|
Volume 271,
Number 18,
Issue of May 3, 1996 pp. 10910-10916
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
Vitamin
D Receptors Repress Basal Transcription and Exert Dominant Negative
Activity on Triiodothyronine-mediated Transcriptional Activity (*)
(Received for publication, November 6, 1995; and in revised form, January
10, 1996)
Paul M.
Yen (§), ,
Ying
Liu,
Akira
Sugawara
(1),
William W.
Chin
From the Division of Genetics, Department of Medicine, Brigham and
Women's Hospital, and Harvard Medical School, Boston,
Massachusetts 02115 2nd Department of Internal Medicine,
Tohoku University, Sendai 980, Japan
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
We have examined vitamin D receptor (VDR), thyroid hormone
receptor (TR), and retinoid X receptor (RXR ) binding to
vitamin D response elements (VDREs), two thyroid hormone response
elements (TREs) (DR4 and F2), and a retinoic acid response element
(DR5). VDR/RXR bound well to the VDREs and to DR4 and DR5 using the
electrophoretic mobility shift assay. Surprisingly, VDR/RXR also bound
well to F2, which contains half-sites arranged as an inverted
palindrome. In co-transfection experiments using CV-1 cells, we
observed that VDR repressed basal transcription in the absence of
ligand on DR3 and osteopontin VDREs and F2, but had no effect on DR4 or
DR5. VDR selectively mediated ligand-dependent transcription on only
VDREs. VDR also exhibited dominant negative activity as it blocked
triiodothyronine (T )-mediated transcriptional activity on
DR4 and F2. These results demonstrate that VDR/RXR heterodimers can
bind promiscuously to a wide range of hormone response elements,
including inverted palindromes. Moreover, they show that unliganded
VDRs, similar to TRs and retinoic acid receptors, can repress basal
transcription. Last, they also suggest a novel repressor function of
VDR on T -mediated transcription which may be significant in
tissues where VDR and TR are co-expressed.
INTRODUCTION
Thyroid hormone receptors (TRs) ( )transactivate
hormone response elements (HREs) that contain different half-site
orientations: palindromes, inverted palindromes, and direct repeats
(DRs)(2, 3) . Studies on the spacing of half-sites
arranged as DRs have shown that TRs preferentially mediate
ligand-dependent transactivation via a DR with a four-nucleotide gap
(DR4), whereas vitamin D receptors (VDRs) and retinoic acid receptors
(RARs) transactivate via DRs with three- and five-nucleotide gaps,
respectively (DR3 and DR5)(2, 4) . The transcriptional
specificity for these receptors is thought to depend upon optimal
heterodimerization by these receptors with retinoid X receptors (RXRs)
on these hormone response elements(2, 4) . In
general, nuclear hormone receptor binding to HREs correlates well with
transcriptional activity, although there are examples of promiscuous
receptor binding with variable effects on transcription. In particular,
TRs can bind to direct repeats and inverted palindromes containing
variable spacing(5, 6, 7, 8) .
TR/RXR heterodimers also can bind to the palindromic vitellogenin
estrogen response element, but have weak transcriptional activity via
this element(9, 10) . Additionally, TR and RAR can
bind to the palindromic HRE, TREpal, and the rat growth hormone HRE,
and both T and retinoic acid can co-regulate transcription
via these elements(11, 12, 13, 14) .
It is likely that heterodimerization with RXR facilitates TR binding to
these HREs. Although not studied extensively, it is possible that
VDR/RXR heterodimerization also may promote similar promiscuous binding
by VDR. Recently, Schrader et al.(1) demonstrated
that VDR and TR could form heterodimers on the mouse and rat calbindin
HREs which are arranged as DR3 and DR4, respectively. Through
cross-linking studies, they demonstrated that VDR/TR dimers have a 5`
to 3` polarity on these elements similar to that described for TR/RXR
and RAR/RXR heterodimers. In particular, on the rat calbindin HRE
(DR3), VDR bound to the downstream half-site whereas in the mouse
calbindin HRE (DR4), TR bound to the downsteam half-site. Moreover,
both vitamin D and T could co-regulate transcription via
these elements. The demonstration of VDR:TR cross-talk is significant
as it suggests that VDR may modulate T -mediated
transcription in target genes in cells that express both receptors such
as bone, gut, and skin. In order to understand further potential
interactions between TR and VDR, we have studied the DNA binding and
transcriptional activity of TR and VDR complexes on different HREs. We
report that VDR can bind promiscuously to DR4 and DR5 HREs as well as
the chicken lysozyme thyroid hormone response element (TRE), F2 (which
contains two half-sites arranged as an inverted
palindrome)(15) . In co-transfection studies, VDR did not
mediate ligand-dependent transcription via reporter plasmid containing
these HREs although unliganded VDR could repress basal transcription
via DR3, osteopontin VDRE, and F2. Interestingly, VDR also could block
T -mediated transcriptional activation on DR4- and
F2-containing reporter plasmids. These findings suggest that, similar
to TRs and RARs, VDRs can repress basal transcription. Furthermore,
VDRs may have an important modulatory role in T -mediated
transcription.
MATERIALS AND METHODS
Preparation of Vectors and in Vitro Mutagenesis of
VDRpSG expression vectors encoding chick TR (kind gift of
Dr. D. Barettino, Heidelberg University, Germany) and human VDR (kind
gift of Dr. W. Hunziker, Hoffman-La Roche, Basel, Switzerland) and
human RXR in pCDNA were used in these
studies(1, 16) . An expression vector for GAL4-mouse
RXR which encodes the GAL4 DNA-binding domain and the RXR
ligand-binding domain from amino acids 209-448 in pAB as well as
GAL4 in pAB also were used in some experiments (17) (kind gift
of Dr. Ming-Jer Tsai, Baylor University). Oligonucleotides containing
DR4 and F2 (AGCTACTTATTGAGGTCACATGAGGTCAAGTTACG,
AGCTTATTGACCCCAGCTGAGGTCAAGTTACG) have been described
previously(18, 19) . DR3 and DR5
(AGCTTACTTATTGAGGTCACTGAGGTCAAGTTACG,
AGCTACTTATTGAGGTCACACTGAGGTCAAGTTACG) contain nucleotide gaps of 3 and
5 nucleotides, respectively, but are otherwise identical with DR4
(contain the consensus half-site sequence AGGTCA arranged as a direct
repeat, flanked upstream and downstream by F2 sequences). An
oligonucleotide containing the GAL4 binding site: upstream activating
sequence, a previously described 17-base pair sequence(20) ,
also was used. Each of these oligonucleotides as well as the mouse
osteopontin HRE (imperfect DR3 with half-site sequence AGTTCA) (21) contained BamHI and EcoRI restriction
sites on either end and were subcloned in the reporter vector, PT109 (22) which contains a viral thymidine kinase promoter and the
firefly luciferase cDNA, as described previously. Clones were isolated,
sequenced, and maxiprepped by affinity chromatography (Qiagen) before
used in transfections.The method for preparation of the VDR
DNA-binding mutant, DBD , is similar to the method that we
have used previously(23, 24) . Briefly, mutagenesis of
human VDR in pSG was performed using 30-base pair mutagenic
oligonucleotide and restriction site oligonucleotide according to the
manufacturer's instructions (Clontech). Final constructs were
sequenced to verify mutations. DBD contains a single
nucleotide change in the codon for the fourth coordinating cysteine
(resulting in Cys to Ser change) of the first zinc finger of the
DNA-binding domain which has been shown previously to be important for
TR binding to TREs(24, 25) .
