|
Volume 271,
Number 19,
Issue of May 10, 1996 pp. 11392-11399
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
Induction of
c-Erb A-AP-1 Interactions and c-Erb A Transcriptional Activity in
Myoblasts by RXR
CONSEQUENCES FOR MUSCLE DIFFERENTIATION (*)
(Received for publication, January 11, 1996; and in revised form, February 29,
1996)
Isabelle
Cassar-Malek
,
Sophie
Marchal
,
Pierrick
Rochard
,
François
Casas
,
Chantal
Wrutniak
,
Jacques
Samarut
(1),
Gérard
Cabello (§)
From the INRA, Unité d'Endocrinologie Cellulaire, Laboratoire de
Différenciation Cellulaire et Croissance, place
Viala, 34060 Montpellier Cédex 01 and the Laboratoire de Biologie Moléculaire
et Cellulaire, CNRS UMR40, INRA ENS Lyon, 46
allée d'Italie, 69 364 Lyon
Cédex 07
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
We have previously shown that c-Erb A and v-Erb A display a
cell-specific activity in avian myoblasts. In this work, we have
compared the molecular basis of thyroid hormone action in HeLa cells
and in QM7 myoblasts. The transcriptional activity of c-Erb A 1
through a palindromic thyroid hormone response element (TRE) was
similar in both cell types. However, c-Erb A did not activate gene
transcription through a direct repeat sequence (DR) 4 TRE in myoblasts
in contrast to results obtained in HeLa cells. Moreover, whereas
retinoic acid receptor-AP-1 interactions were functional in both cell
types, thyroid hormone receptor (T3R)-AP-1 interactions were only
functional in HeLa cells. Using electrophoretic mobility shift assays,
functional tests, and Northern blot experiments, we observed that RXR
isoforms are not expressed in proliferating myoblasts. Expression of
RXR in these cells did not influence T3R transcriptional activity
through a palindromic TRE but induced such an activity through a DR4
TRE. Moreover, it restored c-Erb A-AP-1 functionality in QM7 myoblasts
and enhanced the myogenic influence of T3. We also observed that c-Jun
overexpression in proliferating QM7 cells restored T3R transcriptional
activity through a DR4 TRE. Therefore, alternative mechanisms are
involved in the induction of T3R transcriptional activity according to
the cell status (proliferation: c-Jun; differentiation: RXR). In
addition we provide the first evidence that RXR is required to allow
inhibition of AP-1 activity by ligand-activated T3R. Lastly, we
demonstrate the importance of RXR in the regulation of myoblast
differentiation by T3.
INTRODUCTION
Thyroid hormones exert critical effects on development, as well
as a variety of metabolic pathways. They bind to thyroid hormone
receptors (T3Rs), ( )closely related to steroid hormone
receptors, and control the expression of specific target genes in a
ligand-dependent manner. There are two classes of T3Rs, TR and
TR , which are encoded on two separate genes. They bind to specific
regulatory sequences (thyroid hormone response element (TRE)) usually
found in the promoter area of T3 responsive genes. TREs are composed of
hexamer half-sites (AGGTCA) with degeneracy in sequence and
orientation. In the absence of T3, c-Erb A proteins generally repress
basal transcription. In the presence of the hormone, they positively or
negatively modulate transcription. In vitro, T3Rs bind to DNA
as monomer, homodimer, and heterodimer with members of the nuclear
receptor superfamily, such as retinoic acid receptors
(RARs)(1, 2) ,
RXR(3, 4, 5) , vitamin D3
receptor(6) , PPAR(7) , or COUP-Tf(8) . It is
generally assumed that the T3R-RXR heterodimer is a major transcription
complex, at least through a DR4 TRE, whereas the T3R homodimer is
probably not a significant transcription
factor(9, 10) . In addition, as previously shown
for ligand-activated glucocorticoid receptors (11) and retinoic
acid receptors(12) , liganded T3Rs repress AP-1
activity(13, 14) . Conversely, stimulation of AP-1
activity by TPA or c-Jun overexpression inhibits T3Rs transcriptional
activity(14) . It was proposed that a direct physical
interaction between the AP-1 complex and T3Rs leads to a subsequent
loss of activity through TRE or AP-1 responsive
elements(14, 15) . The involvement of a third partner
in stabilization of the T3R-AP-1 complex was also
postulated(13, 16) . Therefore, although liganded
c-Erb A proteins directly regulate T3 target gene expression, they
repress transcription of AP-1-regulated genes. This dual pathway might
regulate the expression of two different sets of genes respectively
involved in cell proliferation and differentiation(13) . We
have previously shown that T3 stimulation of quail myoblast
differentiation was enhanced by T3R
overexpression(17, 18, 19) . In this work, we
compared two T3-regulated mechanisms in QM7 myoblasts and in HeLa
cells. We report that QM7 cells do not significantly express RXR,
leading to a cell-specific activity of T3R . In contrast to its
action in HeLa cells, c-Erb A 1 does not inhibit AP-1 activity in
QM7 cells, but RXR transfection induced functionality of T3R-AP-1
interactions. Last, whereas RXR does not affect T3R transcriptional
activity through a TRE , it induces such an activity
through a DR4 TRE. In agreement with these data, RXR expression
potentiates the T3 stimulation of myoblast differentiation. These
findings suggest a crucial role of RXR for the regulation of cell
differentiation through interactions with T3R and AP-1 activity.
EXPERIMENTAL PROCEDURES
Cell CulturesMyoblasts of the QM7 cell line (20) were grown in Earle's 199 Medium supplemented with
0.2% tryptose phosphate broth, penicillin (100 IU/ml), and 10%
T3-depleted fetal calf serum. HeLa cells were cultured in
Dulbecco's modified Eagle's medium supplemented with 10%
fetal calf serum. Serum was T3-depleted according to Samuels et
al.(21) . After hormonal depletion, T3 levels measured by
radioimmunoassay were always lower than the detection limit of the
assay (80 pmol/liter).
Plasmids and Reporter GenesThe
(AP-1) tk-CAT plasmid carrying five AP-1 sites upstream of
the thymidine kinase promoter linked to the CAT gene was kindly
provided by P. Chambon (LGME-U184, Strasbourg, France). The collagenase
promoter-CAT construct -73 col CAT previously described (22) was kindly provided by P. K. Vogt (The Scripps Research
Institute, La Jolla, CA). The TRE -glo-CAT plasmid
carrying the synthetic palindromic TRE sequence (TRE )
upstream of the rabbit -globin core promoter linked to the CAT
gene (23) was constructed by A. Rascle (ENS Lyon, France). The
DR4-tk-CAT plasmid was obtained from P. Chambon (LGME-U184, Strasbourg,
France), and the DR1-tk-CAT was from P. Balaguer (INSERM, U58,
Montpellier, France). The expression vectors for chicken c-Erb A 1
and RXR (p RS c-erb A 1 et pRS RXR ) had been described
elsewhere(1, 24) . The pRS chicken c-Jun expression
plasmid was obtained from P. K. Vogt (The Scripps Research Institute,
La Jolla, CA).
