Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cassar-Malek, I.
Right arrow Articles by Cabello, Gér.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cassar-Malek, I.
Right arrow Articles by Cabello, Gér.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 271, Number 19, Issue of May 10, 1996 pp. 11392-11399
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
Induction of c-Erb A-AP-1 Interactions and c-Erb A Transcriptional Activity in Myoblasts by RXR
CONSEQUENCES FOR MUSCLE DIFFERENTIATION (*)

(Received for publication, January 11, 1996; and in revised form, February 29, 1996)

Isabelle Cassar-Malek Sophie Marchal Pierrick Rochard François Casas Chantal Wrutniak Jacques Samarut (1) Gérard Cabello (§)

From the INRA, Unité d'Endocrinologie Cellulaire, Laboratoire de Différenciation Cellulaire et Croissance, place Viala, 34060 Montpellier Cédex 01 and the Laboratoire de Biologie Moléculaire et Cellulaire, CNRS UMR40, INRA ENS Lyon, 46 allée d'Italie, 69 364 Lyon Cédex 07

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

We have previously shown that c-Erb A and v-Erb A display a cell-specific activity in avian myoblasts. In this work, we have compared the molecular basis of thyroid hormone action in HeLa cells and in QM7 myoblasts. The transcriptional activity of c-Erb Aalpha1 through a palindromic thyroid hormone response element (TRE) was similar in both cell types. However, c-Erb A did not activate gene transcription through a direct repeat sequence (DR) 4 TRE in myoblasts in contrast to results obtained in HeLa cells. Moreover, whereas retinoic acid receptor-AP-1 interactions were functional in both cell types, thyroid hormone receptor (T3R)-AP-1 interactions were only functional in HeLa cells. Using electrophoretic mobility shift assays, functional tests, and Northern blot experiments, we observed that RXR isoforms are not expressed in proliferating myoblasts. Expression of RXR in these cells did not influence T3R transcriptional activity through a palindromic TRE but induced such an activity through a DR4 TRE. Moreover, it restored c-Erb A-AP-1 functionality in QM7 myoblasts and enhanced the myogenic influence of T3. We also observed that c-Jun overexpression in proliferating QM7 cells restored T3R transcriptional activity through a DR4 TRE. Therefore, alternative mechanisms are involved in the induction of T3R transcriptional activity according to the cell status (proliferation: c-Jun; differentiation: RXR). In addition we provide the first evidence that RXR is required to allow inhibition of AP-1 activity by ligand-activated T3R. Lastly, we demonstrate the importance of RXR in the regulation of myoblast differentiation by T3.


INTRODUCTION

Thyroid hormones exert critical effects on development, as well as a variety of metabolic pathways. They bind to thyroid hormone receptors (T3Rs), (^1)closely related to steroid hormone receptors, and control the expression of specific target genes in a ligand-dependent manner. There are two classes of T3Rs, TRalpha and TRbeta, which are encoded on two separate genes. They bind to specific regulatory sequences (thyroid hormone response element (TRE)) usually found in the promoter area of T3 responsive genes. TREs are composed of hexamer half-sites (AGGTCA) with degeneracy in sequence and orientation. In the absence of T3, c-Erb A proteins generally repress basal transcription. In the presence of the hormone, they positively or negatively modulate transcription. In vitro, T3Rs bind to DNA as monomer, homodimer, and heterodimer with members of the nuclear receptor superfamily, such as retinoic acid receptors (RARs)(1, 2) , RXR(3, 4, 5) , vitamin D3 receptor(6) , PPAR(7) , or COUP-Tf(8) . It is generally assumed that the T3R-RXR heterodimer is a major transcription complex, at least through a DR4 TRE, whereas the T3R homodimer is probably not a significant transcription factor(9, 10) .

In addition, as previously shown for ligand-activated glucocorticoid receptors (11) and retinoic acid receptors(12) , liganded T3Rs repress AP-1 activity(13, 14) . Conversely, stimulation of AP-1 activity by TPA or c-Jun overexpression inhibits T3Rs transcriptional activity(14) . It was proposed that a direct physical interaction between the AP-1 complex and T3Rs leads to a subsequent loss of activity through TRE or AP-1 responsive elements(14, 15) . The involvement of a third partner in stabilization of the T3R-AP-1 complex was also postulated(13, 16) . Therefore, although liganded c-Erb A proteins directly regulate T3 target gene expression, they repress transcription of AP-1-regulated genes. This dual pathway might regulate the expression of two different sets of genes respectively involved in cell proliferation and differentiation(13) .

We have previously shown that T3 stimulation of quail myoblast differentiation was enhanced by T3Ralpha overexpression(17, 18, 19) . In this work, we compared two T3-regulated mechanisms in QM7 myoblasts and in HeLa cells. We report that QM7 cells do not significantly express RXR, leading to a cell-specific activity of T3Ralpha. In contrast to its action in HeLa cells, c-Erb Aalpha1 does not inhibit AP-1 activity in QM7 cells, but RXR transfection induced functionality of T3R-AP-1 interactions. Last, whereas RXR does not affect T3R transcriptional activity through a TRE, it induces such an activity through a DR4 TRE. In agreement with these data, RXR expression potentiates the T3 stimulation of myoblast differentiation. These findings suggest a crucial role of RXR for the regulation of cell differentiation through interactions with T3R and AP-1 activity.


EXPERIMENTAL PROCEDURES

Cell Cultures

Myoblasts of the QM7 cell line (20) were grown in Earle's 199 Medium supplemented with 0.2% tryptose phosphate broth, penicillin (100 IU/ml), and 10% T3-depleted fetal calf serum. HeLa cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. Serum was T3-depleted according to Samuels et al.(21) . After hormonal depletion, T3 levels measured by radioimmunoassay were always lower than the detection limit of the assay (80 pmol/liter).

Plasmids and Reporter Genes

The (AP-1)(5)tk-CAT plasmid carrying five AP-1 sites upstream of the thymidine kinase promoter linked to the CAT gene was kindly provided by P. Chambon (LGME-U184, Strasbourg, France). The collagenase promoter-CAT construct -73 col CAT previously described (22) was kindly provided by P. K. Vogt (The Scripps Research Institute, La Jolla, CA). The TRE-glo-CAT plasmid carrying the synthetic palindromic TRE sequence (TRE) upstream of the rabbit beta-globin core promoter linked to the CAT gene (23) was constructed by A. Rascle (ENS Lyon, France). The DR4-tk-CAT plasmid was obtained from P. Chambon (LGME-U184, Strasbourg, France), and the DR1-tk-CAT was from P. Balaguer (INSERM, U58, Montpellier, France). The expression vectors for chicken c-Erb Aalpha1 and RXR (p RS c-erb Aalpha1 et pRS RXR ) had been described elsewhere(1, 24) . The pRS chicken c-Jun expression plasmid was obtained from P. K. Vogt (The Scripps Research Institute, La Jolla, CA).