Preparation of in Vitro Translated ReceptorscDNA
clones of TR, VDR, RXR , and DBD described above were
used in these assays. Unlabeled and
[ S]methionine-labeled receptors were produced
from rabbit reticulocyte lysates using expression vectors encoding
these cDNAs according to the manufacturer's instructions
(Promega). Unprogrammed reticulocyte lysate also was incubated under
the same conditions. [ S]Methionine-labeled
receptor protein was quantitated by SDS-polyacrylamide gel
electrophoresis analysis which showed labeled proteins of expected
molecular weights.
DNA Binding Assay/Electrophoretic Mobility Shift Assay
(EMSA)Deoxyribonucleotides containing F2, DR3, DR4, DR5, and
osteopontin HREs were end-labeled with
[ - P]ATP by T polynucleotide
kinase. The labeled oligonucleotide was gel-purified and stored as
described previously(26) .In vitro translated
receptor and 10,000 cpm of oligonucleotide probe were mixed and
incubated together before being subjected to electrophoresis and
autoradiography as described previously(26) .
Co-transfection StudiescDNA clones of TR ,
VDR, or DBD described above were used in the
co-transfection experiments. Reporter plasmids containing the F2, DR3,
DR4, DR5, or osteopontin HREs and the luciferase cDNA in PT109
described above were used.CV-1 cells were grown in Dulbecco's
modified Eagle's medium, 10% fetal calf serum. The serum was
stripped of T and vitamin D by incubating with charcoal for
12 h at 4 °C, and constant mixing with 5% (w/v) AG1-X8 resin
(Bio-Rad) twice for 12 h at 4 °C before ultrafiltration. The cells
were transfected with expression (0.1 µg) and reporter (2 µg)
plasmids as well as a Rous sarcoma virus- -galactosidase control
plasmid (1 µg) (27) in 3.5-cm plates using the
calcium-phosphate precipitation method(28) . Cells were grown
for 48 h in the absence or presence of 10 M T (Sigma) or vitamin D (Biomol), and harvested. Cell
extracts then were analyzed for both luciferase (29) and
-galactosidase (27) activity in order to correct for
transfection efficiency. Except where indicated, the corrected
luciferase activities of untreated samples were normalized to the
luciferase activities of samples containing vector alone in the absence
of ligand (1-fold basal).
VDR Expression in CV-1 CellsVDR and DBD expressions in CV-1 cells were determined using previously
described protocols with minor changes(30) . Briefly, CV-1
cells in 10-cm dishes were co-transfected with 10 µg of expression
plasmid and 1 µg of -galactosidase cDNA by the calcium
phosphate method and grown in stripped media. After 48 h, cells were
treated with 0.5 nM [ H]vitamin D (DuPont
NEN; specific activity = 175 Ci/mmol) ± 1000-fold excess
vitamin D for 2 h. Cells were harvested by scraping in 2 ml of cold
phosphate-buffered saline. Nuclear pellets and binding assay then were
performed as described previously(30) . Total incorporated
specific counts per minute (cpm) were normalized to -galactosidase
activity to adjust for any differences in transfection efficiency of
samples.
RESULTS
We first examined VDR homodimer and heterodimer binding on
DR3, DR4, and DR5 by electrophoretic mobility shift assay. VDR/RXR
heterodimer bound well to labeled DR3, DR4, and DR5 oligonucleotides (Fig. 1, lanes 5, 11, and 17). Two
VDR/RXR bands were observed as in vitro translated RXR
has two major translation products. The rank order of binding was DR3
> DR4 > DR5. Interestingly, addition of vitamin D slightly
decreased VDR/RXR heterodimer binding to these elements. No VDR
homodimer or monomer binding was observed on DR3 or DR5; however, a
faint band was observed on DR4 with the sample containing VDR alone (Fig. 1, lane 9). This band disappeared after addition
of vitamin D (Fig. 1, lane 10), similar to recent
reports of ligand-induced dissociation of TR and VDR
homodimers(26, 31, 32, 33, 34) .
Additionally, anti-VDR antibody could block the formation of this band
(data not shown). These results suggest that VDR weakly formed a
homodimer on the DR4 oligonucleotide. In contrast, no VDR/TR dimers
were observed on these elements ( Fig. 3and data not shown).
Figure 1:
VDR binding to direct repeats. In
vitro translated VDR (3 µl) and RXR (2 µl) were incubated
with P-labeled oligonucleotides in the presence and
absence of 10 M vitamin D and then analyzed
by EMSA as described under ``Materials and Methods.'' Please
note that there are two in vitro translated RXR products
with the smaller one likely due to translation from an internal
methionine. These, in turn, result in two VDR/RXR bands on EMSA. HD, VDR/RXR heterodimer; VD, VDR homodimer: rl, reticulocyte lysate; and *, nonspecific
band.
Figure 3:
Formation of VDR/RXR heterodimers on DR4
and the inverted palindrome F2 TRE. In vitro translated
TR , VDR, and RXR (2-5 µl) were incubated with P-labeled DR4 or F2 and then analyzed by EMSA as in Fig. 1. Reticulocyte lysate was added to some samples so that
the total volume of reticulocyte lysate was the same for each sample.