Transient Transfections and CAT Assays24 h before
transfection, 0.3 10 HeLa cells or QM7 cells per
100-mm dish were plated. Transfection of plasmid DNA into the cells was
performed using a calcium phosphate co-precipitation procedure (25) as described previously(19) . All transfections
also included 1 µg of pCMV -galactosidase as an internal
control to normalize for transfection efficiencies. Cells were exposed
to precipitates for 16-20 h. Then, they were refed for an
additional 24 h, respectively, with either 0.5 or 10% depleted
serum-containing medium and incubated with 50 ng/ml TPA and/or
10 M T3 when indicated. -Galactosidase
activity was measured as described previously(26) . CAT
enzymatic activity was measured at room temperature by following the
kinetics of chloramphenicol acetylation with
[ H]acetyl-CoA as a substrate(27) . For
each assay the initial rate of the enzymatic reaction (v = d[P]/dt) was determined. The results
are expressed as the percentage of control values after
-galactosidase normalization.
Electrophoretic Mobility Shift Assay (EMSA)Gel
mobility shift assays were performed according to Graupner et al.(28) , using whole cell extracts. HeLa cells or QM7
myoblasts were seeded at 0.3 10 cell/100-mm dish 24
h before transfection and transfected with 10 µg of pRS poly(A),
pRS c-erb-A 1, and/or pRS RXR by calcium phosphate
co-precipitation, respectively. After 48 h, cells were scraped and
pooled from two dishes, pelleted by centrifugation, and resuspended in
100 µl of buffer containing 10 mM Tris HCl (pH 7.8),
400 mM KCl, 20% glycerol, and 2 mM dithiothreitol.
Cell lysates were obtained after four freeze-thaw cycles and
centrifugated at 10,000 g. Protein amounts were
determined using the Bio-Rad protein assay in supernatant using bovine
serum albumin as a standard. For EMSA, various combinations of 10
µg of whole cell extracts were used. For competition assays, 200 ng
of cold oligonucleotide were preincubated with the reaction mixture
before adding the probe. TREpal (GATCCTCAGGTCATGACCTTGAAA) and
DR4 (TCAGGTCACAGGAGGTCA) were used as probes. Cold DR5
(GGTAAGGGTTCACCGAAAGTTCACTCA) and DR1
(GGTAAGGGTTCAGAGTTCACTCA) were used for competition
assays. Antibodies raised against c-Erb A 1 ( -17) and RXR
, and isoforms (4RX-1D12) were kindly provided by L.
J. De Groot (University of Chicago, IL) and P. Chambon (LGME-U184,
Strasbourg, France), respectively.
Statistical AnalysisStatistical analysis were
performed using the paired t test(29) .
RESULTS
T3R Transcriptional Activity in HeLa Cells and in
QM7 MyoblastsWe assessed the transcriptional activity of
T3R by transient transfections experiments using a
TRE -glo-CAT or a DR4-tk-CAT reporter gene together with
the pRS c-Erb A 1 expression vector.In both cell types,
co-transfection of the pRS c-Erb A 1 expression vector induced a
T3-dependent transcriptional activation of the
TRE -glo-CAT construct (up to 10-fold, p <
0.001; Fig. 1, A and B). Therefore T3R
displayed a similar transcriptional activity in QM7 myoblasts and in
HeLa cells through a TRE .
Figure 1:
Differences in c-Erb A 1
transcriptional activity assessed in HeLa cells and in QM7 myoblasts
when using a TRE or a DR4 TRE. Cells were transfected
with 1 µg/dish of the TRE -glo-CAT (A and B) or the DR4-tk-CAT reporter gene (C and D)
together with 2 µg of c-Erb A 1 expression vector. T3
(10 M) was added in the culture medium when
indicated. The results are normalized to -galactosidase activities
and expressed as percentages of control cells CAT activity. A and C, HeLa cells. B and D, QM7
myoblasts. Three independent transfection experiments were performed in
each case.
Using the DR4-tk-CAT
reporter gene, we observed striking differences. A significant
induction of CAT activity by liganded c-Erb A 1 was recorded in
HeLa cells (3-fold induction, p < 0.005; Fig. 1C). In QM7 myoblasts, T3R significantly
decreased basal CAT activity in the absence of T3 (p <
0.025). The addition of the hormone abrogated this inhibition but did
not induce any stimulation of CAT activity (Fig. 1D).
Therefore, as expected, the liganded T3R was able to stimulate the
expression of genes under the control of a DR4 TRE in HeLa cells.
However, in QM7 myoblasts, T3R acts only as a transcriptional
repressor of gene transcription through a DR4 TRE, and T3 abrogates
this activity.
In Contrast to RAR , T3R Inhibits AP-1 Activity
in HeLa Cells but Not in QM7 MyoblastsIn order to compare
T3R and RAR interactions with the AP-1 complex in HeLa and
QM7 cells, we performed transient transfection experiments in both cell
types. The (AP-1) -tk-CAT reporter gene and pRS c-erb
A 1 or pRS RAR expression vectors were simultaneously
co-transfected in these cells. AP-1 activity was stimulated by TPA. As expected, T3R and RAR activated by their cognate
ligands (10 M T3; 10 M RA) strongly inhibited the TPA-stimulated AP-1
activity in HeLa cells (in both cases: -80%, p <
0.005; Fig. 2A). However, liganded T3R did not
repress the TPA-induced AP-1 activity in QM7 cells (Fig. 2B) or in secondary quail myoblasts (Fig. 2C). Similar results were obtained when AP-1
activity was stimulated by chicken c-Jun overexpression using the
-73 col-CAT reporter gene in QM7 cells (Fig. 2D).