Transient Transfections and CAT Assays

24 h before transfection, 0.3 times 10^6 HeLa cells or QM7 cells per 100-mm dish were plated. Transfection of plasmid DNA into the cells was performed using a calcium phosphate co-precipitation procedure (25) as described previously(19) . All transfections also included 1 µg of pCMV beta-galactosidase as an internal control to normalize for transfection efficiencies. Cells were exposed to precipitates for 16-20 h. Then, they were refed for an additional 24 h, respectively, with either 0.5 or 10% depleted serum-containing medium and incubated with 50 ng/ml TPA and/or 10M T3 when indicated. beta-Galactosidase activity was measured as described previously(26) . CAT enzymatic activity was measured at room temperature by following the kinetics of chloramphenicol acetylation with [^3H]acetyl-CoA as a substrate(27) . For each assay the initial rate of the enzymatic reaction (v = d[P]/dt) was determined. The results are expressed as the percentage of control values after beta-galactosidase normalization.

Electrophoretic Mobility Shift Assay (EMSA)

Gel mobility shift assays were performed according to Graupner et al.(28) , using whole cell extracts. HeLa cells or QM7 myoblasts were seeded at 0.3 times 10^6 cell/100-mm dish 24 h before transfection and transfected with 10 µg of pRS poly(A), pRS c-erb-Aalpha1, and/or pRS RXR by calcium phosphate co-precipitation, respectively. After 48 h, cells were scraped and pooled from two dishes, pelleted by centrifugation, and resuspended in 100 µl of buffer containing 10 mM TrisbulletHCl (pH 7.8), 400 mM KCl, 20% glycerol, and 2 mM dithiothreitol. Cell lysates were obtained after four freeze-thaw cycles and centrifugated at 10,000 times g. Protein amounts were determined using the Bio-Rad protein assay in supernatant using bovine serum albumin as a standard. For EMSA, various combinations of 10 µg of whole cell extracts were used. For competition assays, 200 ng of cold oligonucleotide were preincubated with the reaction mixture before adding the probe. TREpal (GATCCTCAGGTCATGACCTTGAAA) and DR4 (TCAGGTCACAGGAGGTCA) were used as probes. Cold DR5 (GGTAAGGGTTCACCGAAAGTTCACTCA) and DR1 (GGTAAGGGTTCAGAGTTCACTCA) were used for competition assays. Antibodies raised against c-Erb Aalpha1 (alpha-17) and RXR alpha, beta and isoforms (4RX-1D12) were kindly provided by L. J. De Groot (University of Chicago, IL) and P. Chambon (LGME-U184, Strasbourg, France), respectively.

Statistical Analysis

Statistical analysis were performed using the paired t test(29) .


RESULTS

T3Ralpha Transcriptional Activity in HeLa Cells and in QM7 Myoblasts

We assessed the transcriptional activity of T3Ralpha by transient transfections experiments using a TRE-glo-CAT or a DR4-tk-CAT reporter gene together with the pRS c-Erb Aalpha1 expression vector.

In both cell types, co-transfection of the pRS c-Erb Aalpha1 expression vector induced a T3-dependent transcriptional activation of the TRE-glo-CAT construct (up to 10-fold, p < 0.001; Fig. 1, A and B). Therefore T3Ralpha displayed a similar transcriptional activity in QM7 myoblasts and in HeLa cells through a TRE.


Figure 1: Differences in c-Erb Aalpha1 transcriptional activity assessed in HeLa cells and in QM7 myoblasts when using a TRE or a DR4 TRE. Cells were transfected with 1 µg/dish of the TRE-glo-CAT (A and B) or the DR4-tk-CAT reporter gene (C and D) together with 2 µg of c-Erb A alpha1 expression vector. T3 (10M) was added in the culture medium when indicated. The results are normalized to beta-galactosidase activities and expressed as percentages of control cells CAT activity. A and C, HeLa cells. B and D, QM7 myoblasts. Three independent transfection experiments were performed in each case.



Using the DR4-tk-CAT reporter gene, we observed striking differences. A significant induction of CAT activity by liganded c-Erb Aalpha1 was recorded in HeLa cells (3-fold induction, p < 0.005; Fig. 1C). In QM7 myoblasts, T3Ralpha significantly decreased basal CAT activity in the absence of T3 (p < 0.025). The addition of the hormone abrogated this inhibition but did not induce any stimulation of CAT activity (Fig. 1D). Therefore, as expected, the liganded T3R was able to stimulate the expression of genes under the control of a DR4 TRE in HeLa cells. However, in QM7 myoblasts, T3Ralpha acts only as a transcriptional repressor of gene transcription through a DR4 TRE, and T3 abrogates this activity.

In Contrast to RAR alpha, T3Ralpha Inhibits AP-1 Activity in HeLa Cells but Not in QM7 Myoblasts

In order to compare T3Ralpha and RAR alpha interactions with the AP-1 complex in HeLa and QM7 cells, we performed transient transfection experiments in both cell types. The (AP-1)(5)-tk-CAT reporter gene and pRS c-erb Aalpha1 or pRS RAR alpha expression vectors were simultaneously co-transfected in these cells. AP-1 activity was stimulated by TPA.

As expected, T3Ralpha and RAR alpha activated by their cognate ligands (10M T3; 10M RA) strongly inhibited the TPA-stimulated AP-1 activity in HeLa cells (in both cases: -80%, p < 0.005; Fig. 2A). However, liganded T3Ralpha did not repress the TPA-induced AP-1 activity in QM7 cells (Fig. 2B) or in secondary quail myoblasts (Fig. 2C). Similar results were obtained when AP-1 activity was stimulated by chicken c-Jun overexpression using the -73 col-CAT reporter gene in QM7 cells (Fig. 2D).