Similar amounts of TR and VDR, as quantitated by
SDS-polyacrylamide gel electrophoresis analyses described under
``Materials and Methods,'' were added. A, DR4. Note
that weak TR and VDR homodimer bands were seen (lanes 3 and 4) after longer film exposure (48 h) to gel. B, F2. Lanes 10-12, preimmune, anti-RXR or
anti-VDR antibodies were added after samples incubated with probe. M, TR monomer; D, TR homodimer; HD, TR/RXR or VDR/RXR heterodimer; and SS,
supershifted complex.
We next examined the transcriptional activity of VDR on these
elements by transfecting CV-1 cells with VDR expression plasmid and
reporter plasmids containing the DRs (Fig. 2). In the absence of
vitamin D, we observed repression of basal transcription on DR3- and
the mouse osteopontin VDRE-containing reporter (this osteopontin VDRE
contains an imperfect DR3). Little or no basal repression was observed
on DR4 and DR5. In the presence of vitamin D, transcriptional
activation was observed on DR3 and osteopontin VDRE, but not on DR4 and
DR5. These findings suggest that VDR can repress basal repression in
the absence of ligand on DR3 and osteopontin VDRE similar to TR on
certain TREs(6, 35, 36) . Additionally,
despite binding as VDR/RXR heterodimers to DR4 and DR5, VDR had minimal
or no effect on basal repression or ligand-dependent transactivation.
Figure 2:
Transcriptional activity of VDR on several
different HREs. VDR transcriptional activity on DR3, DR4, DR5, and
osteopontin. VDR expression vector (0.1 µg), HRE-containing
reporter plasmid (1.7 µg), and -galactosidase control vector
(1.0 µg) were co-transfected in CV-1 cells in the absence or
presence of 10 M vitamin D for 48 h. In
these experiments, treated cells then were harvested and luciferase was
measured. Luciferase activity was normalized to -galactosidase
activity and then calculated as fold basal luciferase activity with
1-fold basal activity defined as the luciferase activity with control
pSG vector alone in the absence of ligand. Each point represents the mean of four samples, and bars denote S.E.
* denotes significant difference from basal luciferase
activity.
GAL4 fusion protein systems have been used to characterize roles of
nuclear hormone receptor heterodimers on transcriptional activation by
minimizing potential contributions of endogenous RXR on transcription (17, 37) . In order to further characterize basal
repression by VDR, we performed co-transfection studies using GAL4,
GAL4-RXR, and VDR expression plasmids and a GAL4 binding
site-containing reporter in CV-1 cells. Both VDR and GAL4, or GAL4-RXR
alone, slightly decreased transcription both in the presence or absence
of vitamin D when compared to GAL4 alone. However, when cells were
co-transfected with VDR and GAL4-RXR in the absence of vitamin D, there
was greater than 90% repression of basal transcription compared to GAL4
alone (fold basal luciferase activity = 0.07 ± 0.01 S.D.)
and 90% repression of basal transcription compared to GAL4-RXR alone
(fold basal luciferase activity = 0.10 ± 0.01 S.D.). This
repression was reversed with addition of vitamin D, as ligand
stimulated transcription greater than 3-fold above basal levels (fold
basal luciferase activity = 3.45 ± 0.36 S.D.). These data
strongly support an important functional role for VDR/RXR heterodimer
in mediating basal repression and transcriptional activation. We
then compared VDR and TR binding to the consensus TRE, DR4, and
the chicken lysozyme TRE, F2, which contains half-sites arranged as an
inverted palindrome. On DR4, TR alone bound mostly as a monomer (Fig. 3A, lane 3) whereas both TR and VDR
bound poorly as a homodimer ( Fig. 1and Fig. 3A, lanes 3 and 4). Both TR/RXR and VDR/RXR heterodimers
bound well to DR4, but no VDR/TR dimers were observed even after a 48-h
exposure of the film to the gel. Surprisingly, when we examined TR and
VDR binding to the inverted palindrome, F2, we also observed strong
VDR/RXR heterodimer binding comparable to that observed for TR/RXR (Fig. 3B, lanes 5 and 6). As observed
for the DRs, vitamin D slightly decreased VDR/RXR heterodimer binding
to F2 (Fig. 3B, lanes 6 and 9).
Anti-RXR antibody partially supershifted the VDR/RXR bands,
whereas anti-VDR antibody blocked DNA binding by these complexes (Fig. 3B, lanes 11 and 12). No VDR
homodimer or VDR/TR dimers were observed even after a 48-h exposure of
the gel (Fig. 3B, lanes 4 and 7).
These latter findings suggest that VDR not only can bind promiscuously
to DRs with variable spacing between half-sites, but also can bind to
HREs containing different half-site orientations, e.g. inverted palindromes. Studies comparing the transcriptional
activities on TR and VDR using the DR4- and F2-containing
reporters also were performed. On DR4, basal repression by unliganded
TR and T -mediated transcriptional activation were
observed (Fig. 4A) as noted previously(18) .
VDR appeared to have weak repression of basal transcription on DR4,
although this effect did not reach statistical significance (n = 5 experiments and Fig. 1and Fig. 4A). VDR also did not stimulate transcription on
DR4 in the presence of vitamin D. On F2, similar basal repression and
ligand-mediated transcriptional activation for TR also was
observed. Interestingly, VDR repressed basal transcription in the
absence of vitamin D and derepressed basal transcription in the
presence of vitamin D on F2 (Fig. 4B). However, there
was no significant ligand-dependent transactivation by VDR on
F2-reporter activity.
Figure 4:
Comparison of transcriptional activity of
VDR and TR on DR4 and F2. VDR, TR , or pSG control expression
vector (0.1 µg), DR4- or F2-containing reporter plasmid (1.7
µg), and -galactosidase control vector (1.0 µg) were
co-transfected in CV-1 cells in the absence or presence of
10 M T or vitamin D for 48 h.
Treated cells then were harvested and luciferase was measured.
Luciferase activity was normalized to -galactosidase activity and
then calculated as fold basal luciferase activity with 1-fold basal
activity defined as the luciferase activity with control pSG vector
alone in the absence of ligand. Each point represents the mean
of four samples and bars denote S.D. * denotes significant
difference from basal luciferase activity. A, DR4-containing
reporter; B, F2-containing
reporter.
Since VDR could bind to the DR4 and F2 TREs
but was unable to mediate ligand-dependent transcriptional activation,
we examined whether VDR might instead exert dominant negative activity
on T -mediated transcription. Previously, it had been shown
the natural mutant TR s from patients with resistance to thyroid
hormone as well as the viral oncogene homolog of TR, v-erbA, possess
dominant negative activity on wild-type TRs. Moreover, this dominant
negative activity depended on mutant TR or v-erbA binding to TREs.