Figure 2:
In contrast to RAR , ligand-activated
c-Erb A 1 does not repress AP-1 activity in quail myoblasts. Cells
were transfected with 1 µg/dish of the (AP-1) -tk-CAT (A, B, C, and the left panel of D) or the -reporter gene (right panel of D) together with 2 µg of c-Erb A 1 expression vector
or 2 µg of RAR expression vector. TPA (50 ng/ml), T3
(10 M), or retinoic acid (RA,
10 M) were added in the culture medium when
indicated. Stimulation of AP-1 activity was also achieved by
transfection of 2 µg of c-Jun expression vector (C). The
results are normalized to -galactosidase activities and expressed
as percentages of TPA- or c-Jun-stimulated activity in control cells. A, HeLa cells. B, C, and D, QM7
myoblasts. Three independent transfection experiments were performed in
each case.
However, in QM7 myoblasts the
ligand-dependent repression by endogenous or exogenous RAR occurred as
observed in HeLa cells (Fig. 2, A and B).
Therefore, activated T3R and RAR do not display a similar
activity in myoblasts, whereas no difference could be noted in HeLa
cells. These results suggest that interactions of these receptors with
the AP-1 complex might not be mediated through strictly identical
pathways.
Stimulation of AP-1 Activity Differently Affects T3R
Transcriptional Activity According to the Cell Type and the
TRETo further investigate T3R-AP-1 relationships in myoblasts,
we studied the influence of TPA treatment on the transactivation of the
TRE -glo-CAT reporter by T3R . As previously reported
in CV1 cells(14) , activation of this reporter construct by
liganded T3R was abrogated by TPA treatment in HeLa cells (-90%, p < 0.001; Fig. 3A), whereas it was not
affected in QM7 cells (Fig. 3B). However, using the
same reporter gene, we observed that TPA abrogated RAR
transcriptional activity in both cell type (data not shown).
Figure 3:
Stimulation of AP-1 activity differently
affects c-Erb A 1 transcriptional activity according to the cell
type and the studied TRE. Cells were transfected with 1 µg/dish of
the TRE -glo-CAT (A and B) or the
DR4-tk-CAT reporter gene (C and D) together with 2
µg of c-Erb A 1 expression vector. AP-1 activity was
stimulated by TPA treatment (50 ng/ml, A, B, C, and D) or transfection of 2 µg of c-Jun
expression vector (D). T3 (10 M)
was added in the culture medium when indicated. The results are
normalized to -galactosidase activities and expressed as
percentages of control cells CAT activity. A and C,
HeLa cells. B and D, QM7 myoblasts. Three independent
transfection experiments were performed in each
case.
More
striking is the observation that in QM7 myoblasts, TPA induced a strong
transcriptional activity of ligand-activated T3R (7-fold
induction, p < 0.001) when using a DR4-tk-CAT gene reporter (Fig. 3D). Similar results were obtained using
c-jun transfection (Fig. 3D). In contrast,
using the same reporter gene, TPA treatment inhibited T3R
transcriptional activity in HeLa cells, with an efficiency similar to
that recorded using a TRE -glo-CAT gene reporter (Fig. 3C, p < 0.005). These data suggest
that TPA influence upon T3R transcriptional activity depends on the TRE
and on the cell type. In particular, an elevated AP-1 activity induces
transcriptional functionality of liganded T3R through a DR4 TRE in QM7
myoblasts.
A Major T3R-RXR Heterodimer Is Detected in HeLa Cells but
Not in QM7 MyoblastsIn EMSA experiments, we studied the c-Erb
A 1 binding pattern to TREs using QM7 or HeLa cells transiently
transfected with the T3R expression vector.When T3R
overexpressing HeLa cell extracts were incubated with a direct repeat
sequence (DR4) probe, three complexes displaying different binding
intensities were detected with complex II on the brink of detection (Fig. 4A, lanes 1 and 3). Using a
TRE probe (Fig. 4B, lanes 3 and 5), no significant differences were observed in the binding
ability of these three complexes. Using extracts of T3R-overexpressing
QM7 myoblasts and a DR4 probe, only two fast mobility complexes (II and
III) were observed (Fig. 4A, lanes 2 and 4). However, binding of complex III was strongly reduced when
using a TRE probe (Fig. 4B, lanes 2 and 4).
Figure 4:
C-Erb
A 1 binding on DR4 or palindromic TREs differs in quail myoblasts
and in HeLa cells. Gel retardation assays were performed using a DR4 (A) or a palindromic TRE (B). 10 µg of protein of
whole extracts of c-Erb A- or poly(A)-expressing cells were used in
each case. A, DR4 TRE. Lanes 1 and 3, c-Erb
A 1 HeLa extracts. Lanes 2 and 4, c-Erb A 1
QM7 extracts. B, palindromic TRE. Lane 1, poly(A)
HeLa extracts. Lanes 2 and 4, c-Erb A 1 QM7
extracts. Lanes 3 and 5, c-Erb A 1 HeLa
extracts. Lane 6, poly(A) QM7
extracts.
When a 5-fold protein excess of control HeLa
cellular extract was mixed with T3R-expressing QM7 cellular extract,
binding of the receptor as three complexes was observed (Fig. 5). Formation of complex I was associated with a decrease
of complexes II and III (Fig. 5, lane 2). Preincubation
with an antibody raised against c-Erb A 1 confirmed that T3R was a
component of these three complexes (Fig. 5, lane 6). In
agreement with this last observation, an excess of cold DR4 was found
to compete binding of complexes I, II, and III to the probe (Fig. 5, lane 5). Interestingly, binding of complex I
was also efficiently competed by molar excess of cold DR5 and DR1
probes (Fig. 5, lanes 3 and 4). These data
suggest that a T3R partner able to bind to DR5 and DR1 responsive
elements is expressed in HeLa but not in QM7 cells.
Figure 5:
HeLa complementation restores a c-Erb A
heterodimeric binding in HeLa cells competed by an excess of cold DR1
and DR5 probes. Gel retardation assays were performed using a
TRE probe as described in the legend to Fig. 4. Lane 1, c-Erb A 1 QM7 extracts. Lane 2, c-Erb A
1 QM7 extracts (1 vol) + nontransfected HeLa extracts (5
vol). Lane 3, c-Erb A 1 QM7 extracts (1 vol) +
nontransfected HeLa extracts (5 vol) + 200 ng cold DR1
oligonucleotide. Lane 4, c-Erb A 1 QM7 extracts (1 vol)
+ nontransfected HeLa extracts (5 vol) + 200 ng cold DR5
oligonucleotide. Lane 5, c-Erb A 1 QM7 extracts (1 vol)
+ nontransfected HeLa extracts (5 vol) + 200 ng cold DR4
oligonucleotide. Lane 6, c-Erb A 1 QM7 extracts (1 vol)
+ nontransfected HeLa extracts (5 vol) + c-Erb A 1
antiserum used at a final 1:5 dilution. Ab,
antibody.
