991); Caco2 (Fogh et al., 1977), HT29 (Huet et al., 1987), Capan1 (Fogh et al., 1977), HPAF (Kim et al., 1989); MCF7 (Soule et al., 1973), and a
lymphoblastoid cell line 37566. The 16HBE14o- SV40 Ori-
transformed bronchial epithelial cell line (Kozens et al.,
1994) was kindly donated by Dr. D. Gruenert.Reverse Transcription-PCR
All cell types studied
were tested for CFTR mRNA expression by reverse transcription-PCR
(RT-PCR) at the time of isolation of nuclei for chromatin analysis
(Smith et al., 1995).Generation of Probes
The cW44 cosmid was kindly
provided by Drs. Johanna Rommens and Lap-Chee Tsui (Rommens et
al., 1989). The XB5.0 (5 kb XhoI/BamHI), H4.0 (4
kb HindIII), and EB1.7 (1.7 kb EcoRI/BamHI)
subfragments of this cosmid are shown in Fig. 1.
DNase I Hypersensitivity Assays
Chromatin from a
panel of cell types was probed for DNase I hypersensitive regions by
standard methods (Higgs et al., 1990).Amplification and Cloning of Fragments of Intron
I
The location of oligonucleotides used for PCR amplification of
fragments of intron 1 TSR3/4, TSR5/6, and TSR7/8 are shown in Fig. 1B. IA1R, CGGGATCCAAGCAAGTACGCATGATA; TSR3,
CCTTAATTAAGGATCCGAGAATGTGTGATTTTCTTG; TSR4,
TCCCCGCGGATCCAAGGGAAGATCAGGAACAAC; TSR5,
CCTTAATTAAGGATCCATAGTGTGAAAACCACTGAC; TSR6,
TCCCCGCGGATCCTCCAAAGTACATGCTTCTTC; TSR7,
CCTTAATTAAGGATCCTCATCTTTATCTTCATTGTC; and TSR8,
TCCCCGCGGATCCTAACTCATTGTACTGACGAG. Primers for PCR amplification of
intron 1 subfragments were designed to have BamHI and either PacI (forward primers) or SacII (reverse primers)
restriction sites at their 5` end. Fragments 3/4, 5/6, and 7/8 and the
BS0.7 (750 bp) fragment amplified by primers IAIR and TSR8 spanning the
site in intron 1 were cloned into pCRII (In Vitrogen). All subcloned
fragments were sequenced to exclude PCR artifacts.Gel Mobility Shift Assays and DNase I
Footprinting
DNA fragments were labeled by fill-in reactions
with Klenow DNA polymerase and [
-
P]dATP,
dCTP, and/or dTTP. Oligonucleotides were end labeled with T4
polynucleotide kinase and [
-P]dATP.
Preparation of nuclear extracts and gel mobility shift assays were
carried out as described previously (Hollingsworth et al.,
1994). DNase I footprinting reactions used standard methods (Philipsen et al., 1990). Oligonucleotide sequences for competition
experiments are ASTM1F/R to ASTM6F/R: ASTM1F, GTACTTTGGAATCAG ASTM1R
CTGATTCCAAAGTAC; ASTM2F, GTCACTTATTAACAATGTGA; ASTM2R,
TCACATTGTTAATAAGTGAC; ASTM3F, TCTTAGGCAATTTACTTA; ASTM3R,
TAAGTAAATTGCCTAAGA; ASTM4F, ACAATGTGATCTTAGGCAATTTACTT; ASTM4R,
AAGTAAATTGCCTAAGATCACATTGT; ASTM5F, AATCCTAACTCTGTCACTTATTAACAATGTGATC;
ASTM5R, GATCACATTGTTAATAAGTGACAGAGTTAGGATT;
ASTM6F,GTACTTTGGAATCAGACAGACCTGGCTGG; and ASTM6R,
CCAGCCAGGTCTGTCTGATTCCAAAGTAC.Transient Expression Assays
Transient expression
constructs were generated using the pGL2B Basic vector (Promega). A
787-bp fragment (named 245) spanning the CFTR basal promoter (from
-820 to -33 with respect to the ATG translational start
codon) was amplified using the primers Bii-5BNheI
(CTAGCTAGCGGAGTTCACTCACCTAAACCTCAAA) and 98LBglII
(AGATCTTCTGGGCTCAAGCTCCTAATG) and cloned into NheI and BglII sites of the promoter multiple cloning site of pGL2B in
the correct orientation for driving transcription of the luciferase
gene. The 5/6, 7/8, and full-length BS0.7 fragments of the intron 1
region (see Fig. 1B) were cloned into the BamHI restriction site in the ``enhancer'' segment
of the vector. The orientation of each fragment with respect to the 245
promoter fragment was verified, and further experiments carried out on
those orientated 5` 
3` with respect to the vector backbone.
Expression of CFTR mRNA
Expression of CFTR was
measured by reverse transcription-PCR in all the cell cultures used in
this study at the time nuclei were isolated for hypersensitivity assays
(Smith et al., 1995). This assay does not provide a highly
accurate quantitative estimation of levels of CFTR mRNA expression;
however, it provides a useful qualitative method of verifying
production of CFTR mRNA by the cells under investigation when performed
with an internal control for a house-keeping gene such as
glucocerebrosidase. These data are summarized in Table 1.
A Novel DNase I Hypersensitive Site in Intron 1
A
diagram showing the relative positions of the XB5.0 (5 kb XhoI/BamHI, where the BamHI site is located
at the cosmid end), H4.0 (4 kb HindIII), and EB1.7 (1.7 kb EcoRI/BamHI) subfragments of the cW44 cosmid that
were used as probes are shown in Fig. 1A. The efficacy
of DNase I treatment of every preparation of DNase I-treated nuclei was
evaluated with the RA2.2 probe that is known to detect a constitutive
DNase I hypersensitive site within the -globin gene cluster in all
cell types (Vyas et al., 1992). All three probes hybridized to
a 22-kb BamHI fragment in genomic DNA from the cell lines
analyzed, as would be predicted from the CFTR genomic DNA map (Rommens et al.(1989) and Fig. 1A). As is shown in Fig. 2for the H4.0 probe, increasing amounts of DNase I revealed
a hypersensitive site within this 22-kb fragment, yielding a major
product of 8 kb. In addition less prominent fragments of about 12 and
10 kb were also seen in some cell types, particularly Caco2, HT29, and
primary epididymis, suggesting the presence of additional
hypersensitive sites in this region. The major hypersensitive site was
located 8 kb from the 5` end of the 22-kb BamHI fragment and
hence approximately 10 kb 3` from the end of exon 1 of the CFTR gene.
Based on CF Genetic Analysis Consortium nomenclature, this site will be
called 181+10kb, where 181 refers to the last base in exon 1.
Hybridization with other probes from this region confirmed the
localization. This hypersensitive site has the potential to contain
cell type expression control elements because it is seen only in cell
lines that transcribe CFTR mRNA. The relative degree of
hypersensitivity of the site correlated with the relative levels of
endogenous expression of CFTR (Table 1). The high expressing
colon carcinoma cell lines Caco2 and HT29 show the site most strongly;
the pancreatic adenocarcinoma cell line Capan that expresses low levels
of CFTR mRNA shows the hypersensitive site weakly, the breast carcinoma
epithelial cell line MCF7, and the lymphoblastoid cell line 37566 do
not show this site. Most importantly, cultured human fetal epididymis
and vas deferens epithelial cells that express CFTR in vitro show the hypersensitive site, whereas it is barely detectable in
the transformed genital duct-derived cell lines REP and RVP, which have
greatly down-regulated CFTR expression following transformation. This
site is not evident in the 16HBE14o- bronchial epithelial cell
line that expresses high levels of CFTR following SV40 Ori-
transformation (not shown).Sequence Analysis of the 181+10kb Hypersensitive
Site
The XB5.0 fragment of the cW44 cosmid (from the more distal XhoI site 3` to the end of exon 1 to the BamHI site
at the end of the cosmid, see Fig. 1) spanned the hypersensitive
site. This fragment was subcloned into the BamHI and SalI/XhoI sites of pUC119. Because the DNase I
hypersensitive site was known to be in close proximity to the HindIII and EcoRI sites at 1.7 and 1.9 kb from the 3`
end of the XB5.0 fragment (see Fig. 1A), these sites
were utilized for subcloning the EcoRI and HindIII
fragments. The inserts were sequenced. A partial restriction map of 850
bp flanking this region is shown in Fig. 1B.Gel Mobility Shift Assays
Overlapping fragments of
approximately 250 bp (3/4, 5/6, and 7/8) were generated from within the
850-bp fragment of intron 1 by PCR. No specific gel mobility shifts
were observed with fragments 3/4 or 5/6. However, several proteins
bound to fragment 7/8 as illustrated in Fig. 3. Two gel mobility
shift bands were generated by nuclear extracts from all cell lines
tested, irrespective of whether they transcribe CFTR (bands c1 and c2). At least one other protein complex was seen in
long term cell lines transcribing CFTR, Caco2, HT29 (Fig. 3, band a1), Capan1, REP, and RVP. These protein-DNA complexes
were specifically competed by excess cold fragment 7/8 but not by the
5/6 fragment (Fig. 3). Primary epididymis and primary vas
deferens nuclear extracts also caused gel mobility shifts of fragment
7/8 and the formation of a complex of at least three components (a2, b1, and b2, Fig. 4A).
The lymphoblastoid cell line 37566 showed a gel mobility shift to form
a complex lying between a2 and b1 (Fig. 4A).
DNase I Footprinting of the 7/8 Fragment
Fig. 5shows DNase I footprinting of the 7/8 fragment
following binding of nuclear extracts from the MCF7 and HPAF cells
lines that do not transcribe CFTR, the Caco2 carcinoma cell line, and
two independent primary epididymis cell cultures that transcribe the
CFTR gene. A footprint between bases 726 and 746
(ATGTGATCTTAGGCAATTTAC) (see Fig. 1C) was seen in all
cell lines. The precise appearance of this footprint was slightly
different when nuclear extracts from primary cells were used, as
illustrated by the appearance of a hypersensitive site close to the Sau3a site at 730. Nuclear extracts from the primary
epithelial cells gave two additional footprints at bases 712-726
(GTCACTTATTAACAAT) and 671-683 (GTACTTTGGAATC), separated by
another hypersensitive site close to the ScrfI site. The
footprint at bases 712-727 is weakly evident with Caco2 nuclear
extracts and on occasion is seen with MCF7 nuclear extracts.
Oligonucleotide Analyses
Several oligonucleotides
were chosen on the basis of the DNase I footprints (shown in Fig. 5) to further elucidate the precise location of the
DNA-protein interactions described in the previous paragraph. Gel
mobility shift assays were performed in which oligonucleotides
ASTM1F/R, ASTM2F/R, ASTM3F/R, ASTM4F/R, ASTM5F/R, and ASTM6F/R (Fig. 1C) were used to compete for the gel mobility
shifts produced when labeled fragment 7/8 was incubated with nuclear
extracts from Caco2, primary epididymis, and MCF7.
(lanes 1), 200 (lanes 2), and 500 (lanes 3) excess of
oligonucleotide ASTM2F/R and ASTM3F/R as marked. P denotes 7/8
probe only, and 0 denotes no competition. B, Caco2
nuclear extract and competition with 100 ASTM2F/R (lane
2), ASTM4F/R (lane 4), and ASTM5F/R (lane 5) as
marked. 0 denotes no competition. C, epididymis
nuclear extract and competition with 200 ASTM1F/R (lane
1), ASTM2F/R (lane 2), and ASTM3F/R (lane 3) as
marked. 0 denotes no competition. D, diagram to show
locations of oligonucleotides (1, 2, 3, 4, 5) and binding
sites of Caco2 and epididymis-specific proteins and non-cell
type-specific proteins to the 7/8 fragment.
Transient Expression Assays
Constructs containing
the 787-bp CFTR basal promoter fragment (designated 245) driving
luciferase expression with the 5/6, 7/8, or BS0.7 (IA1R-TSR8) fragments
cloned into the enhancer site of the PGL2B vector (3` to the CFTR
promoter) were co-transfected with pdolCMVcat (Ma et al.,
1992) into the cells lines Caco2, 16HBE14o-, and MCF7, and both
CAT and luciferase activities were assayed. The results of the
transfection experiments are shown in Fig. 7. Each experiment
included transfections that were carried out in quintuplicate in 60-mm
culture dishes. Luciferase values were corrected for transfection
efficiency based on CAT activities for each transfected dish. In each
experiment, controls were transfections with the pGL2B vector alone.
Luciferase activities were expressed as a fraction of that obtained
with the pGL2B+245 CFTR promoter element construct.
promoter alone, the 7/8 fragment augmented luciferase activity by a
mean of 2.2-fold (S.E.= 0.311) with respect to the CFTR promoter
alone. The BS0.7 fragment that encompasses the 750-bp fragment of the
putative regulatory element (see Fig. 1B, 1AIR-TSR8)
caused a mean amplification of luciferase activity of 3.4-fold
(S.E.= 0.350). An analysis of variance was performed on log
transformed data (to correct for non-normality) with experiment number
added to the model as a block to control for temporal variation. After
correcting the significance levels for multiple comparisons, the 7/8
and the BS0.7 elements were each seen to have significantly greater
activity than the 245 CFTR promoter element alone (p < 0.01
in both cases). However, the 5/6 element did not differ in activity
from the promoter alone (p > 0.3).
The 181+10kb Regulatory Element
The regulatory
element we have identified is located within a DNase I hypersensitive
site 10 kb into the first intron of the CFTR gene. This is the first
intronic regulatory element to be reported for the CFTR gene. Its
location may, in part, explain the failure of several groups to
elucidate the elements involved in regulating control of expression of
CFTR, because previous analyses of the CFTR promoter region have been
restricted to sequences 5` to and including the first exon. The
presence of a regulatory element in the first intron is not
unprecedented (Hines et al., 1988).
, although any
relevance to CFTR expression is obscure.Regulatory Proteins
Data from the gel mobility
shift and DNase I footprint experiments using the 7/8 fragment suggest
that there may be a complex of proteins binding within this region.
There are clearly one or more proteins that give rise to the gel
mobility shifts at positions c1 and c2. In addition to these proteins,
other proteins give rise to the unique gel mobility shifts that are
associated with CFTR-expressing cells: a1, seen in the colon carcinoma
cell lines, and those seen in the primary male genital duct epithelial
cells, a2, b1, and b2. The nature and identity of these proteins is
currently unclear. The results of oligonucleotide competition
experiments suggest that at least some of the proteins bind directly to
DNA.Transient Assays
In vitro transient assays of the
activity of the regulatory element (the BS0.7 fragment spanning the
181+10kb site) have shown that it augments the level of the CFTR
promoter-mediated expression of the luciferase reporter gene in the
Caco2 cell line by a mean of 3.4-fold in 30 independent transfections
(six experiments with five dishes of cells for each transfection).
Although this enhancement of expression might seem relatively modest,
this is not unexpected given the weak activity of the CFTR promoter in
driving reporter gene expression in transient assays (Chou et
al., 1991; Yoshimura et al., 1991b; Koh et al.,
1993). Moreover, the observed enhancement of expression is of the same
order of magnitude as has been observed for other regulatory elements
in the CFTR gene promoter (McDonald et al., 1995). It is
interesting that the 7/8 fragment shows a common gel mobility shift in
Caco2 and HT29 but a different shift profile with primary genital duct
epithelial cells. Both Caco2 and HT29 are colon carcinoma cell lines
that transcribe high levels of CFTR in culture. Although these cell
lines are not normal cells, it is likely that they arise from colonic
epithelial cells that do express significant amounts of CFTR in
vivo. This is in contrast to the 16HBE14o- cell line that is
derived from bronchial epithelium, which transcribes very low levels of
CFTR in vivo. Thus, high levels of CFTR expression in this
line are likely to be a consequence of the SV40 Ori-
transformation process. It remains possible that the element that we
have identified may be of importance in the expression of CFTR only in
specific epithelia such as the intestinal epithelium and male genital
duct epithelium.
)
We are grateful to Drs. Johanna Rommens and Lap-Chee
Tsui for providing cosmid cW44, Dr. Mike Gravenor for statistical
analyses, Dr. Angie Rizzino for the pdolCMVcat construct, Christina
Closken, Tom Caffrey, and Zahra Madgwick for technical assistance, Drs.
Douglas Higgs and Erick Denamur for helpful discussions, Prof. Chris
Higgins for critical reading of the manuscript, and Prof. Richard Moxon
for support.
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  Y. Xu, C. Liu, J. C. Clark, and J. A. Whitsett Functional Genomic Responses to Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) and CFTR{Delta}508 in the Lung J. Biol. Chem., April 21, 2006; 281(16): 11279 - 11291. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Rene, M. Taulan, F. Iral, J. Doudement, A. L'Honore, C. Gerbon, J. Demaille, M. Claustres, and M.-C. Romey Binding of serum response factor to cystic fibrosis transmembrane conductance regulator CArG-like elements, as a new potential CFTR transcriptional regulation pathway Nucleic Acids Res., September 16, 2005; 33(16): 5271 - 5290. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Sironi, G. Menozzi, G. P. Comi, R. Cagliani, N. Bresolin, and U. Pozzoli Analysis of intronic conserved elements indicates that functional complexity might represent a major source of negative selection on non-coding sequences Hum. Mol. Genet., September 1, 2005; 14(17): 2533 - 2546. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. M. Ulatowski, K. L. Whitmore, T. Romigh, A. S. VanderWyden, S. M. Satinover, and M. L. Drumm Strain-specific variants of the mouse Cftr promoter region reveal transcriptional regulatory elements Hum. Mol. Genet., September 1, 2004; 13(17): 1933 - 1941. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. K. Rowntree, G. Vassaux, T. L. McDowell, S. Howe, A. McGuigan, M. Phylactides, C. Huxley, and A. Harris An element in intron 1 of the CFTR gene augments intestinal expression in vivo Hum. Mol. Genet., July 1, 2001; 10(14): 1455 - 1464. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Davidson, M. S. Taylor, A. Doherty, A. C. Boyd, and D. J. Porteous Genomic Sequence Analysis of Fugu rubripes CFTR and Flanking Genes in a 60 kb Region Conserving Synteny with 800 kb of Human Chromosome 7 Genome Res., August 1, 2000; 10(8): 1194 - 1203. [Abstract] [Full Text]
|
|
|
|
 |
|
 M. Bertog, D. J. Smith, A. Bielfeld-Ackermann, J. Bassett, D. J. P. Ferguson, C. Korbmacher, and A. Harris Ovine male genital duct epithelial cells differentiate in vitro and express functional CFTR and ENaC Am J Physiol Cell Physiol, May 1, 2000; 278(5): C885 - C894. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.-C. Romey, N. Pallares-Ruiz, A. Mange, C. Mettling, R. Peytavi, J. Demaille, and M. Claustres A Naturally Occurring Sequence Variation That Creates a YY1 Element Is Associated with Increased Cystic Fibrosis Transmembrane Conductance Regulator Gene Expression J. Biol. Chem., February 4, 2000; 275(5): 3561 - 3567. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. E. Ellsworth, D. C. Jamison, J. W. Touchman, S. L. Chissoe, V. V. Braden Maduro, G. G. Bouffard, N. L. Dietrich, S. M. Beckstrom-Sternberg, L. M. Iyer, L. A. Weintraub, et al. Comparative genomic sequence analysis of the human and mouse cystic fibrosis transmembrane conductance regulator genes PNAS, February 1, 2000; 97(3): 1172 - 1177. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Li, L. Moy, N. Pittman, G. Shue, B. Aufiero, E. J. Neufeld, N. S. LeLeiko, and M. J. Walsh Transcriptional Repression of the Cystic Fibrosis Transmembrane Conductance Regulator Gene, Mediated by CCAAT Displacement Protein/cut Homolog, Is Associated with Histone Deacetylation J. Biol. Chem., March 19, 1999; 274(12): 7803 - 7815. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