Accordingly, we transfected increasing amounts of VDR expression
plasmid and a fixed amount of TR expression plasmid with DR4
reporter into CV-1 cells (Fig. 5A). In the absence or
presence of vitamin D, increasing VDR:TR expression plasmid ratio
progressively decreased T -mediated transcriptional
activation. In fact, a 3:1 ratio of VDR and TR expression plasmids
completely blocked T -mediated transcriptional activation to
basal levels. Similar findings were observed for VDR blockade of
T -mediated transcription on the F2 reporter (Fig. 5B). We also observed similar VDR blockade of
T -mediated transcription when TR expression plasmid
was used, indicating VDR did not exhibit TR isoform specificity in its
dominant negative activity (data not shown).
Figure 5:
VDR blocks T -mediated
transcriptional activity on DR4 and F2 reporter. Expression plasmids
encoding TR , VDR, or pSG control vector (0.1 µg) were
co-transfected with DR4- or F2-containing reporter plasmid (1.7 µg)
and Rous sarcoma virus- -galactosidase control vector (1 µg).
Cells then were treated with or without 10 M T ± vitamin D for 48 h and analyzed for
luciferase activity. Luciferase activity was normalized to
-galactosidase activity and then calculated as fold basal
luciferase activity with 1-fold basal activity defined as the
luciferase activity with pSG alone in the presence of T alone or T + vitamin D. Each point represents the mean of four samples, and bars denote S.D. A, DR4-containing reporter; B, F2-containing
reporter.
In order to investigate
whether the dominant negative activity depended on VDR binding to TREs,
we created a mutant VDR, DBD , in which the fourth
cysteine of the first zinc finger was mutated to a serine. We and
others have shown that similar mutations in TR abrogate or markedly
reduce TR homodimer and TR/RXR heterodimer binding to TREs without
affecting ligand binding(24, 25) . DBD was unable to bind as a heterodimer to F2, DR3, and DR4 (Fig. 6A and data not shown). We then examined the
dominant negative activity of DBD on
T -mediated transcriptional activity on F2-containing
reporter (Fig. 6B). At a 1:1 expression plasmid ratio,
DBD had little dominant negative activity in contrast to
wild type VDR. At increasing expression plasmid ratios, however,
DBD had some dominant negative activity which was less
than wild type VDR dominant negative activity at the same expression
plasmid ratio. Addition of vitamin D did not significantly affect the
dominant activity of DBD or wild type VDR, and similar
results were observed with the DR4-containing reporter (Fig. 5, A and B, and data not shown). Additionally, we
performed [ H]vitamin D binding studies on nuclear
extracts from CV-1 cells co-transfected with VDR or DBD and observed similar binding, suggesting similar expression of
these receptors in CV-1 cells (data not shown). Collectively, these
results suggest that DNA binding is not absolutely required for
dominant negative activity by VDR, particularly at high expression
plasmid ratios. However, VDR/RXR heterodimer binding to TREs may be a
major contributor to dominant negative activity at low expression
plasmid ratios ( Fig. 6and Fig. 7).
Figure 6:
DNA binding and dominant negative activity
by DNA-binding mutant, DBD , on F2. A, in
vitro translated VDR, RXR, and DBD in the presence
and absence of vitamin D were incubated with P-labeled F2
probe, similar to Fig. 1and Fig. 3. Samples then were
analyzed by EMSA. B, increasing amounts of VDR or DBD expression vector (0.1, 0.3, 0.5 µg) and a fixed amount of
TR expression vector (0.1 µg) were co-transfected with
F2-containing reporter plasmid (1.7 µg) and -galactosidase
control vector (1 µg) in the presence of 10 M T for 48 h and analyzed for luciferase
activity. In some samples, control pSG vector was added so that the
total amount of expression vector was identical for each sample.
Luciferase activity was normalized to -galactosidase activity and
then calculated as fold basal luciferase activity with 1-fold basal
activity defined as the luciferase activity with control pSG vector
alone in the absence of ligand. Each point represents the mean
of triplicate samples. Similar results were obtained with
DR4-containing reporter.
Figure 7:
Model for dominant negative activity by
VDR on T -mediated transcription. Abbreviations same as in
text. , coactivator.
DISCUSSION
These studies provide new information on transcriptional
mechanisms mediated by VDR and TR and suggest cross-talk between these
receptors. In our studies of transcriptional activity by VDR on
different reporter plasmids, we observed that unliganded VDR can
repress basal transcription on DR3, osteopontin VDRE, and F2. This
phenomenon has not been reported for VDR previously. However, basal
repression or silencing has been well described for
TRs(6, 35, 36) . One mechanism proposed for
basal repression involves the binding of unliganded TR homodimer and
TR/RXR heterodimer to TREs, possibly in conjunction with
co-repressor(s) to TREs. These complexes may then interact with the
basal transcriptional machinery to repress basal
transcription(24, 38) . In the presence of
T , the TR homodimer dissociates from the TRE (inducing
derepression), whereas the liganded TR/RXR assumes an
``active'' conformation such that it now interacts with
co-activator(s) or the basal transcriptional machinery to support
ligand-dependent transcriptional activation. It is likely that VDR may
utilize similar repression and derepression mechanisms as liganded VDR
homodimer dissociates from HREs whereas liganded VDR/RXR heterodimers
remain bound to HREs(34) . However, VDR formed homodimers
weakly on DR4 and poorly on all other elements studied (including DR3
and osteopontin VDRE) suggesting that unliganded VDR/RXR may be the
major complex in VDR-mediated repression of basal transcription. Our
studies with GAL4-RXR and VDR further support the notion that VDR/RXR
heterodimers can mediate basal repression. Recently, two groups also
have shown that TRs and RARs can interact with co-repressors that may
participate in basal repression of
transcription(39, 40) . This new class of proteins are
called thyroid hormone and retinoic acid receptor associated
co-repressors (TRACs). Interestingly, these proteins bind well to TRs
or RARs in the absence, but not in the presence, of ligand. The
co-repressor interacts with the hinge region of TR and RAR, and a
three-amino acid substitution of amino acids 223, 224, and 227 of
TR abrogates binding with co-repressor(40) .
Interestingly, these amino acids are conserved in the vitamin D
receptor. It remains to be seen whether VDR interacts with these
recently described co-repressors or its own distinct co-repressor. Our findings also demonstrated that VDR/RXR heterodimers can bind to
DRs with gaps greater than three nucleotides. Although these
heterodimers can bind to DR4 and DR5, reporter plasmids containing
these HREs exhibit little vitamin D-dependent transcriptional activity.
This discordance between DNA binding and transcriptional activity
likely is due to spacing between VDRE half-sites modulating VDR/RXR
heterodimer conformation, which, in turn, may affect its interaction
with other associated proteins involved in transcriptional activation.
In this connection, recent studies have shown similar discordance
between TR/RXR heterodimer binding to certain elements and
transcriptional activity(21, 41, 42) .
Moreover, binding to different TREs can affect the trypsin sensitivity
of TR/RXR heterodimers(42) . Likewise, heterodimer binding was
not sufficient for mediating basal repression as we observed basal
repression on DR3, osteopontin, and F2 HREs, but not on DR4 or DR5.
This selective ability of unliganded VDR to repress and derepress basal
transcription on certain HREs is reminiscent of recent studies by
Kurokawa et al.(43) in which they observed similar
effects for RAR on DR1 and DR5. Thus, DNA sequences as well as spacing
between half-sites may modulate receptor complex interactions with
associated proteins for both transcriptional activation and basal
repression. We also observed VDR/RXR heterodimer binding on the
chicken lysozyme TRE, F2, suggesting that VDRs can bind to HREs in
which half-sites are arranged as inverted palindromes. Again, as
previously observed for TR/RXR
heterodimers(6, 7, 8) , the formation of
VDR/RXR heterodimers allows a more flexible and permissive binding to
HREs containing different half-site spacing and orientations. Recently,
Schrader et al.(44) have reported VDR/RXR heterodimer
binding on two other inverted palindromes with a 9-nucleotide spacing,
human calbindin and rat osteocalcin HREs. Both vitamin D and
9-cis-retinoic acid can stimulate transcription via these
elements. However, in the case of F2, which contains an inverted
palindrome with a gap of 6 nucleotides, no vitamin D-stimulated
transcription was observed. These results again suggest that spacing
between half-sites may dictate transcriptional activity by VDR/RXR
heterodimers. Previously, Schrader et al.(1) reported VDR/TR heterodimer binding to calbindin HREs.
We were unable to observe formation of VDR/TR heterodimers on any of
the different HREs as well as on the mouse and rat calbindin HREs. ( )Although differences in EMSA conditions likely account for
these differences, these data nonetheless suggest that RXR
preferentially forms heterodimers with VDR in comparison to TR on most
HREs. Schrader et al.(1) also observed vitamin D,
T , and dual ligand activation via the calbindin HREs. In
contrast, we have observed that VDR had no ligand-dependent
transcriptional activation on two TREs (DR4 and F2) and a retinoic acid
response element (DR5). Moreover, when VDR was co-transfected with TR,
we observed dominant negative activity on T -mediated
transcription. Similar results also were observed for VDR on
RA-mediated transcription using the DR5 reporter. These
findings suggest that VDR modulation of transcriptional activity on
these HREs are fundamentally different than those reported on the
calbindin HREs(1) , both in terms of mechanism and the
functional consequence of blocking hormone-mediated transcriptional
activation. It previously had been shown that mutation of the
DNA-binding domain abrogated dominant negative activity by natural
mutant TRs and v-erbA (25, 45) suggesting that DNA
binding is essential for dominant negative activity on
T -mediated transcription by these proteins. Our studies
with DBD , however, indicate that, although DNA binding is
important for full potency of dominant negative activity by VDR, it is
not absolutely required as high concentrations of DBD also can have dominant negative activity. These findings suggest
that both competition for DNA binding to TREs by transcriptionally
inactive VDR/RXR heterodimers as well as titration of putative common
associated proteins or co-activators may contribute to dominant
negative activity by VDR (Fig. 7). It does not appear that
titration of RXR is the likely mechanism for the latter effect as
co-transfection of RXR , the major endogenous
T -receptor auxiliary protein in CV-1 cells(46) ,
does not reverse VDR dominant negative activity on
T -mediated transcription. Moreover, in contrast
to TR/RXR heterodimers, VDR/TR heterodimers do not form in solution (47) . ( ) Interestingly, another dominant negative
inhibitor of T action, c-erbA -2 (the alternative
splice variant of TR ), may have similar mechanisms of
action(48, 49, 50) . Several groups have
shown DNA binding and/or DNA-dependent blockade of
T -mediated transcription by
c-erbA -2(48, 49, 50, 52) .
However, DNA binding is not absolutely required as co-transfection of
high amounts of a DNA-binding mutant of c-erbA -2 still can mediate
dominant negative activity(51) . Recently, Juge-Aubry et
al.(53) showed that peroxisome proliferator-activated
receptor, a member of the nuclear hormone receptor superfamily, also
can block T -mediated transcription. These studies with
peroxisome proliferator-activated receptor suggest that
heterodimerization with RXR as well as titration of a common
co-activator may be important in mediating dominant negative activity. Several human VDR mutations have been described which contain either
mutations in the DNA-binding domain or premature stop
codons(54, 55) . Some of these mutants have been shown
to bind DNA poorly or are likely to dimerize poorly since the critical
distal heptad repeats in the ligand-binding domain which are important
for TR and VDR dimerization are eliminated(56) . It is possible
that these mutants may behave similarly to the DBD ; that
is, they may exhibit impaired dominant negative activity on
T -mediated transcription. It thus is possible that
mutations in certain nuclear hormone receptors may have a deleterious
effect on the function(s) of other nuclear hormone receptors, which, in
turn, may contribute to the phenotype of affected patients. Currently, little is known about vitamin D regulation of TRs and
vice versa. Previously, Kaji and Hinkle (57) showed that
vitamin D decreased [ I]T binding
capacity and TR mRNA in GH4C1 pituitary cells, but the precise
mechanism(s) is not known. Recently, studies by Shrader et al.(1) suggested VDR and TR can form dimers on some HREs that
enable dual-ligand regulation. Our studies suggest that VDR may be
involved in yet another mechanism for VDR:TR cross talk, formation of
VDR/RXR heterodimers on TREs that can modulate T -mediated
transcription. These findings raise the possibility that VDR can
modulate T -mediated transcription in tissues where both
receptors are co-expressed (e.g. bone, gut, skin). Although
the physiological significance of this cross-talk currently is not
known, studies on the thyroid hormone status and function in patients
with vitamin D resistance or in VDR knockout animals may shed light on
this issue. In summary, our studies of VDR and TR regulation of
transcription demonstrate the intricacy and complexity of the signaling
pathways and networks that may occur among nuclear hormone receptors.
These, in turn, may enable finely tuned regulation of gene
transcription in target tissues.
FOOTNOTES
- *
- This work was
supported by a Charles H. Hood Foundation Grant and National Institutes
of Health Grant K08DK-02186. The costs of publication of this article
were defrayed in part by the payment of page charges. This article must
therefore by hereby marked ``advertisement'' in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
- §
- To whom correspondence should be addressed:
G. W. Thorn Research Bldg., Rm. 907, Brigham and Women's
Hospital, 20 Shattuck St., Boston, MA 02115. Tel.: 617-732-5858; Fax:
617-732-5123.
- (
) - The abbreviations used are: TR,
thyroid hormone receptor; VDR, vitamin D receptor; VDRE, vitamin D
response element; HRE, hormone response element; TRE, thyroid response
element; RAR, retinoic acid receptor; RXR, retinoid X receptor;
T
, triiodothyronine; EMSA, electrophoretic mobility shift
assay.
- (
) - P. M. Yen and Y. Liu, unpublished
results.
- (
) - P. M. Yen, unpublished results.
ACKNOWLEDGEMENTS
We would like to thank Dr. Ming-Jer Tsai (Baylor
University) for the GAL4-RXR and GAL4 expression vectors and Dr.
Willi Hunziker for the pSG-VDR vector (Hoffman-La Roche, Basel,
Switzerland). We also appreciate helpful suggestions by Drs. Masato
Ikeda and Akira Takeshita (Harvard Medical School), Dr. Tai Chen
(Boston University), Dr. Leonard Freedman (Memorial Sloan Kettering
Cancer Center), Dr. Mark Hughes (NIH), and Dr. Samuel Refetoff
(University of Chicago).
REFERENCES
- Schrader, M., Muller,
K. M., Nayeri, S., Kahlen, J.-P., and Carlberg, C. (1994) Nature 370, 382-386
[CrossRef][Medline]
[Order article via Infotrieve]
- Glass, C. K. (1994) Endocrinol. Rev. 15, 391-407
[Abstract/Free Full Text]
- Yen, P. M., and Chin, W.
W. (1994) Trends Endocrinol. Metab. 5, 65-72
- Umesono, K., Murakami, K.
K., Thompson, C. C., and Evans, R. M. (1991) Cell 65, 1255-1266
[CrossRef][Medline]
[Order article via Infotrieve]
- Naar, A. M., Boutin, J.
M., Lipkin, S. M., Yu, V. C., Holloway, J. M., Glass, C. K., and
Rosenfeld, M. G. (1991) Cell 65, 1267-1279
[CrossRef][Medline]
[Order article via Infotrieve]
- Yen, P. M., Spanjaard, R.
A., Sugawara, A., Darling, D. S., Nguyen, V. P., and Chin, W. W. (1993) Endocrine J. 1, 461-466
- Williams, G. R., Zavacki,
A. M., Harney, J. W., and Brent, G. A. (1994) Endocrinology 134, 1888-1896
[Abstract/Free Full Text]
- Schrader, M., and
Carlberg, C. (1994) DNA Cell Biol. 13, 333-341
[Medline]
[Order article via Infotrieve]
- Glass, C. K., Holloway,
J. M., Devary, O. V., and Rosenfeld, M. G. (1988) Cell 54, 313-323
[CrossRef][Medline]
[Order article via Infotrieve]
- Segars, J. H., Marks, M.
S., Hirschfeld, S., Driggers, P. H., Martinez, E., Grippo, J. F.,
Brown, M., Wahli, W., and Ozato, L. (1993) Mol. Cell.
Biol. 13, 2258-2268
[Abstract/Free Full Text]
- Glass, C. K., Lipkin, S.
M., Devary, O. V., and Rosenfeld, M. G. (1989) Cell 59, 697-708
[CrossRef][Medline]
[Order article via Infotrieve]
- Graupner, G., Wills, K.
N., Tzukerman, M., Zhang, X., and Pfahl, M. (1989) Nature 340, 653-656
[CrossRef][Medline]
[Order article via Infotrieve]
- Williams, G. R., Harney,
J. W., Moore, D. D., Larsen, P. R., and Brent, G. A. (1992) Mol. Endocrinol. 6, 1527-1537
[Abstract/Free Full Text]
- Sugawara, A., Yen, P.
M., and Chin, W. W. (1994) Endocrinology 135, 1956-1962
[Abstract]
- Baniahmad, A., Steiner,
A., Kohne, A. C., and Renkawitz, R. (1990) Cell 61, 505-514
[CrossRef][Medline]
[Order article via Infotrieve]
- Barettino, D., Bugge, T.
H., Bartunek, P., Ruiz, Vivanco, M. M., Sonntag-Buck, V., Beug, H.,
Zenke, M., and Stunnenberg, H. G. (1993) EMBO J. 12, 1343-1354
[Medline]
[Order article via Infotrieve]
- Leng, X.-K., Blanco, J.,
Tsai, S. Y., Ozato, K., O'Malley, B. W., and Tsai, M.-J. (1994) J. Biol. Chem. 50, 31435-31442
- Yen, P. M., Ikeda, M.,
Brubaker, J. H., Forgione, M., Sugawara, A., and Chin, W. W. (1994) J. Biol. Chem. 269, 903-909
[Abstract/Free Full Text]
- Yen, P. M., Sugawara,
A., and Chin, W. W. (1992) J. Biol. Chem. 267, 23248-23252
[Abstract/Free Full Text]
- Carey, M., Kakidani, H.,
Leatherwood, J., Mostashari, F., and Ptashne, M. (1989) J. Mol. Biol. 209, 423-432
[CrossRef][Medline]
[Order article via Infotrieve]
- Freedman, L. P., Arce,
V., and Perez Fernandez, R. (1993) Mol. Endocrinol. 8, 265-273
[Abstract/Free Full Text]
- Nordeen, S. K. (1988) BioTechniques 6, 454-458
[Medline]
[Order article via Infotrieve]
- Yen, P. M., Ikeda, M.,
Wilcox, E. C., Brubaker, J. H., Spanjaard, R. A., Sugawara, A., and
Chin, W. W. (1994) J. Biol. Chem. 269, 12704-12709
[Abstract/Free Full Text]
- Yen, P. M., Wilcox, E.