Figure 2: In contrast to RAR alpha, ligand-activated c-Erb A alpha1 does not repress AP-1 activity in quail myoblasts. Cells were transfected with 1 µg/dish of the (AP-1)(5)-tk-CAT (A, B, C, and the left panel of D) or the -reporter gene (right panel of D) together with 2 µg of c-Erb A alpha1 expression vector or 2 µg of RAR alpha expression vector. TPA (50 ng/ml), T3 (10M), or retinoic acid (RA, 10M) were added in the culture medium when indicated. Stimulation of AP-1 activity was also achieved by transfection of 2 µg of c-Jun expression vector (C). The results are normalized to beta-galactosidase activities and expressed as percentages of TPA- or c-Jun-stimulated activity in control cells. A, HeLa cells. B, C, and D, QM7 myoblasts. Three independent transfection experiments were performed in each case.



However, in QM7 myoblasts the ligand-dependent repression by endogenous or exogenous RAR occurred as observed in HeLa cells (Fig. 2, A and B). Therefore, activated T3Ralpha and RAR alpha do not display a similar activity in myoblasts, whereas no difference could be noted in HeLa cells. These results suggest that interactions of these receptors with the AP-1 complex might not be mediated through strictly identical pathways.

Stimulation of AP-1 Activity Differently Affects T3Ralpha Transcriptional Activity According to the Cell Type and the TRE

To further investigate T3R-AP-1 relationships in myoblasts, we studied the influence of TPA treatment on the transactivation of the TRE-glo-CAT reporter by T3Ralpha. As previously reported in CV1 cells(14) , activation of this reporter construct by liganded T3R was abrogated by TPA treatment in HeLa cells (-90%, p < 0.001; Fig. 3A), whereas it was not affected in QM7 cells (Fig. 3B). However, using the same reporter gene, we observed that TPA abrogated RAR alpha transcriptional activity in both cell type (data not shown).


Figure 3: Stimulation of AP-1 activity differently affects c-Erb Aalpha1 transcriptional activity according to the cell type and the studied TRE. Cells were transfected with 1 µg/dish of the TRE-glo-CAT (A and B) or the DR4-tk-CAT reporter gene (C and D) together with 2 µg of c-Erb A alpha1 expression vector. AP-1 activity was stimulated by TPA treatment (50 ng/ml, A, B, C, and D) or transfection of 2 µg of c-Jun expression vector (D). T3 (10M) was added in the culture medium when indicated. The results are normalized to beta-galactosidase activities and expressed as percentages of control cells CAT activity. A and C, HeLa cells. B and D, QM7 myoblasts. Three independent transfection experiments were performed in each case.



More striking is the observation that in QM7 myoblasts, TPA induced a strong transcriptional activity of ligand-activated T3Ralpha (7-fold induction, p < 0.001) when using a DR4-tk-CAT gene reporter (Fig. 3D). Similar results were obtained using c-jun transfection (Fig. 3D). In contrast, using the same reporter gene, TPA treatment inhibited T3R transcriptional activity in HeLa cells, with an efficiency similar to that recorded using a TRE-glo-CAT gene reporter (Fig. 3C, p < 0.005).

These data suggest that TPA influence upon T3R transcriptional activity depends on the TRE and on the cell type. In particular, an elevated AP-1 activity induces transcriptional functionality of liganded T3R through a DR4 TRE in QM7 myoblasts.

A Major T3R-RXR Heterodimer Is Detected in HeLa Cells but Not in QM7 Myoblasts

In EMSA experiments, we studied the c-Erb Aalpha1 binding pattern to TREs using QM7 or HeLa cells transiently transfected with the T3Ralpha expression vector.

When T3R overexpressing HeLa cell extracts were incubated with a direct repeat sequence (DR4) probe, three complexes displaying different binding intensities were detected with complex II on the brink of detection (Fig. 4A, lanes 1 and 3). Using a TRE probe (Fig. 4B, lanes 3 and 5), no significant differences were observed in the binding ability of these three complexes. Using extracts of T3R-overexpressing QM7 myoblasts and a DR4 probe, only two fast mobility complexes (II and III) were observed (Fig. 4A, lanes 2 and 4). However, binding of complex III was strongly reduced when using a TRE probe (Fig. 4B, lanes 2 and 4).


Figure 4: C-Erb A alpha1 binding on DR4 or palindromic TREs differs in quail myoblasts and in HeLa cells. Gel retardation assays were performed using a DR4 (A) or a palindromic TRE (B). 10 µg of protein of whole extracts of c-Erb A- or poly(A)-expressing cells were used in each case. A, DR4 TRE. Lanes 1 and 3, c-Erb A alpha1 HeLa extracts. Lanes 2 and 4, c-Erb A alpha1 QM7 extracts. B, palindromic TRE. Lane 1, poly(A) HeLa extracts. Lanes 2 and 4, c-Erb A alpha1 QM7 extracts. Lanes 3 and 5, c-Erb A alpha1 HeLa extracts. Lane 6, poly(A) QM7 extracts.



When a 5-fold protein excess of control HeLa cellular extract was mixed with T3R-expressing QM7 cellular extract, binding of the receptor as three complexes was observed (Fig. 5). Formation of complex I was associated with a decrease of complexes II and III (Fig. 5, lane 2). Preincubation with an antibody raised against c-Erb Aalpha1 confirmed that T3R was a component of these three complexes (Fig. 5, lane 6). In agreement with this last observation, an excess of cold DR4 was found to compete binding of complexes I, II, and III to the probe (Fig. 5, lane 5). Interestingly, binding of complex I was also efficiently competed by molar excess of cold DR5 and DR1 probes (Fig. 5, lanes 3 and 4). These data suggest that a T3R partner able to bind to DR5 and DR1 responsive elements is expressed in HeLa but not in QM7 cells.


Figure 5: HeLa complementation restores a c-Erb A heterodimeric binding in HeLa cells competed by an excess of cold DR1 and DR5 probes. Gel retardation assays were performed using a TRE probe as described in the legend to Fig. 4. Lane 1, c-Erb A alpha1 QM7 extracts. Lane 2, c-Erb A alpha1 QM7 extracts (1 vol) + nontransfected HeLa extracts (5 vol). Lane 3, c-Erb A alpha1 QM7 extracts (1 vol) + nontransfected HeLa extracts (5 vol) + 200 ng cold DR1 oligonucleotide. Lane 4, c-Erb A alpha1 QM7 extracts (1 vol) + nontransfected HeLa extracts (5 vol) + 200 ng cold DR5 oligonucleotide. Lane 5, c-Erb A alpha1 QM7 extracts (1 vol) + nontransfected HeLa extracts (5 vol) + 200 ng cold DR4 oligonucleotide. Lane 6, c-Erb A alpha1 QM7 extracts (1 vol) + nontransfected HeLa extracts (5 vol) + c-Erb A alpha1 antiserum used at a final 1:5 dilution. Ab, antibody.