When RXR
and T3R were co-expressed in QM7 myoblasts, a third complex was
detected (Fig. 6, lane 7). It displayed the same
mobility as complex I in QM7 expressing T3R extracts mixed with control
extracts of HeLa cells (Fig. 6, lanes 7 and 8). In addition, preincubation of cell extracts with an
antibody raised against all RXR isoforms suppressed the slow mobility
signal (complex I) both in T3R-RXR-expressing myoblasts and in
T3R-expressing HeLa cells (Fig. 6, lanes 4 and 5). In addition, binding of complexes II and III was not
affected in these two cell types, thus demonstrating absence of RXR in
these fast mobility complexes.
Figure 6:
Evidence that RXR is the
heterodimerization partner of c-Erb A in HeLa cells. Gel retardation
assays were performed using a TRE probe as described in
the legend to Fig. 4. Lane 1, extracts of c-Erb A
1 overexpressing QM7 + c-Erb A 1 antiserum at a final
1:5 dilution. Lane 2, extracts of c-Erb A 1 and RXR
overexpressing QM7 + c-Erb A 1 antiserum used at a final 1:5
dilution. Lane 3, c-Erb A 1 QM7 extracts (1 vol) +
nontransfected HeLa extracts (5 vol) and c-Erb A 1 antiserum used
at a final 1:5 dilution. Lane 4, c-Erb A 1 QM7 extracts
+ RXR antiserum used at a final 1:5 dilution. Lane 5,
c-Erb A 1 HeLa extracts + RXR antiserum used at a final 1:5
dilution. Lane 6, c-Erb A 1 QM7 extracts. Lane
7, extracts of c-Erb A 1- and RXR -overexpressing QM7
cells. Lane 8, c-Erb A 1 QM7 extracts (1 vol) +
nontransfected HeLa extracts (5 vol). Ab,
antibody.
Because only two RXR isoforms (
and ) are characterized in avian
species(24, 30) , expression of theses receptors was
assessed by Northern blot in proliferative QM7 myoblasts. Whereas the
two transcripts were easily detected in 4.5- and 5.5-day-old quail
embryo in agreement with previous data(24, 30) , we
failed to detect them in QM7 extracts (Fig. 7), in agreement
with our EMSA data.
Figure 7:
RXR isoforms are not expressed in
proliferating QM7 myoblasts. RXR (5 kilobases) and (2.5
kilobases) RNAs were detected by Northern blot analysis using
homologous probe in chicken embryos but not in QM7 cells. Lane
1, total RNA from stage 25 chicken embryos (4.5 days in
ovo). Lane 2, total RNA from stage 27 chicken embryos
(5.5 days in ovo). Lane 3, total RNA from QM7 cells
48 h after seeding (T3 depleted culture medium). Lane 4, total
RNA from QM7 cells 48 h after seeding (0.6 nM T3 supplemented
medium). 15 and 30 µg were loaded in lanes 1 and 2 and in lanes 3 and 4,
respectively.
RXR Expression Differently Influences T3R
Transcriptional Activity According to the Nature of the TRE in QM7
MyoblastsThese results lead us to study the influence of RXR on
T3R transcriptional activity in QM7 myoblasts. In transient
transfection experiments performed in HeLa cells, we observed that RXR
expression did not affect T3R transcriptional activity when
using a TRE -glo-CAT reporter (Fig. 8A)
but significantly enhanced this activity through a DR4-tk-CAT (Fig. 8C, p < 0.05).
Figure 8:
RXR expression affects c-Erb A
transcriptional activity when using a DR4 TRE but not a TRE construct. Cells were transfected with 1 µg/dish of the
TRE -glo-CAT (A and B) or the DR4-tk-CAT
reporter gene (C and D) together with 2 µg of
c-Erb A 1 expression vector. A and C, HeLa cells
were transfected with 2 µg of RXR expression vector when
indicated. B and D, QM7 myoblasts were stably
transfected using the RXR (+RXR) or the corresponding
``empty'' expression vector (control cells). E, RXR
expression was assessed by comparison of the activation of a
DR1-tk-CAT reporter gene in control and RXR-expressing myoblasts (1
µg of reporter gene was transiently transfected in cells grown
without or with 9-cis-RA). T3 (10 M) was
added in the culture medium when indicated. The results are normalized
to -galactosidase activities and expressed as percentages of
control cells CAT activity. Three (A, B, C,
and D) or five (E) independent transfection
experiments were performed.
QM7 myoblasts were
transfected with pRS c-RXR and pSV2-neo expression
plasmids. Control myoblasts were obtained by co-transfecting pRS
poly(A) vector with pSV2-neo plasmid. Stable expression of
RXR was tested using a DR1 CAT reporter gene (Fig. 8E). Using a TRE -glo-CAT gene
reporter, we observed that RXR expression did not significantly
influence the liganded T3R transcriptional activity (Fig. 8B) but restored a transcriptional activity of
liganded c-Erb A through a DR4 TRE in QM7 myoblasts (about 4-fold
induction, p < 0.005; Fig. 8D). Therefore,
this set of data brings evidence that T3R could be fully active through
a synthetic TRE in the absence of RXR, whereas the
T3R-RXR heterodimer is a major transcription complex on a DR4 TRE.
RXR Expression Restores the Functionality of
T3R -AP-1 InteractionsThe functionality of T3R -AP-1
interactions was also investigated in RXR -expressing myoblasts
using the (AP-1) -tk-CAT reporter plasmid. In absence of T3,
stimulation of AP-1 activity by TPA was not affected in control or
RXR-expressing myoblasts. A significant inhibition of CAT activity was
recorded in RXR -expressing myoblasts in comparison with control
myoblasts after 10 M T3 stimulation (Fig. 9A; p < 0.025; RXR versus control myoblasts). Therefore, in contrast to control cells,
T3-activated endogenous c-Erb A receptors inhibited AP-1 activity in
RXR -expressing cells. In addition, T3R overexpression
induced a strong inhibition of the TPA-stimulated AP-1 activity in RXR
-expressing myoblasts after 10 M T3
addition (Fig. 9A; p < 0.01, RXR versus control myoblasts). Similar results were recorded when
expression of RXR or RXR was performed in transient
transfection experiments (data not shown). Furthermore, in control
experiments, PPAR , RAR , or COUP-Tf I expression failed to
restore functionality of T3R-AP-1 interactions (data not shown). These
data demonstrated that RXR expression is specifically required for
inhibition of AP-1 activity by T3R.
Figure 9:
RXR expression induces functionality
of AP-1-c-Erb A interactions in QM7 myoblasts. QM7 myoblasts were
stably transfected using the RXR (+RXR) or the corresponding
empty expression vector (control cells). Thereafter, cells were
transfected with 1 µg/dish of the
[AP-1] -tk-CAT (A),
TRE -glo-CAT (B), or DR4-tk-CAT reporter gene (C) together with 2 µg of c-Erb A 1 expression vector
when indicated. TPA (50 ng/ml) and/or T3 (10 M) were added in the culture medium when indicated. A, ligand-activated c-Erb A represses AP-1 activity in RXR
-expressing myoblasts. B and C, stimulation of
AP-1 activity inhibits c-Erb A transcriptional activity in RXR
-expressing myoblasts when using a TRE glo-CAT (B) or a DR4-tk-CAT reporter gene (C). Three
independent experiments were performed. Similar results were obtained
when RXR expression was obtained by transient transfections
experiments.
Conversely, we demonstrated that
RXR expression restored the inhibition of T3R transcriptional
activity by AP-1 in QM7 myoblasts, whatever the TRE. Using a
TRE , TPA stimulation of AP-1 activity strongly inhibited
CAT induction by liganded T3R in RXR -expressing myoblasts
(-85%, p < 0.005; Fig. 9B). Similar
data were obtained using a DR4 TRE (-55%, p < 0.025; Fig. 9C), but a significant induction of CAT activity
remained (3-fold induction, p < 0.01; Fig. 9C), suggesting that RXR expression partly
preserved the transcriptional T3R activity through a DR4 TRE, even when
AP-1 activity was elevated.
Physiological ConsequencesBecause c-Erb A-AP-1
interactions and T3R transcriptional activity are probably involved in
the myogenic influence of T3(17, 18, 19) , we
studied the influence of RXR expression on myoblast
differentiation. QM7 myoblasts stably expressing pRS poly(A) or pRS
cRXR were infected with the avian retrovirus CASBA 9 enabling
expression of T3R as described previously(19) . Myoblast
differentiation was studied by cyto-immunofluorescence experiments
assessing myoblast fusion and connectin (a muscle-specific protein)
expression. Whereas RXR expression did not affect differentiation
by itself (Fig. 10, E versus A), it strongly
potentiated the myogenic influence of T3 in control (Fig. 10, F versus B) or in T3R-overexpressing cells (Fig. 10, H versus D). Therefore, by altering the T3R-AP-1 pathway and
T3R transcriptional activity, RXR expression modulates the stimulation
of cell differentiation induced by T3.
Figure 10:
RXR expression strongly enhances
the stimulation of QM7 myoblast differentiation induced by T3 in
control or c-Erb A 1 overexpressing cells. Connectin expression
was assessed by cytoimmunofluorescence 2 days after the induction of
differentiation with an antibody raised against connectin and a
fluorescein-conjugated antibody raised against mouse immunoglobulins
( 100). When indicated, 0.6 nM T3 was added in the
culture medium. A, control cells. B, control cells
+ T3. C, T3R-expressing cells. D, T3R-expressing
cells + T3. E, RXR -expressing cells. F,
RXR -expressing cells + T3. G, T3R + RXR
-expressing cells. H, T3R + RXR -expressing
cells + T3. These microphotographs are representative of three
independent experiments.
DISCUSSION
T3R-RXR Heterodimeric Binding Is Detected on a TRE
Sequence in HeLa Cells but Not in Avian MyoblastsWe have shown
that in both cell types, T3R binds to a palindromic TRE or a DR4
motif as two fast migrating complexes (II and III). We have detected a
third slow migrating complex in HeLa cells (complex I). Moreover,
addition of HeLa extracts to T3R overexpressing QM7 extracts
induced formation of an additional complex with a mobility similar to
that of complex I in myoblasts.Because an excess of cold DR1 or DR5
probes efficiently competed complex I binding to a TRE ,
RXR, PPAR, or COUP-Tf I and II, which are able to bind to these
response
elements(31, 32, 33, 34, 35, 36, 37, 38, 39) ,
could be possible partners of T3R 1 in HeLa cells. In EMSA
experiments, using 4RX-1D12 antibody reacting against all RXR
isoforms(40) , we identified RXR as the partner of T3R in
complex I of HeLa cells. Furthermore, RXR expression induced formation
of an additional complex in QM7 myoblasts with the same mobility as
complex I. These results were in line with some previous data
suggesting that RXR isoforms are not expressed in proliferating
myoblasts(41) . The present study also clearly indicates that
RXR isoforms are weakly or not expressed in proliferative quail
myoblasts: (i) transcriptional activity of 9-cis-RA from a DR1-tk-CAT
reporter gene is not significant (Fig. 7); (ii) we failed to
detect any T3R-RXR heterodimers in avian myoblasts (Fig. 6); and
(iii) we failed to detect RXR mRNAs in our cell extracts.
QM7 Myoblasts Provide a Useful Experimental Model to
Study the Influence of RXR upon T3R ActivityNumerous studies
have been performed in order to define the exact influence of RXR on
T3R activity. Whereas T3 induces dissociation of the T3R homodimer from
a direct repeat TRE, the hormone does not affect this binding to a
TRE or the binding of a T3R-RXR complex to a DR4
TRE(9, 10, 42) . In addition, several studies
strongly suggest that T3R-RXR is the major T3 dependent-transcription
complex through a direct repeat
TRE(43, 44, 45) . Interestingly, our study
clearly suggests that RXR is not required to induce a T3R
transcriptional activity through a TRE ; its efficiency is
not affected by the absence of RXR, and conversely RXR expression does
not influence T3R activity. Therefore, the T3R homodimer could be a
fully active transcription complex on this particular TRE, in
disagreement with previous
data(4, 37, 46, 47) . Alternatively,
such transcriptional activity could be induced by a T3R complex
including a partner other than RXR.However, T3-activated c-Erb A is
devoided of transcriptional activity through a DR4 TRE in the absence
of RXR: (i) T3R represses the basal expression level in absence of T3;
(ii) the addition of the hormone abrogates this inhibition but does not
stimulate transcription; (iii) in cells expressing RXR such as HeLa
cells, liganded T3R displays a significant transcriptional activity
through a DR4 TRE; and (iv) a similar activity is restored in myoblasts
after RXR expression. Therefore these data clearly indicate that the
T3R-RXR heterodimer is a major transcription complex on a DR4 TRE. We report a striking exception to this rule. In QM7 cells, TPA
stimulation or c-Jun overexpression induces a strong transcriptional
activity to liganded T3R through a DR4 TRE. Disruption by T3 of the
c-Erb A homodimer binding to a DR4 TRE (10, 42) probably explains the inability of T3R to
increase gene transcription by itself. Therefore, it could be proposed
that c-Jun acts by stabilizating homodimer binding to DNA. In addition,
according to the hypothesis of Pfahl(16) , Jun could function
as a bridging molecule between c-Erb A and the transcriptional
machinery. However, because we have not observed a similar T3R-Jun
interaction in HeLa cells, a muscle-specific protein could be involved
in this bridging, as already proposed ( (16) and Fig. 11).
Figure 11:
Hypothetic scheme involving AP-1 and RXR
in the regulation of myoblast differentiation by T3. This hypothesis
only considers results obtained using a DR4 TRE, closely related to
natural TREs. It is based on the original proposition of
Pfahl(16) . A, in proliferating myoblasts, a high AP-1
activity is recorded, thus repressing differentiation. In these
conditions, according to the hypothesis of this study, c-Jun could
function as a bridging molecule between T3R bound to a DR4 TRE and the
transcriptional machinery. However, our data demonstrate that c-Jun
induces a c-Erb A transcriptional activity in myoblasts but not in HeLa
cells. These data suggest that another molecule, which may differ from
cell type to cell type, is necessary to stabilize Jun binding to the
receptor, in agreement with the proposition of Pfahl(16) . We
propose that a muscle-specific factor (MSF) expressed in
proliferative myoblasts plays this role. Such a mechanism could induce
the activation of a set of genes involved in myogenic differentiation
by T3. B, RXR expression induces formation of a T3R-AP-1
inactive complex either through DR4 or TPA responsive elements.
Molecules involved in the bridging between the T3R homodimer and the
transcriptional machinery could be directly released by RXR (inducing
inactivity of the transcriptional complex) or indirectly (as a
consequence of a disruption of the interaction of the transcription
complex with DNA induced by RXR). Consequently, AP-1 activity is
strongly inhibited, thus derepressing terminal differentiation. In
these conditions, T3 responsive proteins synthetized in A could induce terminal differentiation. In differentiated cells,
AP-1 activity remains depressed; T3-regulated gene expression is
activated by RXR/T3R heterodimer. In this scheme, the T3
transcriptional pathway is always functional in relation to c-Jun
(proliferation) or RXR (differentiation) expression. In conjunction
with T3R (but probably with other nuclear receptors such as RARs), RXR
represses AP-1 activity and overcomes the differentiation
block.
Furthermore, we have obtained original data
establishing a major role of RXR in of T3R-AP-1 functionality. In
contrast to RAR , T3R does not repress AP-1 activity in quail
myoblasts. In addition, TPA stimulation of endogenous AP-1 activity
does not inhibit the ligand-dependent transcriptional activity of T3R
in these cells. Interestingly, in contrast to COUP-Tf I, PPAR , or
RAR , RXR expression restored functionality of T3R-AP-1
interactions in quail myoblasts. Similar data were obtained with RXR
expression, thus suggesting that such an activity is specific of
RXR isoforms. Functional interactions between RXR and T3Rs are well
documented. However, until this work, it was assumed that RXR
interaction with c-Erb A only affected the transcriptional activity of
T3R. Our data extend the importance of this interaction to the
functionality of T3R-AP-1 interactions. Consequently, they suggest that
RXR affects all pathways of T3 action.
RXR Plays a Major Role in the Processes of Cell
DifferentiationNumerous data underline the positive influence
of T3 upon differentiation of a number of cell types including
myoblasts, preadipocytes, chondrocytes, neurons, erythroblasts, etc. It
is well established that RXR is involved in the stimulation of gene
expression by T3, such as MyoD and myogenin gene expression in mouse
myoblasts (48, 49) . It is also assumed that AP-1
activity regulates cell proliferation and differentiation. Its
stimulation induces a strong inhibition of murine C2 myoblast
differentiation(50) . Moreover, c-Jun inhibits the expression
and activity of MyoD in C2 as in embryonic chicken
myoblasts(51, 52) . We demonstrate that in addition to
its strong influence upon c-Erb A transcriptional activity through a
DR4 TRE, RXR expression is necessary to induce the inhibition of AP-1
activity by liganded T3R. As a consequence, RXR is not only involved in
the stimulation of T3 target genes but also represses another set of
genes inhibiting cell differentiation.The physiological relevance
of these data is well illustrated by the observation that RXR strongly
potentiates the stimulation of differentiation induced by T3 in control
or in c-Erb A overexpressing myoblasts. Because myoblast withdrawal
from the cell cycle is the first event of terminal differentiation, an
anticipated differentiation would probably result in a reduced number
of muscle fibers and consequently an important impairment of muscle
development. As previously observed, RXR is not expressed before
induction of terminal differentiation in murine myoblasts(33) .
Our data also indicate that in QM7 cells, RXR is not significantly
expressed in proliferating cells. Therefore, RXR absence during the
earliest steps of muscle development could provide a protection against
such a precocious differentiation. T3 regulates the expression of a
large set of genes, involved in developmental processes and in cell
metabolism regulation. A lack of RXR expression in proliferating
myoblasts inducing a T3R transcriptional inefficiency would probably
severely impair cell metabolism and viability if we consider that
direct repeats are the most frequently described TREs. Interestingly,
AP-1 activity could restore the T3R transcriptional activity.
Therefore, our data indicate that alternative mechanisms are involved
in the preservation of T3R activity: first, via AP-1 activity, which
also inhibits differentiation, and second via RXR expression, which
also inhibits AP-1 activity through a T3R-related mechanism and
probably derepresses differentiation (Fig. 11).
FOOTNOTES
- *
- This work was partly supported by
Roussel-Uclaf (France), l'Association
Française contre les Myopathies, and
l'Association de Recherche sur le Cancer. The costs of
publication of this article were defrayed in part by the payment of
page charges. This article must therefore by hereby marked
``advertisement'' in accordance with 18 U.S.C.
Section 1734 solely to indicate this fact.
- §
- To whom correspondence should be addressed.
Tel.: 33-67-61-22-19; Fax: 33-67-54-56-94.
- (
) - The
abbreviations used are: T3R, triiodothyronine receptor; TRE, thyroid
hormone response element; RAR, retinoic acid receptor; TPA,
12-O-tetradecanoylphorbol-13-acetate; CAT, chloramphenicol
acetyltransferase; EMSA, electrophoretic mobility shift assay; DR,
direct repeat sequence; PPAR, peroxisome proliferator-activated
receptor; COUP-Tf, chicken ovalbumin upstream promoter-transcription
factor.
ACKNOWLEDGEMENTS
We thank Professor P. Chambon (LGME-U184, Strasbourg,
France), Dr. P. K. Vogt (The Scripps Research Institute, La Jolla, CA),
Dr. P. Brickell (University College and Middlesex School of Medicine,
London, UK), Dr. A. Rascle (ENS Lyon, France), Dr. L. J. De Groot
(University of Chicago, IL), Dr. P. Balaguer (INSERM Montpellier,
France), Dr. F. Pons (INSERM U300 Montpellier, France), Dr. P. B. Antin
and Dr. C. P. Ordhal (San Francisco, CA) for providing
(AP1) -tk-CAT, DR4-tk-CAT reporter constructs and RXR
antibody, c-Jun expression vector and -73 col CAT reporter gene,
chicken RXR expression vector, TRE -glo-CAT reporter gene,
c-Erb A 1 antibody, DR1-tk-CAT reporter gene, monoclonal antibody
raised against connectin, and the myoblast QM7 line, respectively. Dr.
N. Tourkine is greatly acknowledged for critical reading. Dr. J. C.
Nicolas and Dr. P. Balaguer (INSERM Montpellier, France) are
acknowledged for help and discussion.
REFERENCES
- Forman, B. M., Yang, C.
R., Au, M., Casanova, J., Ghysdael, J., and Samuels, H. H. (1989) Mol. Endocrinol. 3, 1610-1626
[Abstract/Free Full Text]
- Glass, C. K., Lipkin, S.
M., Devary, O. V., and Rosenfeld, M. G. (1989) Cell 59, 697-708
[CrossRef][Medline]
[Order article via Infotrieve]
- Hermann, T., Hoffmann,
B., Zhang, X. K., Tran, P., and Pfahl, M. (1992) Mol.
Endocrinol. 6, 1153-1162
[Abstract/Free Full Text]
- Zhang, X. K., Hoffman,
B., Tran, P. B. V., Graupner, G., and Pfahl, M. (1992) Nature 355, 441-446
[CrossRef][Medline]
[Order article via Infotrieve]
- Barettino, D., Bugge, T.
H., Bartunek, P., Vivanco Ruiz, M. M., Sonntag-Buck, V., Beug, H.,
Zenke, M., and Stunnenberg, H. G. (1993) EMBO J. 12, 1343-1354
[Medline]
[Order article via Infotrieve]
- Schräder,
M., Müller, K. H., Nayeri, S., Kahlen, J. P., and
Carlberg, C. (1994) Nature 370, 382-386
[CrossRef][Medline]
[Order article via Infotrieve]
- Bogazzi, F., Hudson, L.
D., and Nikodem, V. M. (1994) J. Biol. Chem. 269, 11683-11686
[Abstract/Free Full Text]
- Berrodin, T. J., Marks,
M. S., Ozato, K., Linney, L., and Lazar, M. A. (1992) Mol. Endocrinol. 6, 1468-1478
[Abstract/Free Full Text]
- Yen, P. M., Darling, D.
S., Carter, R. L., Forgione, M., Umeda, P. K., and Chin, W. W. (1992) J. Biol. Chem. 267, 3565-3568
[Abstract/Free Full Text]
- Andersson, M. L.,
Nordström, K., Demczuk, S., Harbers, M., and
Vennström, B. (1992) Nucleic Acids
Res. 20, 4803-4810
[Abstract/Free Full Text]
- Jonat, C., Rahmsdorf, H.
J., Park, K. K., Cato, A. C. B., Gebel, S., Ponta, H., and Herrlich, P. (1990) Cell 62, 1189-1204
[CrossRef][Medline]
[Order article via Infotrieve]
- Yang-Yen, H. F.,
Chambard, J. C., Sun, Y. L., Smeal, T., Schimdt, T. J., Drouin, J., and
Karin M. (1990) Cell 62, 1205-1215
[CrossRef][Medline]
[Order article via Infotrieve]
- Desbois, C., Aubert, D.,
Legrand, C., Pain, B., and Samarut, J. (1991a) Cell 67, 731-740
[CrossRef][Medline]
[Order article via Infotrieve]
- Zhang, X. K., Wills, K.
N., Husmann, N., Hermann, T, and Pfahl, M. (1991) Mol.
Cell. Biol. 11, 6016-6025
[Abstract/Free Full Text]
- Schmidt, E. D. L.,
Cramer, S. J., and Offringa, R. (1993) Biochem.
Biophys. Res. Commun. 192, 151-160
[CrossRef][Medline]
[Order article via Infotrieve]
- Pfahl, M. (1993) Endocr. Rev. 14, 651-658
[Abstract/Free Full Text]
- Marchal, S.,
Cassar-Malek, I., Pons, F., Wrutniak, C., and Cabello, G. (1993) Biol. Cell 78, 191-197
[CrossRef][Medline]
[Order article via Infotrieve]
- Marchal, S.,
Cassar-Malek, I., Magaud, J. P., Rouault, J. P., Wrutniak, C., and
Cabello, G. (1995) Exp. Cell. Res. 220, 1-10
[CrossRef][Medline]
[Order article via Infotrieve]
- Cassar-Malek, I.,
Marchal, S., Altabef, M., Wrutniak, C., Samarut, J., and Cabello, G. (1994) Oncogene 9, 2197-2206
[Medline]
[Order article via Infotrieve]
- Antin, P. B., and
Ordhal, C. P. (1991) Dev. Biol. 143, 111-121
[CrossRef][Medline]
[Order article via Infotrieve]
- Samuels, H. H. Stanley,
F., and Casanova, J. (1979) Endocrinology 105, 80-85
[Abstract/Free Full Text]
- Angel, P., Baumann, I.,
Stein, B., Delius, H., Rahmsdorf, H. J., and Herrlich, P. (1987) Mol. Cell. Biol. 7, 2256-2266
[Abstract/Free Full Text]
- Rascle, A., Ghysdael,
J., and Samarut, J. (1994) Oncogene 9, 2853-2867
[Medline]
[Order article via Infotrieve]
- Rowe, A., Eager, N. S.,
and Brickell, P. M. (1991) Development 111, 771-778
[Abstract]
- Wigler, M., Pellicer,
A., Silverstein, S., and Axel, R. (1978) Cell 14, 725-731
[CrossRef][Medline]
[Order article via Infotrieve]
- Nielsen, D. A., Chou,
J., Mackrell, A. J., Casabadan, M. J., and Steiner, D. F. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 5198-5202
[Abstract/Free Full Text]
- Neumann, J. R., Morency,
C. A., and Russian, K. O. (1987) BioTechniques 5, 444-447
- Graupner, G., Wills, K.
M., Tzukerman, X. K., and Pfahl, M. (1989) Nature 340, 654-656
- Snedecor, G. W.
(1961) Statistical Methods , p. 534, Iowa State University
Press, Ames, IA
- Seleiro, E. A. P., Roxe,
A., and Brickell, P.M . (1995) Roux's Arch. Dev.
Biol. 204, 244-249
- Wang, L. H., Tsai, S.
Y., Cook, R. G., Beattie, W. G., Tsai, M. J., and O'Malley, B. W. (1989) Nature 340, 163-166
[CrossRef][Medline]
[Order article via Infotrieve]
- Kadowaki, Y., Toyoshima,
K., and Yamamoto, T. (1992) Biochem. Biophys. Res.
Commun. 183, 492-498
[CrossRef][Medline]
[Order article via Infotrieve]
- Lutz, B., Kuratani, S.,
Cooney, A. J., Wawersik, S., Tsai, S. Y., Eichele, G., and Tsai, M. J. (1994) Development 120, 25-36
[Abstract]
- Tugwood, J. D.,
Issemann, I., Anderson, R. G., Bundell, K. R., McPheat, W. L., and
Green, S. (1992) EMBO J. 11, 433-439
[Medline]
[Order article via Infotrieve]
- Keller, H., and Whali,
W. (1993) Trends. Endocrinol. Metab. 4, 291-296
- Mangelsdorf, D. J.,
Umesono, K., Kliewer, S. A., Borgmeyer, U., Ong, E. S., and Evans, R.
M. (1991) Cell 66, 555-561
[CrossRef][Medline]
[Order article via Infotrieve]
- Kliewer, S. A., Umesono,
K., Mangelsdorf, D. J., and Evans, R. M. (1992) Nature 355, 446-449
[CrossRef][Medline]
[Order article via Infotrieve]
- Bardot, O., Aldridge, T.
C., Latruffe, N., and Green, S. (1993) Biochem.
Biophys. Res. Commun. 192, 37-45
[CrossRef][Medline]
[Order article via Infotrieve]
- Cooney, A. J., Leng, X.,
Tsai, S. Y., O'Malley, B. W., and Tsai, M.-J. (1993) J. Biol. Chem. 268, 4152-4160
[Abstract/Free Full Text]
- Rochette-Egly, C., Lutz,
Y., Pfister, V., Heyberger, S., Scheuer, I., Chambon, P., and Gaub, M.
P. (1994) Biochem. Biophys. Res. Commun. 204, 525-536
[CrossRef][Medline]
[Order article via Infotrieve]
- Downes, M.,
Mynett-Johnson, L., and Muscat, G. E. O. (1994) Endocrinology 134, 2658-2661
[Abstract/Free Full Text]
- Ribeiro, R. C., Kushner,
P. J., Apriletti, J. W., West, B. L., and Baxter, J. D. (1992) Mol. Endocrinol. 6, 1142-1152
[Abstract/Free Full Text]
- Perlmann, T.,
Rangarjian, P. N., Umesono, I., and Evans, R. M. (1993) Genes & Dev. 7, 1411-1422
- Kurokawa, R., Yu, V. C.,
Naar, A., Kyakumoto, S., Han, Z., Silverman, S., Rosenfeld, M. G., and
Glass, C. K. (1993) Genes & Dev. 7, 1423-1435
- Miyamoto, T., Suzuki,
S., and DeGroot, L. J. (1993) Mol. Endocrinol. 7, 224-231
[Abstract/Free Full Text]
- Marks, M. S.,
Hallenbeck, P. L., Nagata, T., Segars, J. H., Appella, E., Nikodem, V.
M., and Ozato, K. (1992) EMBO J. 11, 1419-1435
[Medline]
[Order article via Infotrieve]
- Piedrafita, F. J.,
Bendik, I., Ortiz, M. A., and Pfahl, M. (1995) Mol.
Endocrinol. 9, 563-578
[Abstract/Free Full Text]
- Muscat, G. E. O.,
Mynett-Johnson, L., Dowhan, D., Downes, M., and Griggs R. (1994) Nucleic Acids Res. 22, 583-591
[Abstract/Free Full Text]
- Downes, M., Griggs, R.,
Atkins, A., Olson, E. N., and Muscat, G. E. O. (1994a) Cell Growth & Differ. 4, 901-909
- Park, K., Chung, M., and
Kim, S. J. (1992) J. Biol. Chem. 267, 10810-10815
[Abstract/Free Full Text]
- Bengal, E., Ransone, L.,
Scharfmann, R., Dwarki, V. J., Tapscott, S. J., Weintraub, H., and
Verma, I. M. (1992) Cell 68, 507-519
[CrossRef][Medline]
[Order article via Infotrieve]
- Li, L., Chambard, J. C.,
Karin, M., and Olson, E. N. (1992) Genes & Dev. 6, 676-689
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Busson, L. Daury, P. Seyer, S. Grandemange, L. Pessemesse, F. Casas, C. Wrutniak-Cabello, and G. Cabello
Avian MyoD and c-Jun Coordinately Induce Transcriptional Activity of the 3,5,3'-Triiodothyronine Nuclear Receptor c-ErbA{alpha}1 in Proliferating Myoblasts
Endocrinology,
July 1, 2006;
147(7):
3408 - 3418.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Casas, M. Busson, S. Grandemange, P. Seyer, A. Carazo, L. Pessemesse, C. Wrutniak-Cabello, and G. Cabello
Characterization of a Novel Thyroid Hormone Receptor {alpha} Variant Involved in the Regulation of Myoblast Differentiation
Mol. Endocrinol.,
April 1, 2006;
20(4):
749 - 763.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Casas, P. Rochard, A. Rodier, I. Cassar-Malek, S. Marchal-Victorion, R. J. Wiesner, G. Cabello, and C. Wrutniak
A Variant Form of the Nuclear Triiodothyronine Receptor c-ErbAalpha 1 Plays a Direct Role in Regulation of Mitochondrial RNA Synthesis
Mol. Cell. Biol.,
December 1, 1999;
19(12):
7913 - 7924.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1996 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|