C., Hayashi, Y., Refetoff, S., and Chin, W. W. (1995) Endocrinology 136, 2845-2851
[Abstract]
- Nagaya, T., Madison, L.
D., and Jameson, J. L. (1992) J. Biol. Chem. 267, 13014-13019
[Abstract/Free Full Text]
- Yen, P. M., Darling, D.
S., Carter, R. L., Forgione, M., Umeda, P. K., and Chin, W. W. (1992) J. Biol. Chem. 267, 3565-3568
[Abstract/Free Full Text]
- Edlund, T., Walker, M.
D., Barr, P. J., and Rutter, W. J. (1985) Science 230, 912-916
[Abstract/Free Full Text]
- Sambrook, J.,
Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: a
Laboratory Manual , 2nd Ed, Cold Spring Harbor Laboratory, Cold
Spring Harbor, NY
- DeWet, J. R., Wood, K.
V., DeLuca, M., Helsinki, D. R., and Subramani, S. (1987) Mol. Cell. Biol. 7, 725-737
[Abstract/Free Full Text]
- Sone, T., Scott, R. A,
Hughes, M. R., Malloy, P. J., Feldman, D., O'Malley, B. W., and
Pike, W. J. (1989) J. Biol. Chem. 264, 20230-20234
[Abstract/Free Full Text]
- Ribeiro, R. C. J.,
Kushman, P. J., Apriletti, J. W., West, B. L., and Baxter, J. D. (1992) Mol. Endocrinol. 6, 1142-1152
[Abstract/Free Full Text]
- Miyamoto, T., Suzuki,
S., and DeGroot, L. (1993) Mol. Endocrinol. 7, 224-231
[Abstract/Free Full Text]
- Andersson, M. L.,
Nordstrom, K., Demezuk, S., Harbers, M., and Vennstrom, B. (1992) Nucleic Acids Res. 20, 4803-4870
[Abstract/Free Full Text]
- Cheskis, B., and
Freedman, L. P. (1994) Mol. Cell. Biol. 14, 3329-38
[Abstract/Free Full Text]
- Zhang, X. K., Wills, K.
N., Graupner, G., Tzukerman, M., Hermann, T., and Pfahl, M. (1991) New Biologist 3, 169-181
[Medline]
[Order article via Infotrieve]
- Brent, G. A., Dunn, M.
K., Harney, J. W., Gulick, T., Larsen, P. R., and Moore, D. D. (1989) New Biologist 1, 329-336
[Medline]
[Order article via Infotrieve]
- Forman, B. M., Umesono,
K., Chen, J., and Evans, R. M. (1995) Cell 81, 541-550
[CrossRef][Medline]
[Order article via Infotrieve]
- Bendik, I., and Pfahl,
M. (1995) J. Biol. Chem. 270, 3107-14
[Abstract/Free Full Text]
- Chen, D. J. and Evans,
R. M. (1995) Nature 377, 454-457
[CrossRef][Medline]
[Order article via Infotrieve]
- Horlein, A. J., Naar, A.
M., Heinzel, T., Torchia, J., Gloss, B., Kurokawa, R., Ryan, A., Kamei,
Y., Soderstrom, M., Glass, C. K., and Rosenfeld, M. G. (1995) Nature 377, 397-404
[CrossRef][Medline]
[Order article via Infotrieve]
- Nelson, C. C., Faris, J.
S., Hendy, S. C., and Romaniuk, P. J. (1993) Mol.
Endocrinol. 7, 1185-95
[Abstract/Free Full Text]
- Ikeda, M., Wilcox, E. C., and Chin, W. W. (1995) Abstracts of the Endocrine Society Meeting, Washington, D. C., June
14-17, 1995 , 1-P3-439, The Endocrine Society, Washington, D.
C.
- Kurokawa, R.,
Soderstrom, M., Horlein, A. J., Halachmi, S., Brown, M., Rosenfeld, M.
G., and Glass, C. K. (1995) Nature 377, 451-454
[CrossRef][Medline]
[Order article via Infotrieve]
- Schrader, M., Nayeri,
S., Kahlen, J. P., Muller, K. M., and Carlberg, C. (1995) Mol. Cell. Biol. 15, 1154-1161
[Abstract]
- Damm, K., Thompson, C.
C., and Evans, R. M. (1989) Nature 339, 593-597
[CrossRef][Medline]
[Order article via Infotrieve]
- Sugawara, A., Yen, P.
M., Darling, D. S., and Chin, W. W. (1993) Endocrinology 133, 965-971
[Abstract/Free Full Text]
- Yen, P. M., Brubaker, J.
H., Apriletti, J. W., Baxter, J. D., and Chin, W. W. (1994) Endocrinology 134, 1075-1081
[Abstract/Free Full Text]
- Koenig, R. J., Lazar, M.
A., Hodin, R. A., Brent, G. A., Larsen, P. R., Chin, W. W., and Moore,
D. D. (1989) Nature 337, 659-661
[CrossRef][Medline]
[Order article via Infotrieve]
- Nagaya, T., and Jameson,
J. L. (1993) J. Biol. Chem. 268, 24278-24282
[Abstract/Free Full Text]
- Yang, Y.-Z., and Koenig,
R. J. (1995) Abstracts of the Eleventh International Thyroid
Congress, Toronto, Canada, September 10-15, 1995 , 1-S-140
Mary Ann Liebert, Inc., Larchmont, NY
- Liu, R. T., Suzuki, S.,
Miyamoto, T., Takeda, T., Ozato, M., and DeGroot, L. J. (1995) Mol. Endocrinol. 9, 86-95
[Abstract/Free Full Text]
- Katz, D., and Lazar, M.
A. (1993) J. Biol. Chem. 268, 20904-20910
[Abstract/Free Full Text]
- Juge-Aubry, C. E.,
Gorla-Bajszczak, A., Pernin, A., Lemberger, T., Wahli, W., Burger, A.
G., and Meier, C. A. (1995) J. Biol. Chem. 270, 18117-18122
[Abstract/Free Full Text]
- Hughes, M. R., Malloy,
P. J., Kieback, D. G., Kesterson, R. A., Pike, J. W., Feldman, D., and
O'Malley, B. W. (1988) Science 242, 1702-1705
[Abstract/Free Full Text]
- Kristjansson, K., Rut,
A. R., Hewison, M., O'Riordan, J. L., and Hughes, M. R (1993) J. Clin. Invest. 92, 12-16
- Forman, B. M., Yang, C.
R., Au, M., Casanova, J., Ghysdael, J., and Samuels, H. H. (1989) Mol. Endocrinol. 3, 1610-1626
[Abstract/Free Full Text]
- Kaji, H., and Hinkle, P.
M. (1989) Endocrinology 124, 930-936
[Abstract/Free Full Text]
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
Y. Liu, S. Ando, X. Xia, R. Yao, M. Kim, J. Fondell, and P. M. Yen
p62, A TFIIH Subunit, Directly Interacts with Thyroid Hormone Receptor and Enhances T3-Mediated Transcription
Mol. Endocrinol.,
April 1, 2005;
19(4):
879 - 884.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-N. Bastie, N. Balitrand, F. Guidez, I. Guillemot, J. Larghero, C. Calabresse, C. Chomienne, and L. Delva
1{alpha},25-Dihydroxyvitamin D3 Transrepresses Retinoic Acid Transcriptional Activity via Vitamin D Receptor in Myeloid Cells
Mol. Endocrinol.,
November 1, 2004;
18(11):
2685 - 2699.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-C. Hsieh, J. M. Sisk, P. W. Jurutka, C. A. Haussler, S. A. Slater, M. R. Haussler, and C. C. Thompson
Physical and Functional Interaction between the Vitamin D Receptor and Hairless Corepressor, Two Proteins Required for Hair Cycling
J. Biol. Chem.,
October 3, 2003;
278(40):
38665 - 38674.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Ingley, D. Chappell, S. Y. K. Poon, M. K. Sarna, J. G. Beaumont, J. H. Williams, J. P. Stillitano, S. Tsai, P. J. Leedman, P. A. Tilbrook, et al.
Thyroid Hormone Receptor-interacting Protein 1 Modulates Cytokine and Nuclear Hormone Signaling in Erythroid Cells
J. Biol. Chem.,
November 9, 2001;
276(46):
43428 - 43434.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. M. Yen
Physiological and Molecular Basis of Thyroid Hormone Action
Physiol Rev,
July 1, 2001;
81(3):
1097 - 1142.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M Li, H Chiba, X Warot, N Messaddeq, C Gerard, P Chambon, and D Metzger
RXR-alpha ablation in skin keratinocytes results in alopecia and epidermal alterations
Development,
January 3, 2001;
128(5):
675 - 688.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Sakai and M. B. Demay
Evaluation of Keratinocyte Proliferation and Differentiation in Vitamin D Receptor Knockout Mice
Endocrinology,
June 1, 2000;
141(6):
2043 - 2049.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Jiménez-Lara and A. Aranda
Vitamin D Represses Retinoic Acid-Dependent Transactivation of the Retinoic Acid Receptor-{beta}2 Promoter: The AF-2 Domain of the Vitamin D Receptor Is Required for Transrepression
Endocrinology,
June 1, 1999;
140(6):
2898 - 2907.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
N. Koibuchi, Y. Liu, H. Fukuda, A. Takeshita, P. M. Yen, and W. W. Chin
ROR{alpha} Augments Thyroid Hormone Receptor-Mediated Transcriptional Activation
Endocrinology,
March 1, 1999;
140(3):
1356 - 1364.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Raval-Pandya, L. P. Freedman, H. Li, and S. Christakos
Thyroid Hormone Receptor Does Not Heterodimerize with the Vitamin D Receptor but Represses Vitamin D Receptor-Mediated Transactivation
Mol. Endocrinol.,
September 1, 1998;
12(9):
1367 - 1379.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
A. Takeshita, P. M. Yen, M. Ikeda, G. R. Cardona, Y. Liu, N. Koibuchi, E. R. Norwitz, and W. W. Chin
Thyroid Hormone Response Elements Differentially Modulate the Interactions of Thyroid Hormone Receptors with Two Receptor Binding Domains in the Steroid Receptor Coactivator-1
J. Biol. Chem.,
August 21, 1998;
273(34):
21554 - 21562.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. W. Anderson, R. J. Larson, D. R. Oas, C. R. Sandhofer, H. L. Schwartz, C. N. Mariash, and J. H. Oppenheimer
Chicken Ovalbumin Upstream Promoter-Transcription Factor (COUP-TF) Modulates Expression of the Purkinje Cell Protein-2 Gene. A POTENTIAL ROLE FOR COUP-TF IN REPRESSING PREMATURE THYROID HORMONE ACTION IN THE DEVELOPING BRAIN
J. Biol. Chem.,
June 26, 1998;
273(26):
16391 - 16399.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Li, C. Leo, D. J. Schroen, and J. D. Chen
Characterization of Receptor Interaction and Transcriptional Repression by the Corepressor SMRT
Mol. Endocrinol.,
December 1, 1997;
11(13):
2025 - 2037.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Ezura, O. Tournay, A. Nifuji, and M. Noda
Identification of a Novel Suppressive Vitamin D Response Sequence in the 5'-Flanking Region of the Murine Id1 Gene
J. Biol. Chem.,
November 21, 1997;
272(47):
29865 - 29872.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Takeshita, G. R. Cardona, N. Koibuchi, C.-S. Suen, and W. W. Chin
TRAM-1, A Novel 160-kDa Thyroid Hormone Receptor Activator Molecule, Exhibits Distinct Properties from Steroid Receptor Coactivator-1
J. Biol. Chem.,
October 31, 1997;
272(44):
27629 - 27634.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Sugawara, N. Sanno, N. Takahashi, R. Y. Osamura, and K. Abe
Retinoid X Receptors in the Kidney: Their Protein Expression and Functional Significance
Endocrinology,
August 1, 1997;
138(8):
3175 - 3180.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. M. Yen, Y. Liu, J. J. Palvimo, M. Trifiro, J. Whang, L. Pinsky, O. A. Jänne, and W. W. Chin
Mutant and Wild-Type Androgen Receptors Exhibit Cross-Talk on Androgen-, Glucocorticoid-, and Progesterone-Mediated Transcription
Mol. Endocrinol.,
February 1, 1997;
11(2):
162 - 171.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
H. Masuyama, S. C. Jefcoat Jr., and P. N. MacDonald
The N-Terminal Domain of Transcription Factor IIB Is Required for Direct Interaction with the Vitamin D Receptor and Participates in Vitamin D-Mediated Transcription
Mol. Endocrinol.,
February 1, 1997;
11(2):
218 - 228.
[Abstract]
[Full Text]
|
 |
|
Copyright © 1996 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|