When RXR and T3Ralpha were co-expressed in QM7 myoblasts, a third complex was detected (Fig. 6, lane 7). It displayed the same mobility as complex I in QM7 expressing T3R extracts mixed with control extracts of HeLa cells (Fig. 6, lanes 7 and 8). In addition, preincubation of cell extracts with an antibody raised against all RXR isoforms suppressed the slow mobility signal (complex I) both in T3R-RXR-expressing myoblasts and in T3R-expressing HeLa cells (Fig. 6, lanes 4 and 5). In addition, binding of complexes II and III was not affected in these two cell types, thus demonstrating absence of RXR in these fast mobility complexes.


Figure 6: Evidence that RXR is the heterodimerization partner of c-Erb A in HeLa cells. Gel retardation assays were performed using a TRE probe as described in the legend to Fig. 4. Lane 1, extracts of c-Erb A alpha1 overexpressing QM7 + c-Erb A alpha1 antiserum at a final 1:5 dilution. Lane 2, extracts of c-Erb Aalpha1 and RXR overexpressing QM7 + c-Erb A alpha1 antiserum used at a final 1:5 dilution. Lane 3, c-Erb A alpha1 QM7 extracts (1 vol) + nontransfected HeLa extracts (5 vol) and c-Erb A alpha1 antiserum used at a final 1:5 dilution. Lane 4, c-Erb A alpha1 QM7 extracts + RXR antiserum used at a final 1:5 dilution. Lane 5, c-Erb A alpha1 HeLa extracts + RXR antiserum used at a final 1:5 dilution. Lane 6, c-Erb A alpha1 QM7 extracts. Lane 7, extracts of c-Erb A alpha1- and RXR -overexpressing QM7 cells. Lane 8, c-Erb A alpha1 QM7 extracts (1 vol) + nontransfected HeLa extracts (5 vol). Ab, antibody.



Because only two RXR isoforms (alpha and ) are characterized in avian species(24, 30) , expression of theses receptors was assessed by Northern blot in proliferative QM7 myoblasts. Whereas the two transcripts were easily detected in 4.5- and 5.5-day-old quail embryo in agreement with previous data(24, 30) , we failed to detect them in QM7 extracts (Fig. 7), in agreement with our EMSA data.


Figure 7: RXR isoforms are not expressed in proliferating QM7 myoblasts. RXR alpha (5 kilobases) and (2.5 kilobases) RNAs were detected by Northern blot analysis using homologous probe in chicken embryos but not in QM7 cells. Lane 1, total RNA from stage 25 chicken embryos (4.5 days in ovo). Lane 2, total RNA from stage 27 chicken embryos (5.5 days in ovo). Lane 3, total RNA from QM7 cells 48 h after seeding (T3 depleted culture medium). Lane 4, total RNA from QM7 cells 48 h after seeding (0.6 nM T3 supplemented medium). 15 and 30 µg were loaded in lanes 1 and 2 and in lanes 3 and 4, respectively.



RXR Expression Differently Influences T3R Transcriptional Activity According to the Nature of the TRE in QM7 Myoblasts

These results lead us to study the influence of RXR on T3R transcriptional activity in QM7 myoblasts. In transient transfection experiments performed in HeLa cells, we observed that RXR expression did not affect T3Ralpha transcriptional activity when using a TRE-glo-CAT reporter (Fig. 8A) but significantly enhanced this activity through a DR4-tk-CAT (Fig. 8C, p < 0.05).


Figure 8: RXR expression affects c-Erb A transcriptional activity when using a DR4 TRE but not a TRE construct. Cells were transfected with 1 µg/dish of the TRE-glo-CAT (A and B) or the DR4-tk-CAT reporter gene (C and D) together with 2 µg of c-Erb A alpha1 expression vector. A and C, HeLa cells were transfected with 2 µg of RXR expression vector when indicated. B and D, QM7 myoblasts were stably transfected using the RXR (+RXR) or the corresponding ``empty'' expression vector (control cells). E, RXR expression was assessed by comparison of the activation of a DR1-tk-CAT reporter gene in control and RXR-expressing myoblasts (1 µg of reporter gene was transiently transfected in cells grown without or with 9-cis-RA). T3 (10M) was added in the culture medium when indicated. The results are normalized to beta-galactosidase activities and expressed as percentages of control cells CAT activity. Three (A, B, C, and D) or five (E) independent transfection experiments were performed.



QM7 myoblasts were transfected with pRS c-RXR and pSV2-neo^R expression plasmids. Control myoblasts were obtained by co-transfecting pRS poly(A) vector with pSV2-neo^R plasmid. Stable expression of RXR was tested using a DR1 CAT reporter gene (Fig. 8E). Using a TRE-glo-CAT gene reporter, we observed that RXR expression did not significantly influence the liganded T3Ralpha transcriptional activity (Fig. 8B) but restored a transcriptional activity of liganded c-Erb A through a DR4 TRE in QM7 myoblasts (about 4-fold induction, p < 0.005; Fig. 8D). Therefore, this set of data brings evidence that T3R could be fully active through a synthetic TRE in the absence of RXR, whereas the T3R-RXR heterodimer is a major transcription complex on a DR4 TRE.

RXR Expression Restores the Functionality of T3Ralpha-AP-1 Interactions

The functionality of T3Ralpha-AP-1 interactions was also investigated in RXR -expressing myoblasts using the (AP-1)(5)-tk-CAT reporter plasmid. In absence of T3, stimulation of AP-1 activity by TPA was not affected in control or RXR-expressing myoblasts. A significant inhibition of CAT activity was recorded in RXR -expressing myoblasts in comparison with control myoblasts after 10M T3 stimulation (Fig. 9A; p < 0.025; RXR versus control myoblasts). Therefore, in contrast to control cells, T3-activated endogenous c-Erb A receptors inhibited AP-1 activity in RXR -expressing cells. In addition, T3Ralpha overexpression induced a strong inhibition of the TPA-stimulated AP-1 activity in RXR -expressing myoblasts after 10M T3 addition (Fig. 9A; p < 0.01, RXR versus control myoblasts). Similar results were recorded when expression of RXR or RXR alpha was performed in transient transfection experiments (data not shown). Furthermore, in control experiments, PPARalpha, RAR alpha, or COUP-Tf I expression failed to restore functionality of T3R-AP-1 interactions (data not shown). These data demonstrated that RXR expression is specifically required for inhibition of AP-1 activity by T3R.


Figure 9: RXR expression induces functionality of AP-1-c-Erb A interactions in QM7 myoblasts. QM7 myoblasts were stably transfected using the RXR (+RXR) or the corresponding empty expression vector (control cells). Thereafter, cells were transfected with 1 µg/dish of the [AP-1](5)-tk-CAT (A), TRE-glo-CAT (B), or DR4-tk-CAT reporter gene (C) together with 2 µg of c-Erb A alpha1 expression vector when indicated. TPA (50 ng/ml) and/or T3 (10M) were added in the culture medium when indicated. A, ligand-activated c-Erb A represses AP-1 activity in RXR -expressing myoblasts. B and C, stimulation of AP-1 activity inhibits c-Erb A transcriptional activity in RXR -expressing myoblasts when using a TREglo-CAT (B) or a DR4-tk-CAT reporter gene (C). Three independent experiments were performed. Similar results were obtained when RXR expression was obtained by transient transfections experiments.



Conversely, we demonstrated that RXR expression restored the inhibition of T3R transcriptional activity by AP-1 in QM7 myoblasts, whatever the TRE. Using a TRE, TPA stimulation of AP-1 activity strongly inhibited CAT induction by liganded T3R in RXR -expressing myoblasts (-85%, p < 0.005; Fig. 9B). Similar data were obtained using a DR4 TRE (-55%, p < 0.025; Fig. 9C), but a significant induction of CAT activity remained (3-fold induction, p < 0.01; Fig. 9C), suggesting that RXR expression partly preserved the transcriptional T3R activity through a DR4 TRE, even when AP-1 activity was elevated.

Physiological Consequences

Because c-Erb A-AP-1 interactions and T3R transcriptional activity are probably involved in the myogenic influence of T3(17, 18, 19) , we studied the influence of RXR expression on myoblast differentiation. QM7 myoblasts stably expressing pRS poly(A) or pRS cRXR were infected with the avian retrovirus CASBA 9 enabling expression of T3Ralpha as described previously(19) . Myoblast differentiation was studied by cyto-immunofluorescence experiments assessing myoblast fusion and connectin (a muscle-specific protein) expression. Whereas RXR expression did not affect differentiation by itself (Fig. 10, E versus A), it strongly potentiated the myogenic influence of T3 in control (Fig. 10, F versus B) or in T3R-overexpressing cells (Fig. 10, H versus D). Therefore, by altering the T3R-AP-1 pathway and T3R transcriptional activity, RXR expression modulates the stimulation of cell differentiation induced by T3.


Figure 10: RXR expression strongly enhances the stimulation of QM7 myoblast differentiation induced by T3 in control or c-Erb A alpha1 overexpressing cells. Connectin expression was assessed by cytoimmunofluorescence 2 days after the induction of differentiation with an antibody raised against connectin and a fluorescein-conjugated antibody raised against mouse immunoglobulins (times100). When indicated, 0.6 nM T3 was added in the culture medium. A, control cells. B, control cells + T3. C, T3R-expressing cells. D, T3R-expressing cells + T3. E, RXR -expressing cells. F, RXR -expressing cells + T3. G, T3R + RXR -expressing cells. H, T3R + RXR -expressing cells + T3. These microphotographs are representative of three independent experiments.




DISCUSSION

T3R-RXR Heterodimeric Binding Is Detected on a TRE Sequence in HeLa Cells but Not in Avian Myoblasts

We have shown that in both cell types, T3Ralpha binds to a palindromic TRE or a DR4 motif as two fast migrating complexes (II and III). We have detected a third slow migrating complex in HeLa cells (complex I). Moreover, addition of HeLa extracts to T3Ralpha overexpressing QM7 extracts induced formation of an additional complex with a mobility similar to that of complex I in myoblasts.

Because an excess of cold DR1 or DR5 probes efficiently competed complex I binding to a TRE, RXR, PPAR, or COUP-Tf I and II, which are able to bind to these response elements(31, 32, 33, 34, 35, 36, 37, 38, 39) , could be possible partners of T3Ralpha1 in HeLa cells. In EMSA experiments, using 4RX-1D12 antibody reacting against all RXR isoforms(40) , we identified RXR as the partner of T3R in complex I of HeLa cells. Furthermore, RXR expression induced formation of an additional complex in QM7 myoblasts with the same mobility as complex I.

These results were in line with some previous data suggesting that RXR isoforms are not expressed in proliferating myoblasts(41) . The present study also clearly indicates that RXR isoforms are weakly or not expressed in proliferative quail myoblasts: (i) transcriptional activity of 9-cis-RA from a DR1-tk-CAT reporter gene is not significant (Fig. 7); (ii) we failed to detect any T3R-RXR heterodimers in avian myoblasts (Fig. 6); and (iii) we failed to detect RXR mRNAs in our cell extracts.

QM7 Myoblasts Provide a Useful Experimental Model to Study the Influence of RXR upon T3R Activity

Numerous studies have been performed in order to define the exact influence of RXR on T3R activity. Whereas T3 induces dissociation of the T3R homodimer from a direct repeat TRE, the hormone does not affect this binding to a TRE or the binding of a T3R-RXR complex to a DR4 TRE(9, 10, 42) . In addition, several studies strongly suggest that T3R-RXR is the major T3 dependent-transcription complex through a direct repeat TRE(43, 44, 45) . Interestingly, our study clearly suggests that RXR is not required to induce a T3R transcriptional activity through a TRE; its efficiency is not affected by the absence of RXR, and conversely RXR expression does not influence T3R activity. Therefore, the T3R homodimer could be a fully active transcription complex on this particular TRE, in disagreement with previous data(4, 37, 46, 47) . Alternatively, such transcriptional activity could be induced by a T3R complex including a partner other than RXR.

However, T3-activated c-Erb A is devoided of transcriptional activity through a DR4 TRE in the absence of RXR: (i) T3R represses the basal expression level in absence of T3; (ii) the addition of the hormone abrogates this inhibition but does not stimulate transcription; (iii) in cells expressing RXR such as HeLa cells, liganded T3R displays a significant transcriptional activity through a DR4 TRE; and (iv) a similar activity is restored in myoblasts after RXR expression. Therefore these data clearly indicate that the T3R-RXR heterodimer is a major transcription complex on a DR4 TRE.

We report a striking exception to this rule. In QM7 cells, TPA stimulation or c-Jun overexpression induces a strong transcriptional activity to liganded T3R through a DR4 TRE. Disruption by T3 of the c-Erb A homodimer binding to a DR4 TRE (10, 42) probably explains the inability of T3R to increase gene transcription by itself. Therefore, it could be proposed that c-Jun acts by stabilizating homodimer binding to DNA. In addition, according to the hypothesis of Pfahl(16) , Jun could function as a bridging molecule between c-Erb A and the transcriptional machinery. However, because we have not observed a similar T3R-Jun interaction in HeLa cells, a muscle-specific protein could be involved in this bridging, as already proposed ( (16) and Fig. 11).


Figure 11: Hypothetic scheme involving AP-1 and RXR in the regulation of myoblast differentiation by T3. This hypothesis only considers results obtained using a DR4 TRE, closely related to natural TREs. It is based on the original proposition of Pfahl(16) . A, in proliferating myoblasts, a high AP-1 activity is recorded, thus repressing differentiation. In these conditions, according to the hypothesis of this study, c-Jun could function as a bridging molecule between T3R bound to a DR4 TRE and the transcriptional machinery. However, our data demonstrate that c-Jun induces a c-Erb A transcriptional activity in myoblasts but not in HeLa cells. These data suggest that another molecule, which may differ from cell type to cell type, is necessary to stabilize Jun binding to the receptor, in agreement with the proposition of Pfahl(16) . We propose that a muscle-specific factor (MSF) expressed in proliferative myoblasts plays this role. Such a mechanism could induce the activation of a set of genes involved in myogenic differentiation by T3. B, RXR expression induces formation of a T3R-AP-1 inactive complex either through DR4 or TPA responsive elements. Molecules involved in the bridging between the T3R homodimer and the transcriptional machinery could be directly released by RXR (inducing inactivity of the transcriptional complex) or indirectly (as a consequence of a disruption of the interaction of the transcription complex with DNA induced by RXR). Consequently, AP-1 activity is strongly inhibited, thus derepressing terminal differentiation. In these conditions, T3 responsive proteins synthetized in A could induce terminal differentiation. In differentiated cells, AP-1 activity remains depressed; T3-regulated gene expression is activated by RXR/T3R heterodimer. In this scheme, the T3 transcriptional pathway is always functional in relation to c-Jun (proliferation) or RXR (differentiation) expression. In conjunction with T3R (but probably with other nuclear receptors such as RARs), RXR represses AP-1 activity and overcomes the differentiation block.



Furthermore, we have obtained original data establishing a major role of RXR in of T3R-AP-1 functionality. In contrast to RAR alpha, T3R does not repress AP-1 activity in quail myoblasts. In addition, TPA stimulation of endogenous AP-1 activity does not inhibit the ligand-dependent transcriptional activity of T3R in these cells. Interestingly, in contrast to COUP-Tf I, PPAR alpha, or RAR alpha, RXR expression restored functionality of T3R-AP-1 interactions in quail myoblasts. Similar data were obtained with RXR alpha expression, thus suggesting that such an activity is specific of RXR isoforms. Functional interactions between RXR and T3Rs are well documented. However, until this work, it was assumed that RXR interaction with c-Erb A only affected the transcriptional activity of T3R. Our data extend the importance of this interaction to the functionality of T3R-AP-1 interactions. Consequently, they suggest that RXR affects all pathways of T3 action.

RXR Plays a Major Role in the Processes of Cell Differentiation

Numerous data underline the positive influence of T3 upon differentiation of a number of cell types including myoblasts, preadipocytes, chondrocytes, neurons, erythroblasts, etc. It is well established that RXR is involved in the stimulation of gene expression by T3, such as MyoD and myogenin gene expression in mouse myoblasts (48, 49) . It is also assumed that AP-1 activity regulates cell proliferation and differentiation. Its stimulation induces a strong inhibition of murine C2 myoblast differentiation(50) . Moreover, c-Jun inhibits the expression and activity of MyoD in C2 as in embryonic chicken myoblasts(51, 52) . We demonstrate that in addition to its strong influence upon c-Erb A transcriptional activity through a DR4 TRE, RXR expression is necessary to induce the inhibition of AP-1 activity by liganded T3R. As a consequence, RXR is not only involved in the stimulation of T3 target genes but also represses another set of genes inhibiting cell differentiation.

The physiological relevance of these data is well illustrated by the observation that RXR strongly potentiates the stimulation of differentiation induced by T3 in control or in c-Erb A overexpressing myoblasts. Because myoblast withdrawal from the cell cycle is the first event of terminal differentiation, an anticipated differentiation would probably result in a reduced number of muscle fibers and consequently an important impairment of muscle development. As previously observed, RXR is not expressed before induction of terminal differentiation in murine myoblasts(33) . Our data also indicate that in QM7 cells, RXR is not significantly expressed in proliferating cells. Therefore, RXR absence during the earliest steps of muscle development could provide a protection against such a precocious differentiation.

T3 regulates the expression of a large set of genes, involved in developmental processes and in cell metabolism regulation. A lack of RXR expression in proliferating myoblasts inducing a T3R transcriptional inefficiency would probably severely impair cell metabolism and viability if we consider that direct repeats are the most frequently described TREs. Interestingly, AP-1 activity could restore the T3R transcriptional activity. Therefore, our data indicate that alternative mechanisms are involved in the preservation of T3R activity: first, via AP-1 activity, which also inhibits differentiation, and second via RXR expression, which also inhibits AP-1 activity through a T3R-related mechanism and probably derepresses differentiation (Fig. 11).


FOOTNOTES

*
This work was partly supported by Roussel-Uclaf (France), l'Association Française contre les Myopathies, and l'Association de Recherche sur le Cancer. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed. Tel.: 33-67-61-22-19; Fax: 33-67-54-56-94.

(^1)
The abbreviations used are: T3R, triiodothyronine receptor; TRE, thyroid hormone response element; RAR, retinoic acid receptor; TPA, 12-O-tetradecanoylphorbol-13-acetate; CAT, chloramphenicol acetyltransferase; EMSA, electrophoretic mobility shift assay; DR, direct repeat sequence; PPAR, peroxisome proliferator-activated receptor; COUP-Tf, chicken ovalbumin upstream promoter-transcription factor.


ACKNOWLEDGEMENTS

We thank Professor P. Chambon (LGME-U184, Strasbourg, France), Dr. P. K. Vogt (The Scripps Research Institute, La Jolla, CA), Dr. P. Brickell (University College and Middlesex School of Medicine, London, UK), Dr. A. Rascle (ENS Lyon, France), Dr. L. J. De Groot (University of Chicago, IL), Dr. P. Balaguer (INSERM Montpellier, France), Dr. F. Pons (INSERM U300 Montpellier, France), Dr. P. B. Antin and Dr. C. P. Ordhal (San Francisco, CA) for providing (AP1)(5)-tk-CAT, DR4-tk-CAT reporter constructs and RXR antibody, c-Jun expression vector and -73 col CAT reporter gene, chicken RXR expression vector, TRE-glo-CAT reporter gene, c-Erb Aalpha1 antibody, DR1-tk-CAT reporter gene, monoclonal antibody raised against connectin, and the myoblast QM7 line, respectively. Dr. N. Tourkine is greatly acknowledged for critical reading. Dr. J. C. Nicolas and Dr. P. Balaguer (INSERM Montpellier, France) are acknowledged for help and discussion.


REFERENCES

  1. Forman, B. M., Yang, C. R., Au, M., Casanova, J., Ghysdael, J., and Samuels, H. H. (1989) Mol. Endocrinol. 3, 1610-1626 [Abstract/Free Full Text]
  2. Glass, C. K., Lipkin, S. M., Devary, O. V., and Rosenfeld, M. G. (1989) Cell 59, 697-708 [CrossRef][Medline] [Order article via Infotrieve]
  3. Hermann, T., Hoffmann, B., Zhang, X. K., Tran, P., and Pfahl, M. (1992) Mol. Endocrinol. 6, 1153-1162 [Abstract/Free Full Text]
  4. Zhang, X. K., Hoffman, B., Tran, P. B. V., Graupner, G., and Pfahl, M. (1992) Nature 355, 441-446 [CrossRef][Medline] [Order article via Infotrieve]
  5. Barettino, D., Bugge, T. H., Bartunek, P., Vivanco Ruiz, M. M., Sonntag-Buck, V., Beug, H., Zenke, M., and Stunnenberg, H. G. (1993) EMBO J. 12, 1343-1354 [Medline] [Order article via Infotrieve]
  6. Schräder, M., Müller, K. H., Nayeri, S., Kahlen, J. P., and Carlberg, C. (1994) Nature 370, 382-386 [CrossRef][Medline] [Order article via Infotrieve]
  7. Bogazzi, F., Hudson, L. D., and Nikodem, V. M. (1994) J. Biol. Chem. 269, 11683-11686 [Abstract/Free Full Text]
  8. Berrodin, T. J., Marks, M. S., Ozato, K., Linney, L., and Lazar, M. A. (1992) Mol. Endocrinol. 6, 1468-1478 [Abstract/Free Full Text]
  9. Yen, P. M., Darling, D. S., Carter, R. L., Forgione, M., Umeda, P. K., and Chin, W. W. (1992) J. Biol. Chem. 267, 3565-3568 [Abstract/Free Full Text]
  10. Andersson, M. L., Nordström, K., Demczuk, S., Harbers, M., and Vennström, B. (1992) Nucleic Acids Res. 20, 4803-4810 [Abstract/Free Full Text]
  11. Jonat, C., Rahmsdorf, H. J., Park, K. K., Cato, A. C. B., Gebel, S., Ponta, H., and Herrlich, P. (1990) Cell 62, 1189-1204 [CrossRef][Medline] [Order article via Infotrieve]
  12. Yang-Yen, H. F., Chambard, J. C., Sun, Y. L., Smeal, T., Schimdt, T. J., Drouin, J., and Karin M. (1990) Cell 62, 1205-1215 [CrossRef][Medline] [Order article via Infotrieve]
  13. Desbois, C., Aubert, D., Legrand, C., Pain, B., and Samarut, J. (1991a) Cell 67, 731-740 [CrossRef][Medline] [Order article via Infotrieve]
  14. Zhang, X. K., Wills, K. N., Husmann, N., Hermann, T, and Pfahl, M. (1991) Mol. Cell. Biol. 11, 6016-6025 [Abstract/Free Full Text]
  15. Schmidt, E. D. L., Cramer, S. J., and Offringa, R. (1993) Biochem. Biophys. Res. Commun. 192, 151-160 [CrossRef][Medline] [Order article via Infotrieve]
  16. Pfahl, M. (1993) Endocr. Rev. 14, 651-658 [Abstract/Free Full Text]
  17. Marchal, S., Cassar-Malek, I., Pons, F., Wrutniak, C., and Cabello, G. (1993) Biol. Cell 78, 191-197 [CrossRef][Medline] [Order article via Infotrieve]
  18. Marchal, S., Cassar-Malek, I., Magaud, J. P., Rouault, J. P., Wrutniak, C., and Cabello, G. (1995) Exp. Cell. Res. 220, 1-10 [CrossRef][Medline] [Order article via Infotrieve]
  19. Cassar-Malek, I., Marchal, S., Altabef, M., Wrutniak, C., Samarut, J., and Cabello, G. (1994) Oncogene 9, 2197-2206 [Medline] [Order article via Infotrieve]
  20. Antin, P. B., and Ordhal, C. P. (1991) Dev. Biol. 143, 111-121 [CrossRef][Medline] [Order article via Infotrieve]
  21. Samuels, H. H. Stanley, F., and Casanova, J. (1979) Endocrinology 105, 80-85 [Abstract/Free Full Text]
  22. Angel, P., Baumann, I., Stein, B., Delius, H., Rahmsdorf, H. J., and Herrlich, P. (1987) Mol. Cell. Biol. 7, 2256-2266 [Abstract/Free Full Text]
  23. Rascle, A., Ghysdael, J., and Samarut, J. (1994) Oncogene 9, 2853-2867 [Medline] [Order article via Infotrieve]
  24. Rowe, A., Eager, N. S., and Brickell, P. M. (1991) Development 111, 771-778 [Abstract]
  25. Wigler, M., Pellicer, A., Silverstein, S., and Axel, R. (1978) Cell 14, 725-731 [CrossRef][Medline] [Order article via Infotrieve]
  26. Nielsen, D. A., Chou, J., Mackrell, A. J., Casabadan, M. J., and Steiner, D. F. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 5198-5202 [Abstract/Free Full Text]
  27. Neumann, J. R., Morency, C. A., and Russian, K. O. (1987) BioTechniques 5, 444-447
  28. Graupner, G., Wills, K. M., Tzukerman, X. K., and Pfahl, M. (1989) Nature 340, 654-656
  29. Snedecor, G. W. (1961) Statistical Methods , p. 534, Iowa State University Press, Ames, IA
  30. Seleiro, E. A. P., Roxe, A., and Brickell, P.M . (1995) Roux's Arch. Dev. Biol. 204, 244-249
  31. Wang, L. H., Tsai, S. Y., Cook, R. G., Beattie, W. G., Tsai, M. J., and O'Malley, B. W. (1989) Nature 340, 163-166 [CrossRef][Medline] [Order article via Infotrieve]
  32. Kadowaki, Y., Toyoshima, K., and Yamamoto, T. (1992) Biochem. Biophys. Res. Commun. 183, 492-498 [CrossRef][Medline] [Order article via Infotrieve]
  33. Lutz, B., Kuratani, S., Cooney, A. J., Wawersik, S., Tsai, S. Y., Eichele, G., and Tsai, M. J. (1994) Development 120, 25-36 [Abstract]
  34. Tugwood, J. D., Issemann, I., Anderson, R. G., Bundell, K. R., McPheat, W. L., and Green, S. (1992) EMBO J. 11, 433-439 [Medline] [Order article via Infotrieve]
  35. Keller, H., and Whali, W. (1993) Trends. Endocrinol. Metab. 4, 291-296
  36. Mangelsdorf, D. J., Umesono, K., Kliewer, S. A., Borgmeyer, U., Ong, E. S., and Evans, R. M. (1991) Cell 66, 555-561 [CrossRef][Medline] [Order article via Infotrieve]
  37. Kliewer, S. A., Umesono, K., Mangelsdorf, D. J., and Evans, R. M. (1992) Nature 355, 446-449 [CrossRef][Medline] [Order article via Infotrieve]
  38. Bardot, O., Aldridge, T. C., Latruffe, N., and Green, S. (1993) Biochem. Biophys. Res. Commun. 192, 37-45 [CrossRef][Medline] [Order article via Infotrieve]
  39. Cooney, A. J., Leng, X., Tsai, S. Y., O'Malley, B. W., and Tsai, M.-J. (1993) J. Biol. Chem. 268, 4152-4160 [Abstract/Free Full Text]
  40. Rochette-Egly, C., Lutz, Y., Pfister, V., Heyberger, S., Scheuer, I., Chambon, P., and Gaub, M. P. (1994) Biochem. Biophys. Res. Commun. 204, 525-536 [CrossRef][Medline] [Order article via Infotrieve]
  41. Downes, M., Mynett-Johnson, L., and Muscat, G. E. O. (1994) Endocrinology 134, 2658-2661 [Abstract/Free Full Text]
  42. Ribeiro, R. C., Kushner, P. J., Apriletti, J. W., West, B. L., and Baxter, J. D. (1992) Mol. Endocrinol. 6, 1142-1152 [Abstract/Free Full Text]
  43. Perlmann, T., Rangarjian, P. N., Umesono, I., and Evans, R. M. (1993) Genes & Dev. 7, 1411-1422
  44. Kurokawa, R., Yu, V. C., Naar, A., Kyakumoto, S., Han, Z., Silverman, S., Rosenfeld, M. G., and Glass, C. K. (1993) Genes & Dev. 7, 1423-1435
  45. Miyamoto, T., Suzuki, S., and DeGroot, L. J. (1993) Mol. Endocrinol. 7, 224-231 [Abstract/Free Full Text]
  46. Marks, M. S., Hallenbeck, P. L., Nagata, T., Segars, J. H., Appella, E., Nikodem, V. M., and Ozato, K. (1992) EMBO J. 11, 1419-1435 [Medline] [Order article via Infotrieve]
  47. Piedrafita, F. J., Bendik, I., Ortiz, M. A., and Pfahl, M. (1995) Mol. Endocrinol. 9, 563-578 [Abstract/Free Full Text]
  48. Muscat, G. E. O., Mynett-Johnson, L., Dowhan, D., Downes, M., and Griggs R. (1994) Nucleic Acids Res. 22, 583-591 [Abstract/Free Full Text]
  49. Downes, M., Griggs, R., Atkins, A., Olson, E. N., and Muscat, G. E. O. (1994a) Cell Growth & Differ. 4, 901-909
  50. Park, K., Chung, M., and Kim, S. J. (1992) J. Biol. Chem. 267, 10810-10815 [Abstract/Free Full Text]
  51. Bengal, E., Ransone, L., Scharfmann, R., Dwarki, V. J., Tapscott, S. J., Weintraub, H., and Verma, I. M. (1992) Cell 68, 507-519 [CrossRef][Medline] [Order article via Infotrieve]
  52. Li, L., Chambard, J. C., Karin, M., and Olson, E. N. (1992) Genes & Dev. 6, 676-689

©1996 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
EndocrinologyHome page
M. Busson, L. Daury, P. Seyer, S. Grandemange, L. Pessemesse, F. Casas, C. Wrutniak-Cabello, and G. Cabello
Avian MyoD and c-Jun Coordinately Induce Transcriptional Activity of the 3,5,3'-Triiodothyronine Nuclear Receptor c-ErbA{alpha}1 in Proliferating Myoblasts
Endocrinology, July 1, 2006; 147(7): 3408 - 3418.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
F. Casas, M. Busson, S. Grandemange, P. Seyer, A. Carazo, L. Pessemesse, C. Wrutniak-Cabello, and G. Cabello
Characterization of a Novel Thyroid Hormone Receptor {alpha} Variant Involved in the Regulation of Myoblast Differentiation
Mol. Endocrinol., April 1, 2006; 20(4): 749 - 763.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
F. Casas, P. Rochard, A. Rodier, I. Cassar-Malek, S. Marchal-Victorion, R. J. Wiesner, G. Cabello, and C. Wrutniak
A Variant Form of the Nuclear Triiodothyronine Receptor c-ErbAalpha 1 Plays a Direct Role in Regulation of Mitochondrial RNA Synthesis
Mol. Cell. Biol., December 1, 1999; 19(12): 7913 - 7924.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cassar-Malek, I.
Right arrow Articles by Cabello, Gér.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cassar-Malek, I.
Right arrow Articles by Cabello, Gér.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1996 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement