|
|
|
|||||||
|
|||||||||
(Received for publication, January 2, 1996; and in revised form, February 21, 1996) From the
malZ is a member of the mal regulon. It is
controlled by MalT, the transcriptional activator of the maltose
system. MalZ has been purified and identified as an enzyme hydrolyzing
maltotriose and longer maltodextrins to glucose and maltose. MalZ is
dispensable for growth on maltose or maltodextrins. Mutants lacking
amylomaltase (encoded by malQ), the major maltose utilizing
enzyme, cannot grow on maltose, maltotriose, or maltotetraose, despite
the fact that they contain an effective transport system and MalZ. From
such a malQ mutant a pseudorevertant was isolated that was
able to grow on maltose. The suppressor mutation was mapped in malZ. The mutant gene was cloned. It contained a Trp to Cys
exchange at position 292 of the deduced protein sequence. Surprisingly,
the purified mutant enzyme was still unable to hydrolyze maltose as was
the wild type enzyme, while both were able to release glucose from
maltodextrins. However, the mutant enzyme had gained the ability to
transfer dextrinyl moieties to glucose, maltose, and other
maltodextrins. Thus, it had gained an activity associated with
amylomaltase. It was the MalZ292-associated transferase reaction that
allowed the utilization of maltose. In addition, we discovered that
mutant and wild type enzymes alike were highly active as
The Escherichia coli maltose system (1, 2) contains two enzymes that are necessary for the
utilization of maltose and maltodextrins. Maltotriose, after having
been taken up by the high affinity and binding protein-dependent ABC
(ATP binding cassette) transport system (3) is recognized by
amylomaltase (encoded by malQ)(4) , the reducing end
glucose is released and the maltosyl residue is transferred to another
maltotriose molecule thus forming maltopentaose (5, 6) . The repetition of this cycle leads to the
formation of long maltodextrins and free glucose which, after
phosphorylation by glucokinase enters glycolysis. Maltopentaose and
longer maltodextrins are recognized by maltodextrin phosphorylase
(encoded by malP) (7, 8) which, by
phosphorolysis, releases the nonreducing end glucose as glucose
1-phosphate. Thus, the final products of maltodextrin metabolism by
these two enzymes are glucose and glucose 1-phosphate. The
degradation of maltose, the smallest member of maltodextrins, also
requires amylomaltase, and malQ mutants are
Mal There are two more enzymes,
members of the mal regulon, that are not essential for the
metabolism of maltose and small maltodextrins. One is a periplasmic
The endogenous formation of maltotriose required for maltose
utilization is also an important aspect of the regulation of the mal system. All mal genes are under the control of
MalT, the positive activator of the system(15) . In vitro MalT-dependent mal gene expression requires the presence
of maltotriose(16) . Cells growing in the presence of maltose
or any other maltodextrin will result in the elevated expression of the mal system even though only maltotriose is the effective
internal inducer. We have argued that the increased formation of
endogenous maltotriose during exogenous induction by maltodextrins is
driven by glucose and glucose 1-phosphate, the degradation products of
maltodextrin metabolism. This reaction is most likely catalyzed by
maltose/maltotriose phosphorylase, the same enzyme that is required for
the maltodextrin primer synthesis mentioned above(9) . In an
attempt to identify the postulated maltose/maltotriose phosphorylase,
we reasoned that the action of this enzyme should be reversible, and it
should therefore be able to split maltose to glucose and glucose
1-phosphate. Thus, malQ mutants which are Mal
Figure 1:
Cloning of malZ292. a, region of the E. coli chromosome around minute 9
of the genetic map that is cotransducible with the malQ
Figure 7:
The formation of linear maltodextrins,
labeled at the reducing end glucosyl residue. The reaction mixture
contained 100 mM maltotriose, 0.4 mM [
MalZ activity was assayed by
following the formation of p-nitrophenol from p-nitrophenyl maltoside (PNG2) as described
previously(14) . Units of enzymatic activity are given in
micromoles of PNG2 hydrolyzed per min at room temperature.
Figure 2:
SDS-polyacrylamide gel electrophoresis of
the different fractions in the purification of MalZ and MalZ292. Lane 1, molecular mass standards; lanes 2-5,
purification of MalZ292; lanes 6-9, purification of wild
type MalZ. Lanes 2 and 6, crude extracts of cells
that have undergone heat induction; lanes 3 and 7,
guanidinium HCl-insoluble pellet remaining after solubilization and
renaturation of inclusion bodies; lanes 4 and 8,
renatured protein after solubilization of inclusion bodies; lanes 5 and 9, homogeneous protein after Mono Q ion exchange
chromatography. Except for the pure protein, 10 µg of total protein
was applied on each lane. The gels consisted of 10% polyacrylamide and
were stained with Coomassie Blue.
Figure 3:
Hydrolysis of maltopentaose by wild type
MalZ and MalZ292 in the presence of trace amounts of
[
Figure 4:
The dextrinyl transfer reaction of
MalZ292. Unlabeled maltose (lanes 1 and 5),
maltotriose (lanes 2 and 6), maltotetraose (lanes
3 and 7), and maltopentaose (lanes 4 and 8) at concentrations corresponding to 20 mM glucosyl
residues were incubated with 10 µM [
When
[
Figure 5:
Hydrolysis of
Figure 6:
The
transfer reaction of MalZ292 with
When the mutant MalZ enzyme was used in
this assay, the amount of glucose released was significantly higher
with all maltodextrins tested. We interpret this as the consequence of
the maltodextrinyl transfer reaction associated with the mutant enzyme.
This would result in the transfer of dextrinyl moieties onto maltose
and subsequent release of glucose. This reaction is essentially the
reason why the malZ292 mutation in a malQ background
gives rise to maltose utilization.
These dextrins were synthesized by the
transferase reaction of amylomaltase. Unlabeled maltotriose (100
mM) was incubated with [
Figure 8:
Maltodextrins hydrolyzed by MalZ. Samples
of 0.08 µCi of maltotriose (lanes 5 and 7) and
maltotetraose (lanes 6 and 8),
Surprisingly, a malT
The malZ292 mutation was isolated as a second site Mal
The expression of the maltose system is controlled by the level of
maltotriose, the endogenous inducer. Obviously, maltotriose can be
produced and degraded by several enzymes. Thus, it is informative to
analyze the state of mal gene expression in several mutants in
the presence and absence of exogenous maltose. Expression was measured
by maltose transport activity (Table 4). The constitutivity of a malQ mutant is somewhat less in the presence of the malZ292 mutation while the presence of maltose in such a
strain increases the expression more than in a malZ
The finding that MalZ292 as well as the wild type MalZ enzyme is an
effective In this publication we report the mutational alteration (Trp
to Cys at position 292 of the polypeptide chain) of MalZ that results
in the effective utilization of maltose when present in a mutant that
lacks amylomaltase, the key enzyme of maltose utilization in E.
coli(1) . MalZ had previously been identified as an enzyme
cleaving glucose from the reducing end of maltodextrins with
maltotriose as the smallest substrate. The wild type MalZ enzyme is
apparently not involved in maltose utilization since mutants lacking malZ still grow normally on maltose and strains harboring the
wild type malZ gene but defective in malQ cannot grow
on maltose(29) . However, in pgm mutants which still
can grow on maltose(27) , the function of the malZ-encoded enzyme becomes apparent. Growth on maltose is
strongly reduced. Thus, MalZ increases the ratio of glucose over
glucose 1-phosphate, the immediate products of maltose utilization. The mutant enzyme MalZ292 still exhibits the same activity as the
wild type MalZ enzyme. Surprisingly, maltose itself was not hydrolyzed
by the mutant enzyme. The only difference that we could detect was the
ability of the mutant enzyme to transfer dextrinyl residues originating
from maltotriose and larger dextrins onto maltose. This indicates that
it is the transfer reaction onto maltose that allows maltose
utilization. The transfer reaction observed with the mutant MalZ enzyme
is reminiscent of the action of amylomaltase, the gene product of malQ. This enzyme will disproportionate any given maltodextrin
longer than maltose into glucose and a series of maltodextrins in such
a way that the number of glycosidic linkages will remain constant.
Thus, amylomaltase is exclusively a maltodextrin transferase but not a
hydrolase. For every glucose released (the apparent hydrolysis
reaction), it will form a new glycosidic linkage by producing a longer
dextrin. Even though the hydrolysis and the transfer reaction
observed with the mutant MalZ enzyme is formally the same as in
amylomaltase, there is still a basic difference between the two
enzymes. In the mutant MalZ, hydrolysis of glucose is not obligatorily
coupled to the transfer reaction, and net hydrolysis of maltodextrins
to glucose and maltose is still the predominant reaction. Nevertheless,
with a continuous supply of small amounts of dextrins (maltotriose and
larger), maltose can be degraded to glucose by the mutant MalZ enzyme.
This does not require the presence of an additional enzyme. In
contrast, when maltose is degraded to glucose by the
``normal'' amylomaltase-mediated pathway, aside from the
requirement of a maltodextrin primer, the action of maltodextrin
phosphorylase, the malP product, is needed to remove the
accumulation of longer dextrins (produced by amylomaltase) by producing
glucose 1-phosphate that enters glycolysis after
phosphoglucomutase-mediated transformation into glucose 6-phosphate. The properties of the mutant MalZ enzyme again necessitate
postulating an endogenous production of maltodextrins that can act as a
dextrinyl donor in the MalZ292-mediated utilization of maltose. In the malQ mutant, the major source of these dextrins including
maltotriose, the inducer of the system, is clearly
glycogen(9, 30) . However, also the pgm or
the pgm glgA derivative of the malQ malZ292 strain
can still grow on maltose. These strains do not contain detectable
glycogen and are not constitutive for the maltose system even though
they still can be induced by maltose. Thus, it is obvious that there
exists a second pathway for the synthesis of endogenous maltodextrins
that do not originate from glycogen. We have previously postulated the
existence of a maltose/maltotriose phosphorylase that would produce
maltose from glucose and glucose 1-phosphate and additionally
maltotriose from maltose and glucose 1-phosphate(9) . Since
phosphorylases are reversible, maltose plus phosphate would produce
glucose 1-phosphate which then could give rise to the synthesis of
small maltodextrins needed for the MalZ292-mediated maltose utilization
in the malQ mutant background. The observation that pgm mutants in this background exhibit an increased rate of maltose
utilization is consistent with this picture. Glucose 1-phosphate
produced from maltose (by the postulated maltose/maltotriose
phosphorylase) would not be removed by phosphoglucomutase (forming
glucose 6-phosphate followed by glycolysis). A testable prediction
would therefore be that malQ pgm mutants when exposed to
maltose will have an elevated level on glucose 1-phosphate even in the
absence of maltodextrin phosphorylase. Clearly, the postulated
maltose/maltotriose phosphorylase cannot be very active. Otherwise,
this enzyme alone should give rise to growth on maltose in the absence
of any other mal enzymes. In the course of this
investigation, we observed that the MalZ enzyme, wild type as well as
MalZ292 mutant, was able to hydrolyze
Volume 271,
Number 18,
Issue of May 3, 1996 pp. 10681-10689
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
-cyclodextrinases.
. However, amylomaltase does not recognize maltose
as glucosyl donor, only as maltodextrinyl acceptor(6) .
Therefore, in order to metabolize maltose, amylomaltase requires a
maltodextrin primer with the minimal size of maltotriose. Within the
cell, the required maltodextrin primer can originate from the
degradation of glycogen or from the action of an as yet uncharacterized
maltose/maltotriose phosphorylase with glucose and glucose 1-phosphate
as starting material(9) .
-amylase encoded by malS(10, 11) . This
enzyme hydrolyzes larger dextrins in the periplasm preferentially to
maltohexaose (12) which can then be transported by the
maltose/maltodextrin transport system. The other is a cytoplasmic
enzyme encoded by malZ(13, 14) whose
function in maltodextrin metabolism is unclear. The enzyme degrades
linear maltodextrins up to a chain length of 7 glucose units but not
maltose. It sequentially cleaves glucose from the reducing end of the
maltodextrin chain. Even though it can hydrolyze maltotriose to glucose
and maltose, malQ mutants cannot grow on maltotriose or
maltotetraose even when malZ is overexpressed(14) . should be able to grow again on maltose after a mutational event
resulting in the overproduction of the postulated maltose/maltotriose
phosphorylase. Among the phenotypic revertants in such a selection, we
found one mutation that did not map in malQ. In this paper, we
report the analysis of this second site revertant. We found that the
mutation had occurred in malZ. We cloned and sequenced the
mutant malZ (malZ292). We purified the encoded enzyme
and characterized its enzymatic activity. We present the explanation
for the ability of the mutant enzyme to support growth on maltose by
its acquisition to transfer dextrinyl residues to maltose, followed by
the consecutive hydrolysis of glucose from the transfer product.
Construction of Strains
Derivatives of E.
coli K12 strains were used throughout this study. They were
constructed by P1 vir transduction (17) and are listed in Table 1. To isolate the malZ292 mutation, strain HS3166,
a maltose constitutive malQ
mutant, was grown in
minimal medium A (MMA) (
)(17) containing 0.4%
glycerol. 2 
10
cells were plated on MMA with 0.2%
maltose. Colonies were tested for the reversion of the malQ mutation by transducing them with a P1
lysate prepared on POP4064 (HfrG6 malQ::Tn10).
Transductants were selected for tetracycline resistance
(Tet
) and screened for a Mal
phenotype.
DNA Methods
Chromosomal DNA was isolated as
described by Silhavy et al.(18) . Plasmid DNA was
prepared by the alkaline-SDS method according to Birnboim and
Doly(19) . Other standard recombinant DNA techniques are from
Sambrook et al.(20) .Construction of pRP100 and Derivatives
Chromosomal
DNA of SFC1 was digested with BamHI and PstI. The
10-14-kb fraction was eluted from an agarose gel and ligated into
pACYC177 that had been digested with the same enzymes. Strain RP90 was
transformed with this ligation mixture. Colonies were selected for
kanamycin resistance and screened for the ability to derepress alkaline
phosphatase on G + L medium (21) with 0.1 mM P
and 0.2% glucose as carbon source and 40 µg/ml
5-bromo-4-chloro-3-indolyl phosphate (X-P) as indicator for alkaline
phosphatase. All the clones which were able to derepress alkaline
phosphatase were also able to grow on MMA-plates containing 0.2%
maltose. One of these plasmids, pRP100, contained a chromosomal insert
of about 12 kb and was used for further studies. pRP102 was obtained by
deleting two MluI fragments (together 6 kb) from pRP100. For
the construction of pRP112, pRP102 was digested with SacII,
and the resulting fragments were blunt-ended with T4 polymerase. In a
second step these fragments were digested with MluI. A 2.1-kb MluI/SacII fragment was isolated and ligated in
pDHB32 that had been digested with MluI and PshAI.
The resulting plasmid pRP112 contained a 2.1-kb chromosomal fragment
encoding the entire mutant malZ292 gene (Fig. 1). For
the construction of pRP117, pRP112 was digested with HindIII
and SnaBI, and a 742-bp fragment containing the malZ292 mutation was eluted from an agarose-gel. Plasmid pST4 (14) was also digested with HindIII and SnaBI. The above 742-bp fragment was ligated in the opened
pST4 plasmid. After transformation of RP90 with the ligation mixture,
all clones were able to grow on MMA plates containing 0.2% maltose. The
construction of pRP118 and pRP119, the expression plasmids for malZ and malZ292, was done by polymerase chain reaction
technique using two primers (ACAGGGGACATATGATGTTAAATGC) and
(TTCGCTGGTACAGCGCG). A 1421-bp fragment of malZ was amplified
in this way using pRP112 as template. The amplified fragment was
digested with NdeI, and the resulting 1020-bp fragment was
ligated in the heat-inducible expression vector pCYTEP1(22) .
The correct orientation of the insert was confirmed by restriction
analysis. The 672-bp BglII/EcoRI fragment of this
vector was exchanged against a 1491-bp BglII/MunI
fragment from pRP112 or pRP114 completing malZ292 and malZ, respectively. pRP112 and pRP114 are equivalent with the
exception of the malZ292 mutation.
suppressor mutation. b, plasmid pRP100 that had been
selected for its ability to complement a phoB::Tn5 mutation and which carried the malZ292 mutation. c and d, subcloning of malZ292 for minimal size.
The letters above the lines show the restriction sites: B, BamHI; M, MluI; P, PstI, Ps, PshAI; S, SacII.
DNA Sequencing
To sequence the malZ and
the malZ292 genes, the plasmids pST4 and pRP112 were used.
Plasmid preparation was done with the Quiagen Kit (Diagen GmbH Hilden,
Germany). Double-stranded DNA was denatured (23) and sequenced
by the chain termination method (24) with the Sequenase kit (U.
S. Biochemical Co.) using seven primers obtained from the MWG-BIOTECH
Co.Purification of MalZ and MalZ292
Strain RP96
harboring either pRP118 or pRP119 was grown at 28 °C in 2 liters of
LB (17) to an optical density at 578 nm (A
) of 1. The culture was shifted to 42 °C
for 2 h, harvested by centrifugation, washed in 50 mM Hepes,
pH 7.0, and resuspended in 35 ml of the same buffer. The cells were
disrupted by one passage through a French pressure cell at 16,000
p.s.i. DNase was added followed by incubation for 30 min. Inclusion
bodies were collected by centrifugation (12,000 g for
10 min). The pellet was solubilized in 10 ml of 50 mM Hepes
containing 4 M guanidinium HCl and 200 mM dithiothreitol. The protein concentration was adjusted to 1 mg/ml
(total volume 100 ml) and put into a dialysis bag with 300 ml external
volume of the same buffer containing 4 M guanidinium HCl.
Renaturation was achieved by slowly (during 12 h) diluting the outside
dialysate with the 5-fold volume of MMA at 4 °C. Subsequently, the
protein solution was dialyzed twice against 2 liters of MMA overnight.
Remaining protein precipitate was removed by centrifugation (18,000
g for 30 min). The solution was precipitated with 40%
saturated (NH
)
SO and cleared by
centrifugation. The supernatant was precipitated with 60%
(NH)SO. The precipitate was
collected by centrifugation, dissolved in 50 mM sodium
phosphate buffer, pH 7.0, and dialyzed against the same buffer. The
protein was further purified in 2-ml portions by fast protein liquid
chromatography anion exchange column chromatography (Mono Q, Pharmacia
Biotech Inc.) in 50 mM sodium phosphate buffer, pH 7.0. The
column was eluted with 20 ml of a linear NaCl gradient (0-300
mM) in the same buffer.Transport of
[
Cultures were grown
logarithmically in MMA containing 0.4% glycerol as carbon source to an A
C]Maltose of 0.5. When indicated, 1 mM maltose
was added 2 h previously. The cultures were harvested, washed three
times with MMA, and resuspended in the same medium to an of A of 0.5 (glycerol-grown cultures) or 0.05
(maltose-induced cultures). To 3 ml of this suspension,
[C]maltose was added at room temperature
resulting in a final concentration of 52 nM. Samples (0.5 ml)
were withdrawn after different time intervals, filtered through
membrane filters (pore size 0.45 µm, Schleicher &
Schüll), and washed with 10 ml of MMA. The
radioactivity was determined in a liquid scintillation counter (Beckman
LS 1801). The rate of uptake was determined from the linear increase in
the accumulated radioactivity and is given as picomoles of substrate
taken up per 10
cells per min.Preparation of Labeled Maltodextrins
The reaction
mixture (250 µl of 50 mM Tris-HCl, pH 7.0) contained 100
mM maltotriose, 0.4 mM [C]glucose (5 µCi), and 0.5 mg of
protein of crude extract obtained from strain ME469 harboring plasmid
pCHAP113(4) . The strain had been grown in LB containing 0.1
mM isopropyl-1-thio-
-D-galactopyranoside. The
mixture was incubated at room temperature for 1 h and subsequently
heated in boiling water for 5 min. Under these conditions, the reaction
has reached equilibrium. The suspension was clarified by
centrifugation, and the supernatant was applied on Whatman 3MM paper
for descending chromatography with butanol:ethanol:water (5:3:2, v/v/v)
as solvent. After drying, the paper was autoradiographed for 24 h (Fig. 7). Paper stripes containing the radioactive compounds
were eluted with water and once rechromatographed with the same system.
The products were again identified by autoradiography, eluted with
water, and lyophilized. They were used in enzymatic digests without
further purification.
C]glucose (5 µCi), and 0.5 mg of crude
extract of a MalQ overproducing strain in 250 µl of 50 mM Tris-HCl, pH 7.0. After 1 h, the mixture was chromatographed by
descending paper chromatography on Whatman 3MM with
butanol:ethanol:water (5:3:2) as solvent. The figure represents a
portion of the autoradiogram with the formed radioactive substrates
indicated on the left.
Analytical Techniques
For testing the
MalZ-dependent hydrolysis products, purified MalZ or MalZ292
(approximately 60 µg/ml, final concentration) was incubated with
maltodextrins (in 50 mM sodium phosphate buffer, pH 7.0) at
room temperature for the time periods indicated. The standard assay was
carried out in 100 µl, containing maltodextrins at a final
concentration of 10 mM (maltose) to 3.3 mM (-cyclodextrin). For testing the transfer reaction, the
maltodextrin substrates (10 mM) were mixed with either
[C]maltose or with
[C]glucose at a final concentration of 10.4
µM ([C]maltose) or 25.4 µM ([C]glucose). At the time points indicated,
10 µl were applied on thin layer chromatography (TLC) plates
(Kieselgel 60; Merck) and developed overnight in butanol:ethanol:water
(5:3:2,v/v/v) or in 1-propanol:ethyl acetate:water (3:2:2, v/v/v).
After drying, the TLC plates were autoradiographed, with times of
exposure ranging from 4 days to 2 weeks. The unlabeled oligosaccharide
spots were visualized by dipping the plate in methanol containing 2%
concentrated HSO followed by drying and
charring for 10 min at 170 °C.
Isolation of a Pseudorevertant from a malQ
malQ mutants are defective in amylomaltase
and cannot grow on maltose. In addition, when grown on a different
carbon source, they are sensitive to maltose. We plated the malQ Mutant mutant HS3166 on minimal maltose plates and
selected for growth. Phenotypic revertants could easily be obtained. To
screen for those that were not true revertants in malQ, we
transduced them to Tet with a P1 lysate obtained from a malQ::Tn10 strain. Most of the Mal revertants became again Mal indicating that
these Mal revertants were indeed true revertants. One
strain, named SFC1, remained Mal after the
introduction of malQ::Tn10 and was considered
further. Using the collection of P1 lysates of mapped Tn10 insertions (25) , we found that the second site reversion
had occurred near the region of minute 9 on the chromosome. A P1
transduction using the phoB::Tn5 mutant BW10320 as
donor and tetracycline resistance as selection revealed that the
Mal phenotype was linked to phoB (78%
cotransduction frequency). This raised the possibility that the
Mal phenotype was caused by a mutation in malZ, a mal gene located next to phoB(26) .Cloning and Sequencing the Mutated malZ Gene
The
high cotransduction frequency between the second site mal mutation in SFC1 and phoB::Tn5 prompted us to use the latter as selection
to clone the gene in which the mutation had occurred. Chromosomal DNA
of SFC1 was digested and ligated into plasmid pACYC177. The phoB::Tn5 derivative of strain HS3166 (malQ) was transformed with the ligation mixture.
Colonies were selected for resistance against kanamycin, and the
ability to derepress alkaline phosphatase was screened. All these
clones were able to grow on maltose. pRP100, the plasmid in one of
these clones, contained a chromosomal insert of about 12 kb. With the
assumption that the gene in question was malZ, we cloned a
2.1-kb MluI/SacII fragment containing malZ in pDHB32 yielding pRP112 (Fig. 1). This plasmid still
carried the mal second site mutation but was
no longer able to complement a phoB mutation. The insert was
sequenced in its entire length and verified the identity of its open
reading frame as MalZ. The mutant gene contained a G to T exchange in
comparison to the wild type malZ sequence resulting in the
exchange of Trp to Cys at position 292 of the MalZ polypeptide chain. ()Purification of Mutant and Wild Type MalZ
Proteins
In order to study the enzymatic properties of the
mutant MalZ enzyme free of activities that might be caused by other
maltodextrin-hydrolyzing activities, the purification of the mutant and
wild type MalZ was necessary. For this purpose, malZ and malZ292 were cloned into the plasmid pCYTEXP1 (22) allowing the expression of both genes under
temperature-sensitive 
repressor control. In both cases, induction
resulted in the formation of inclusion bodies. This material was
isolated by differential centrifugation followed by solubilization in 4 M guanidinium HCl. Renaturation was achieved by slow dilution
in phosphate buffer. Gel electrophoretically homogeneous protein was
obtained by anion exchange chromatography in a Mono Q column. The
analysis of the different purification steps by SDS-polyacrylamide gel
electrophoresis is shown in Fig. 2. All tests were done with
protein purified in this manner. To ensure that the observed properties
were not due to the denaturation-renaturation treatment, the key
experiments (transfer reaction, cyclodextrinase activity) were repeated
with crude extract containing soluble native MalZ as well as MalZ292.
No differences to the preparation obtained from inclusion bodies were
observed.
MalZ292 Is Not Only a Hydrolase as the Wild Type MalZ but
Also a Transferase
From the isolation of the malZ292
mutation as a phenotypic Mal revertant of a malQ mutant, it seemed likely that the MalZ
mutant enzyme would have acquired the ability to hydrolyze maltose, a
property that is absent in the wild type MalZ enzyme. However, maltose
was not hydrolyzed by MalZ292 even after long incubation times (data
not shown). Maltopentaose was hydrolyzed (mainly to glucose and
maltose) by the wild type as well as the mutant enzyme (Fig. 3A). However, the presence of trace amounts of C-labeled glucose or C-labeled maltose in the
hydrolysis mixture revealed that the mutant MalZ enzyme was able to
transfer dextrinyl residues onto the labeled glucose and maltose while
the wild type enzyme was not, or only to a minor extent (Fig. 3B). Most significantly, C label
originally contained in maltose was released as
[C]glucose during the experiment. In the attempt
to detect the initial transfer product arising with the mutant enzyme,
we tested maltose, maltotriose, maltotetraose, and maltopentaose as
glucosyl donors with C-labeled glucose or C-labeled maltose as acceptors (Fig. 4). As
expected, maltose was not used as a glucosyl donor. When
[C]glucose was the acceptor and unlabeled
maltotriose the donor, the initial labeled product was
[C]maltotriose, whereas, with unlabeled tetraose
as donor, [C]tetraose was formed as initial
product. This demonstrated that dextrinyl transfer onto
[C]glucose occurred after the enzymatic release
of the reducing glucose moiety from the donor maltodextrin.
C]glucose or [C]maltose,
demonstration of the transfer reaction. Unlabeled maltopentaose (10
mM), [C]glucose (25 µM),
or [C]maltose (10 µM) was incubated
in 50 mM sodium phosphate buffer, pH 7.0, with 2 µg of
pure protein. The assay volume was 30 µl. Samples of 10 µl were
spotted on TLC plates 2, 10, and 30 min after the addition of the
enzyme. Lanes 1-3, wild type MalZ with
[C]glucose; lanes 4-6, wild type
MalZ with [C]maltose. Lanes
14-16, MalZ292 with [C]glucose; lanes 15-19, MalZ292 with
[C]maltose. Lanes 7-11, sugar
standards as indicated on the left. The TLC plate was
developed with butanol:ethanol:water (5:3:2). A, chemical
detection by charring with sulfuric acid; B, autoradiography
prior to charring.
C]maltose (lanes 1-4) or 20
µM [C]glucose (lanes
5-8) in 15 µl of 50 mM sodium phosphate, pH
7.0, with 1 µg of pure MalZ292 for 2 min. 10 µl were spotted
onto a TLC plate and developed with butanol:ethanol:water (5:3:2). A, chemical detection by charring with sulfuric acid; B, autoradiography prior to
charring.
C]maltose was used as acceptor, the first
products to appear with maltotriose as donor were
[C]maltotetraose as well as
[C]maltotriose. With maltotetraose as donor,
[C]maltopentaose as well as
[C]maltotetraose appeared as first products.
This is consistent with the mechanism of transfer onto
[C]glucose mentioned above. Dextrinyl transfer
onto [C]maltose at the nonreducing end would
occur after the enzymatic release of the reducing end glucose moiety of
the donor. This first product will thus contain two consecutive C-labeled glucose residues at the reducing end. This
product itself is a good substrate of MalZ and will lead to the quick
release of [C]glucose as well as a C-labeled dextrin that is smaller by one glucose moiety.
With unlabeled pentaose as donor, the results are less clear since the
products formed were not sufficiently separated by the TLC technique.
It is noteworthy to emphasize that the MalZ292 enzyme, aside from its
increased activity as a dextrinyl transferase, still shows the same
activity as the wild type enzyme in its function as a maltodextrin
glucosidase, i.e. in the net formation of glucose from
maltodextrins.MalZ Is a
In our previous
publication on the properties of MalZ, we reported that the enzyme only
hydrolyzed linear maltodextrins up to seven glucose residues in chain
length. The two cyclodextrins tested, -Cyclodextrinase- and -cyclodextrin
with a length of six and seven glucosyl residues, were not
hydrolyzed(14) . In testing the substrate specificity of the
mutant MalZ enzyme, we found that it readily hydrolyzed
-cyclodextrin (containing eight glucosyl residues) and to a very
minor extent -cyclodextrin but not -cyclodextrin. The same
was true for the wild type MalZ enzyme (Fig. 5). Following the
time-dependent appearance of the products, we first observed the
formation of linear maltooctaose, followed by linear maltoheptaose. The
same products and not the starting material (-cyclodextrin) became
labeled from the trace amounts of [C]glucose
present as acceptor. Only after some time, glucose, maltose, and small
amounts of maltotriose became labeled (Fig. 6). Apparently
linear maltooctaose and maltoheptaose are rather poor substrates. Only
after the removal of glucose or maltose moieties from the reducing end
of these dextrins does the subsequent hydrolysis proceed rapidly.
Again, the transfer reaction occurred in significant amounts only when
the mutant MalZ292 enzyme was used but not with the wild type MalZ
enzyme (data not shown). We conclude that the hydrolysis of
-cyclodextrin by the mutant as well as the wild type enzyme occurs
by opening the ring followed by the consecutive release of glucose or
maltose from the reducing end of the linear dextrin finally yielding
glucose and maltose.
-, -, and
-cyclodextrin by MalZ and MalZ292. The equivalent of 20 mM glucosyl residues of -, -, and -cyclodextrin in 15
µl of 50 mM sodium phosphate buffer, pH 7.5, was incubated
with 1 µg of pure MalZ enzyme. After 150 min, 10 µl were
spotted onto a TLC plate and developed with butanol:ethanol:water
(5:3:2) followed by chemical detection with charring. Lanes
1-3, controls of glucose, maltose, and maltotriose; lanes 12-15, controls of -, -, and
-cyclodextrin as well as pullulan. Lanes 4-6 and 8-10, assays with -, -, and
-cyclodextrin; lanes 7 and 11, assays with
pullulan. Lanes 4-7, incubation with wild type MalZ; lanes 8-11, incubation with
MalZ292.
-cyclodextrin as substrate and
[C]glucose as acceptor. 80 µl of 50 mM sodium phosphate buffer, pH 7.0, containing 3 mM -cyclodextrin and 25 µM glucose was incubated
with 5 µg of pure MalZ292. 10-µl samples were removed at 1, 5,
10, 20, 40, and 80 min (lanes 2-7) and spotted onto a
TLC plate. The following controls were applied: lane 1,
glucose; lane 8, linear maltoheptaose; lane 9, linear
maltohexaose. The plate was developed with 1-propanol:ethyl
acetate:water (3:2:2, v/v/v) followed by chemical detection with
charring in the presence of sulfuric acid. Lanes 10-15,
autoradiogram of lanes 2-7 prior to charring. Lanes
16 and 17, control [C]glucose and
[C]maltose. Note that the position of the large
radioactively labeled compounds at the earlier time points is not
identical with -cyclodextrin, the starting
material.
Determination of Glucose after MalZ-dependent Hydrolysis
of Maltodextrins
The qualitative appearance on TLC plates of
about equimolar amounts of glucose and maltose after the hydrolysis of
-cyclodextrin, obviously incompatible with a consecutive release
of glucose residues after opening the circular dextrin, prompted us to
reanalyze the amount of glucose released from different dextrins after
end point hydrolysis with the MalZ enzyme. These data are shown in Table 2. A consecutive hydrolysis of glucosyl residues from the
reducing end of the maltodextrins would result in the liberation of 1,
2, 3, and so forth glucose from maltotriose, maltotetraose,
maltopentaose, and so on. Whereas maltotriose and small dextrins
followed this pattern, from increasingly longer dextrins too little
glucose was released. With heptaose as substrate instead of 5 eq of
glucose, only three were released. From -cyclodextrin instead of
six glucose molecules, only four were released. Thus, it was likely
that MalZ not only liberates glucose but also maltose or maltotriose
from longer maltodextrins.
Hydrolysis of Maltotriose and Maltotetraose
In
our previous publication on the mechanism of the MalZ enzyme, we had
concluded that the enzyme is a glucosidase releasing glucose
consecutively from the reducing end of maltodextrins(14) . We
showed that maltotriose C-labeled at the Reducing End Glucose ResidueC-labeled exclusively at the
reducing end glucose molecule yielded only C-labeled
glucose but not C-labeled maltose upon treatment with the
MalZ enzyme. We repeated these experiments now not only with
maltotriose but also with maltotetraose C-labeled only in
the reducing end molecule.C]glucose (0.4
mM) and amylomaltase. The products formed were separated by
paper chromatography, and the results are shown in Fig. 7.
According to the established mechanism of amylomaltase
action(6) , these sugars are labeled exclusively in the
reducing end glucose residue. After rechromatography, maltotriose and
maltotetraose were used in the MalZ-dependent hydrolysis reaction. The
results are shown in Fig. 8. We now conclude that from
maltodextrins longer than maltotriose not only glucose but also maltose
can be released to a small extent.
C-labeled
exclusively in the reducing end glucose residue, were incubated in 10
µl of 50 mM sodium phosphate buffer, pH 7.0, with 1 µg
of wild type MalZ (lanes 5 and 6) or MalZ292 (lanes 7 and 8) for 60 min prior to TLC
chromatography (butanol:ethanol:water (5:3:2) and autoradiography. Lanes 1-4, controls of C-labeled glucose,
maltose, maltotriose, and maltotetraose.
MalZ292-dependent in Vivo Maltose Utilization Occurs in
the Absence of Amylomaltase and Maltodextrin Phosphorylase
The
properties of the MalZ292 enzyme suggested that the utilization of
maltose as carbon source would, aside from the requirement of a dextrin
primer, not necessitate the presence of an additional enzyme. Thus, in
a net reaction, glucose would be formed from maltose by MalZ292. It was
therefore necessary to demonstrate that MalZ292 would allow growth on
maltose in the absence of amylomaltase (the malQ-encoded
enzyme) and maltodextrin phosphorylase (the malP-encoded
enzyme).malP::Tn10 mutant (strain RP97) lacking maltodextrin
phosphorylase and (by the polar effect of the Tn10 insertion
on malQ) also amylomaltase and carrying malZ292 as a
chromosomal mutation utilized maltose much better than strain RP98 (malTmalQ::Tn10
malP) with malZ292 as a chromosomal
mutation. Careful analysis with the purest available maltose (Merck)
revealed that strain RP98 only grew overnight to an A of about 0.3-0.5. After a long incubation time (between an
additional 10 and 20 h), growth resumed but was due to malQ reversions. In contrast, strain RP97 (malP::Tn10 malQ malZ292) grew well and was fully
outgrown overnight on the same purest maltose preparation (Merck). In
addition, the sterile filtered spent medium of strain RP98 (malQ::Tn10 malPmalZ292),
harvested at a time when growth had stopped at A of 0.4, allowed full growth of strain RP97 (malP::Tn10 malQ malZ292). As tested by TLC, the
spent medium still contained large amounts of maltose. This indicates
that endogenously produced maltodextrin needed for the MalZ292-mediated
utilization of maltose will be partially eliminated by maltodextrin
phosphorylase. Apparently less pure maltose preparations contain small
quantities of maltodextrins allowing the MalZ292-mediated utilization
of maltose even in the presence of maltodextrin phosphorylase.Lack of Phosphoglucomutase (Encoded by pgm) Does Not
Prevent MalZ292-dependent Utilization of Maltose
We found that
the introduction of a pgm mutation (lacking
phosphoglucomutase) into a malQ malZ292 strain (RP91) did not
prevent the utilization of maltose; under these conditions, malP encoding maltodextrin phosphorylase no
longer prevented growth in the pgm mutant even on pure
maltose. This again demonstrated firstly that in contrast to the
amylomaltase/maltodextrin phosphorylase-mediated pathway the
``usable glucose unit'' produced from maltose in the malZ292 mutant was not glucose 1-phosphate but glucose.
Secondly, it showed that the inability to utilize glucose 1-phosphate
via phosphoglucomutase counteracted the maltodextrin-degrading activity
of maltodextrin phosphorylase. Possibly, maltodextrin phosphorylase
under conditions of excess glucose 1-phosphate even catalyzes the
reverse reaction, the synthesis of maltodextrins. revertant from a malQ mutant but obviously not on pure
maltose. We determined the growth rate of the malQ malZ292 mutant on maltose in comparison to a malQ malZ strain. While the malZ strain did not
grow at all, we did notice that the malZ292 derivative grew on
maltose at different growth rates depending on the brand of maltose
that was used as carbon source (Table 3). The introduction of a pgm mutation lacking phosphoglucomutase activity, abolished
the difference in the growth rates between the pure and less pure
maltose and allowed reasonable growth rates and final cell densities in
both cases (Table 3). It was somewhat surprising that the rate of
growth on maltose in a malQ malP pgm malZ292 strain (RP93) was
dependent on the copy number of the malZ292 gene, the rate of
growth becoming considerably higher when malZ292 was
plasmid-encoded than when chromosomally encoded.
The MalZ292-mediated Utilization of Galactose in a pgm
Mutant Requires the Presence of malP-encoded Maltodextrin
Phosphorylase
Recently we had concluded that growth on galactose
in a pgm mutant (27) required the presence of all
maltose utilizing enzymes, MalP, MalQ, and MalZ. Mutations in any of
the genes encoding these enzymes abolished the ability to grow on
galactose and to develop the galactose blue phenotype(9) . It
was therefore of interest whether or not the malZ292 mutation
in a malQ pgm mutant would allow growth on galactose. Strain
RP91 (malZ292 malQ pgm) could still grow on
galactose, albeit slowly. However, RP99 (malQ malP pgm)
harboring plasmid-encoded malZ292 (pRP117) did not grow at all
on galactose. Thus, the formation of maltodextrins from the
galactose-derived glucose 1-phosphate (via the postulated
maltose/maltotriose phosphorylase involved in inducer synthesis) and
their subsequent degradation to glucose by the MalZ292 enzyme is too
slow to support growth on galactose. We therefore conclude that
galactose utilization in a malZ292 pgm mutant appears
to require maltodextrin phosphorylase, the malP gene product,
whereas maltose utilization via MalZ292 does not.The Glycogen-derived Production of Maltodextrins Is Not
Essential for the MalZ292-dependent Utilization of Maltose
The
introduction of a glgA mutation that prevents glycogen
formation did not alter the ability of the malQ pgm malZ292
mutant to grow on maltose (strain RP93). This demonstrates once again
that aside from the glycogen-dependent pathway a second origin of
maltodextrins needed as primers for the MalZ292-dependent maltose
utilization must exist. Since malQ pgm or malQ pgm glgA strains are no longer constitutive for the expression of the
maltose system (see Table 4), the endogenous synthesis of
maltotriose (in the absence of external maltose) must be slow. It is
certainly slower than the production of maltotriose from glycogen.
strain (SFC1 versus HS3166). As expected, the
introduction of a glgC or a pgm mutation in SFC1
abolishes the constitutive expression, but does not prevent induction
by exogenous maltose.MalZ292 Reduces the Growth-inhibitory Effect of Maltose
in a malQ Mutant
Another phenotype associated with the malZ292 mutation is its protective function against the growth
inhibition by maltose in a malQ mutant. It has been known for
a long time that growth of malQ mutants is sensitive to
maltose(28) . This can easily be observed on McConkey or EMB
indicator plates containing maltose. Under these conditions,
Mal mutants arise frequently that shut off the influx
of maltose by the acquisition of either malK or malT mutations(1) . This maltose-sensitive phenotype largely
disappears when the malQ mutant also carries the malZ292 mutation.The Lack of the MalZ Enzyme Exhibits a Maltose Phenotype
Only in pgm Mutants Lacking Phosphoglucomutase
Up to now, no
maltose phenotype has been associated with the lack of the MalZ enzyme
in an otherwise wild type strain. The function of this enzyme only
becomes apparent in a pgm mutant. There, of the two final
products of maltodextrin metabolism, glucose and glucose-1-phosphate,
only glucose can be used as carbon source. The pgm mutant
(strain RP101) can still grow on maltose. However, the combination of a malZ and a pgm mutation results in strongly reduced
growth on maltose. Obviously, the function of MalZ is to increase the
proportion of glucose in the final products of maltose utilization. -cyclodextrinase raised the question whether or not this
activity is of physiological significance. Strain MC4100, our control
strain as a standard laboratory Mal strain, cannot
grow on -cyclodextrin.
-cyclodextrin, but not
-cyclodextrin, and -cyclodextrin only to a minor extent.
Several cyclo-maltodextrinases have been isolated in the past and
identified as a special type of maltodextrin hydrolase. They exhibit
molecular weights of 66,000-72,000 and differ from
-amylases, to which they exhibit sequence homology (including
their conserved motifs), by their weak activity in hydrolyzing starch.
Generally, they exhibit transglycosylating activity and some of them
are pullulanases hydrolyzing an -(1
6)
linkage(31, 32, 33) . MalZ, even though
exhibiting -cyclodextrinase activity, carries latent
transglycosylating activity that becomes prominent only after mutation.
We could not detect any hydrolyzing activity on pullulan consistent
with the claim that E. coli does not contain pullulanase (34) . At present, the physiological role, if any, of the
-cyclodextrinase activity of MalZ is unclear. E. coli is
unable to transport or to grow on -cyclodextrin.
))
entry under the accession number
X59839[GenBank].
We are indebted to Bob Doebele who did the mapping of
the malQ suppressor mutation. We thank Regine
Hengge-Aronis, Nancy Kleckner, Tony Pugsley, and Barry Wanner for
bacterial strains and plasmids and August Böck for
helpful discussions.
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  M. R. Stam, E. G.J. Danchin, C. Rancurel, P. M. Coutinho, and B. Henrissat Dividing the large glycoside hydrolase family 13 into subfamilies: towards improved functional annotations of {alpha}-amylase-related proteins Protein Eng. Des. Sel., December 1, 2006; 19(12): 555 - 562. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Dippel and W. Boos The Maltodextrin System of Escherichia coli: Metabolism and Transport J. Bacteriol., December 15, 2005; 187(24): 8322 - 8331. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. K. B. Berlyn Linkage Map of Escherichia coli K-12, Edition 10: The Traditional Map Microbiol. Mol. Biol. Rev., September 1, 1998; 62(3): 814 - 984. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Pajatsch, M. Gerhart, R. Peist, R. Horlacher, W. Boos, and A. Böck The Periplasmic Cyclodextrin Binding Protein CymE from Klebsiella oxytoca and Its Role in Maltodextrin and Cyclodextrin Transport J. Bacteriol., May 15, 1998; 180(10): 2630 - 2635. [Abstract] [Full Text]
|
|
|
|
|
|
W. Boos and H. Shuman Maltose/Maltodextrin System of Escherichia coli: Transport, Metabolism, and Regulation Microbiol. Mol. Biol. Rev., March 1, 1998; 62(1): 204 - 229. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |