Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Katagiri, K.
Right arrow Articles by Katagiri, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Katagiri, K.
Right arrow Articles by Katagiri, T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 271, Number 19, Issue of May 10, 1996 pp. 11557-11562
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
Lyn and Fgr Protein-tyrosine Kinases Prevent Apoptosis during Retinoic Acid-induced Granulocytic Differentiation of HL-60 Cells (*)

(Received for publication, May 30, 1995; and in revised form, February 1, 1996)

Koko Katagiri (1) (2)(§) Kazunari K. Yokoyama (3) Tadashi Yamamoto (4) Satoshi Omura (5) Shinkichi Irie (1) Takuya Katagiri (2)(§)

From the  (1)Institute of Biomatrix, Nippi Inc., 1-1-1 Senju-Midori-chou, Adachi-ku, Tokyo 120, the (2)Department of Molecular Immunology, Center for Basic Research, The Kitasato Institute, 5-9-1 Shirokane, Minato-ku, Tokyo 108, (3)Tsukuba Life Science Center, The Institute of Physical and Chemical Research, 3-1-1 Koyadai, Tsukuba, Ibaraki 305, the (4)Department of Oncology, Institute of Medical Science, University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108, and the (5)Research Center for Biological Function, The Kitasato Institute, 5-9-1 Shirokane, Minato-ku, Tokyo 108, Japan

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES

ABSTRACT

The human promyelocytic leukemia cell line HL-60 can be induced to differentiate toward neutrophils and subsequently die via apoptosis in vitro. In this paper, we investigated the roles of protein-tyrosine kinases (PTKs) in retinoic acid (RA)-induced granulocytic differentiation of HL-60 cells. Accompanying the RA-induced differentiation, activities of src family PTKs Lyn and Fgr became detected and reached a plateau 2 days after the stimulation. The immunoblotting using anti-phosphotyrosine antibody (PY-20) showed that the proteins of 56 and 53 kDa were predominantly tyrosine-phosphorylated at day 2. Adsorption and immunoprecipitation of the cell lysate by specific antibodies evidenced that these phosphotyrosine-containing proteins are Lyn and Fgr PTKs. The degree of both activities and tyrosine phosphorylation of these PTKs was reduced to be minimal at day 5 when the HL-60 cells start to die by apoptosis. The inhibitors of PTKs, herbimycin A and genistein, were demonstrated to cause premature cell death of HL-60 cells in the presence of RA. The death was the consequence of an apoptotic process. The RA-treated HL-60 cells, when incubated with specific c-lyn or c-fgr antisense oligodeoxynucleotide, also underwent premature death at day 2. These data implicate that Lyn and Fgr PTKs prevent programmed cell death to promote granulocytic differentiation of HL-60 cells.


INTRODUCTION

Retinoic acid (RA) (^1)functions as an important bioregulator in cell differentiation and development(1, 2) . Due to its potent activity in inducing differentiation and growth arrest of leukemic cells from acute promyelocytic leukemia (APL M3) patients, RA has been utilized in treatment of these leukemia patients (3, 4) .

The human promyelocytic leukemia cell line HL-60, upon stimulation with RA in vitro, undergoes differentiation toward neutrophils at day 3 to day 4 and dies via apoptosis at day 6 to day 8(5) . Neutrophil is the first cell to accumulate at the site of inflammation and plays a critical role in inducing various inflammatory events. As soon as neutrophils complete their roles at the inflammatory site, they die via apoptosis and are removed by macrophages to limit tissue injury since they release harmful molecules such as proteolytic enzymes(6, 7) . Therefore, molecular analysis for the events occurring after stimulation of HL-60 cells with RA will provide useful information on both the differentiation and the apoptosis of neutrophils.

Apoptosis requires active and coordinated regulation of specific molecules. Bcl-2 is a potent suppressor of death and the balances between Bcl-2 and a death-inducing signal determine the occurrence of apoptosis(8) . It was demonstrated that expression of Bcl-2 decreased markedly during RA-induced granulocytic differentiation of HL-60 cells (9, 10) .

RA binds to specific nuclear receptors (RARs) and the RAbulletRAR complex is thought to regulate the transcription of target genes(11, 12) . However, little is known about the intracellular events that lead to differentiation and apoptosis of the responsive cells subsequent to RAbulletRAR interaction(13) .

The protein-tyrosine kinases (PTKs) play crucial roles in the intracellular signal transduction for growth and differentiation of the cells(14) . Recently, we reported that PTKs play essential roles in TPA-induced monocytic differentiation of HL-60 cells(15, 16, 17) , and that Ras and GTPase-activating protein complex function downstream of PTKs during the differentiation(18) . In addition, our previous paper described the induction of src family PTKs, lyn and fgr mRNA during RA-induced granulocytic differentiation(15) . We have therefore investigated the role of PTKs in the differentiation.

In the current study, during RA-induced granulocytic differentiation of HL-60 cells, both Fgr and Lyn PTKs were demonstrated to be superinduced and tyrosine-phosphorylated. In the presence of RA, treatment with specific c-lyn or c-fgr antisense oligodeoxynucleotides as well as that with herbimycin A or genistein, led to premature death of the HL-60 cells. Thus, Lyn and Fgr PTKs are assumed to exert as anti-apoptotic agents to promote granulocytic differentiation of HL-60 cells.


MATERIALS AND METHODS

Cells

HL-60 cells were suspended with RPMI 1640 medium containing 10% fetal calf serum. For differentiation experiments, growing cells were subcultured at a density of 2 times 10^5 cells/ml, and inducers were added to the medium at the following concentrations: 1 µM for retinoic acid (RA) (Sigma) and 10 ng/ml for 12-O-tetradecanoylphorbol-13-acetate (TPA) (Sigma). Herbimycin A (0.1 and 0.2 µg/ml) (Life Technologies, Inc.) and genistein (10 µg/ml) (Funakoshi Inc., Tokyo, Japan) were also added to the medium. After incubation of HL-60 cells with these drugs for the indicated time, the cells were washed twice with phosphate-buffered saline.

Antibodies

Rabbit polyclonal anti-Fyn, anti-Lyn, anti-Fgr, anti-Hck antibodies and monoclonal anti-Vav antibody were purchased from Santa Cruz Biotechnology, Inc., Santa Cruz, CA. Rabbit polyclonal anti-Syk was obtained from Upstate Biotechnology, Inc., Lake Placid, NY. Rabbit polyclonal anti-Btk and anti-Fes antibodies were kindly donated by Drs. S. Tsukada (Osaka University) and Y. Hanazono (University of Tokyo), respectively. These antibodies were used in the immunoprecipitation as described below. I-Labeled monoclonal anti-phosphotyrosine PY-20 (ICN Radiochemicals), peroxidase-conjugated anti-rabbit Ig F(ab`)2 fragments (Amersham), and peroxidase-conjugated anti-mouse Ig F(ab`)2 fragments (Amersham) were used in the immunoblotting as described below.

Immunoprecipitation

RA-treated cells (1 times 10^7) were collected by centrifugation and lysed at 0 °C for 60 min in 1 ml of lysis buffer (1% Triton X-100, 20 mM Tris aminomethane, 150 mM NaCl, 2 mM EDTA, 2 µg/ml aprotinin, 2 µg/ml leupeptin, 1 mM phenylmethylsulfonyl fluoride, 1 mM Na(3)VO(4), 10 mM NaF, pH 7.6)(19) . The supernatant was precleared by incubation with an excess amount of protein G-Sepharose 4B (Pharmacia Biotech Inc.). The cleared lysate was incubated with various kinds of antibodies and protein G-Sepharose 4B. The immunoprecipitates were washed with the lysis buffer extensively.

Immunoblotting

The 10 µl of the cell lysate (10^6 cells) or the immunoprecipitated proteins were subjected to electrophoresis on 9% polyacrylamide-SDS gel. The transfer of the proteins to polyvinylidene difluoride membrane (PVDF, Pharmacia) and the blotting with I-PY-20 or peroxidase-conjugated antibody were carried out as described(19) . ECL (enhanced chemiluminescence) system (Amersham) was applied to detection.

Immune Complex Kinase Assay

The immunoprecipitates described above were then incubated at 30 °C for 10 min with 40 µl of kinase buffer (100 mM NaCl, 20 mM Hepes, pH 7.5, 10 mM MnCl(2)) containing 1 µM ATP and 10 µCi of [-P]ATP (3000 Ci/mmol; 1 Ci = 37 GBq).

The P-labeled samples were subjected to electrophoresis on 9% polyacrylamide-SDS gels. The gels were treated with 1 M KOH at 55 °C for 2 h to detect tyrosine-phosphorylated protein molecules, dried, and subjected to Fuji RX film at -80 °C.

Morphologic Analysis

The granulocytic differentiation was evaluated on Giemsa-Wright stained cytospin preparation.

Analysis of DNA Fragmentation

Fragmentation of DNA was assayed as described previously(20) . HL-60 cells (5 times 10^6) were treated with drugs and lysed in 0.5 ml of lysis buffer containing 20 mM Tris-HCl, pH 8.0, 1 mM EDTA, 1% sodium dodecyl sulfate (SDS), and 50 µg/ml proteinase K (Sigma). After 4 h at 37 °C, DNA was extracted with an equal volume of Tris buffer-saturated phenol and with chloroform/isoamyl alcohol (24:1) and precipitated with ethanol. DNA was treated with RNase A (50 µg/ml; Sigma) for 5 h and then with proteinase K (120 µg) for 5 h. DNA was separated (5 µg of DNA per lane) by horizontal electrophoresis (2 V/cm) in 1% agarose gel with running buffer containing 90 mM Tris-HCl, 90 mM boric acid, and 2 mM EDTA, pH 8.0, stained with 0.5 µg/ml ethidium bromide, and visualized under ultraviolet light.

Treatment of HL-60 Cells with Antisense Phosphorothioate Oligonucleotides (PSNs)

We synthesized antisense PSNs complementary to positions 142-162 of human c-fgr sequence (CCTGGAATGGGCTGTGTGTTC) and 292-312 of human c-lyn sequence (GGAAATATGGGATGTATAAAA)(21, 22) . Sense PSNs corresponding to each position were prepared as controls. The antisense PSN sequences did not have significant homology with any other sequences in the data base. All experiments using antisense PSNs were repeated three times, and the results obtained were essentially the same.

The antisense and sense PSNs were synthesized on a synthesizer (model 392; Applied Biosystems, Inc., Foster City, CA), precipitated with ethanol, and taken up in media containing 20 mM Hepes. Sense (S) or antisense (AS) c-lyn or S or AS c-fgr PSNs were added to the culture medium for HL-60 cells at the concentration of 20 µM. After 4 days of PSN treatment, the culture medium was replaced with fresh medium containing 20 µM S or AS PSNs, and 1 µM of RA was added to the cultures.


RESULTS

Expressions of PTKs in RA- or TPA-treated HL-60 Cells

In our previous reports(15) , we investigated mRNA expressions and functions of some members of src family PTKs in monocytic differentiation of HL-60 cells. In this study, we examined expressions of 9 src-related cytoplasmic PTKs during granulocytic differentiation of HL-60 cells in comparison with monocytic one. By in vitro immune complex kinase assay using specific antibodies, Fgr and Lyn src family PTKs were found to be induced abundantly within 12 h after RA stimulation, peak at day 2 (Fig. 1), and then decrease to the minimum 5 days after the stimulation (data not shown). While the activities of Hck and Fyn src family PTKs were specifically detected in TPA-treated cells (Fig. 1), Btk was expressed abundantly in nontreated HL-60 cells and remained unchanged after stimulation with TPA or RA (Fig. 1). Syk was expressed in either RA- or TPA-treated cells (Fig. 1). Both Src and Yes were expressed weakly without change in their level upon stimulation, and Lck was not detected during the differentiation (data not shown).


Figure 1: Induction of p56 and p53/p56 PTKs during RA-induced granulocytic differentiation of HL-60 cells. Lysates of untreated HL-60 cells (None), the cells treated for 48 h with retinoic acid (RA) or with TPA (TPA) were immunoprecipitated with anti-Fgr, anti-Lyn, anti-Fyn, anti-Hck, anti-Syk, or anti-Btk antibody. The immunoprecipitates were subjected to immune complex kinase assay and analyzed by SDS-PAGE as described under ``Materials and Methods.'' The autoradiograph was exposed for 1 h at -80 °C with an intensifier screen. The position of each PTK is indicated.



Both mRNAs and proteins of the Lyn and Fgr PTKs were also detected abundantly 2 days after RA treatment ((15) , Fig. 2). However, we could not determine whether the PTKs were activated or not since the degrees of their expressions were very low in untreated HL-60 cells.


Figure 2: Upper, protein tyrosine phosphorylation in HL-60 cells after stimulation with retinoic acid. The lysates from the HL-60 cells (5 times 10^4 cells) stimulated with RA for 0, 1, 2, or 5 days were immunoblotted with I-labeled PY-20. The autoradiograph was exposed for 24 h at -80 °C with an intensifier screen. The positions of major bands are indicated with an arrowhead. Molecular masses in kDa are indicated on the left. Lower, expressions of Lyn, Fgr, and actin in HL-60 cells after stimulation with RA. The lysates from the HL-60 cells (5 times 10^4 cells) stimulated with RA for 0, 1, 2, or 5 days were immunoblotted with anti-Lyn, anti-Fgr, and anti-actin. The bands were detected by ECL assay system (Amersham).



Tyrosine Phosphorylation of Protein Molecules during Granulocytic Differentiation

By using immunoblotting with anti-phosphotyrosine antibody (PY-20), tyrosine phosphorylation of protein molecules were investigated during RA-induced granulocytic differentiation of HL-60 cells (Fig. 2). Protein tyrosine phosphorylation was detected within 12 h after the stimulation, reached a plateau at day 2, and declined thereafter to the minimum at day 5 (Fig. 2). As shown in Fig. 2, the protein molecules of molecular mass 53 to 56 kDa were markedly tyrosine-phosphorylated, and the tyrosine phosphorylation of that of the 95-kDa protein was relatively weak. To identify the tyrosine-phosphorylated proteins, we examined the tyrosine phosphorylation of Lyn (p53 and p56) and Fgr (p56) because the kinetics of expressions of both PTKs were similar to those of tyrosine phosphorylation of the 53- to 56-kDa proteins; that is, expressions of both Lyn and Fgr were predominantly induced at day 2 after RA stimulation and declined thereafter ( Fig. 1and Fig. 2). As shown in Fig. 3, left, Lyn and Fgr PTKs were highly tyrosine-phosphorylated in RA-treated cells, but not in TPA-treated cells. Absorption with anti-Lyn and anti-Fgr antibody plus protein G-Sepharose 4B demonstrated that the major tyrosine-phosphorylated proteins of 53 to 56 kDa were Lyn and Fgr PTKs (Fig. 3, right). These data suggest the involvement of these PTKs in the signaling generated by RAbulletRAR interaction in HL-60 cells. We next investigated the tyrosine phosphorylation of a proto-oncogene product Vav (p95) as a candidate molecule for the 95-kDa protein phosphorylated upon RA stimulation (Fig. 4). The Vav is specifically expressed in hematopoietic cells (23) and is tyrosine-phosphorylated upon stimulation of the cells with antigen or mitogen(24) . As shown in Fig. 4, Vav was markedly (10-fold) tyrosine-phosphorylated at 48 h after stimulation with RA, while the amount of Vav was not changed during that time.


Figure 3: Lyn and Fgr were major phosphotyrosine-containing proteins in RA-treated HL-60 cells. Left, p53/56 and p56 were tyrosine-phosphorylated in RA-treated HL-60 cells. The lysates from the HL-60 cells (2.5 times 10^6 cells) treated with TPA or RA for 48 h were immunoprecipitated with polyclonal anti-Lyn or anti-Fgr antibodies and protein G-Sepharose 4B. The immunoprecipitates were subjected to electrophoresis, transferred to a polyvinylidene difluoride (PVDF) filter, and immunoblotted with I-labeled PY-20. The autoradiograph was exposed for 12 h at -80 °C with an intensifier screen. The positions of Lyn and Fgr are indicated by arrowheads on the right. Molecular masses in kDa are indicated on the left. Right, the absorption of phosphorylated proteins with anti-Lyn plus anti-Fgr antibodies. The lysates from RA-treated HL-60 cells (1 times 10^6 cells) were immunoprecipitated with polyclonal anti-Lyn plus anti-Fgr (anti-Lyn + anti-Fgr) or rabbit IgG (RIg) and protein G-Sepharose 4B. The supernatant was subjected to SDS-PAGE, transferred to a PVDF filter, and immunoblotted with I-labeled PY-20. The exposure time was 12 h at -80 °C with an intensifier screen.




Figure 4: Tyrosine phosphorylation of p95 in RA-treated HL-60 cells. Upper, the RIPA lysates from RA- or TPA-treated HL-60 cells (2.5 times 10^6 cells) for 48 h were immunoprecipitated with monoclonal anti-Vav or mouse IgG (mIg) as a control and protein G-Sepharose. These immunoprecipitated proteins were subjected to SDS-PAGE, transferred to a PVDF filter, and immunoblotted with I-labeled PY-20. The autoradiograph was exposed for 12 h at -80 °C with an intensifier screen. Lower, the same whole lysates were subjected to SDS-PAGE and transferred to a PVDF filter and then immunoblotted with anti-Vav antibody. The bands detected by the ECL assay system (Amersham) showed that an almost equal amount of Vav protein exists in each lysate.



Effect of Herbimycin A on Granulocytic Differentiation of HL-60 Cells

We have reported that herbimycin A prevented TPA-induced monocytic differentiation of HL-60 cells and suggested an important role of tyrosine kinases in the differentiation(16) . To know the role of tyrosine kinases in the RA-induced granulocytic differentiation of HL-60 cells, we investigated the effects of herbimycin A on the differentiation. By using a method of Giemsa-Wright staining of the cells, we observed that RA treatment of HL-60 cells induced terminal differentiation into granulocytic cells at day 3, and, subsequently, they died by apoptosis at day 7 (Fig. 5A). Unexpectedly, herbimycin A in combination with RA inhibited cell growth and caused cell death of HL-60 cells at 48 h after stimulation (Fig. 5, A and B). The cells treated with RA plus herbimycin A revealed fragments of nuclei and highly condensed chromatin, which are the most striking feature of apoptosis (Fig. 5A). Genistein, an another tyrosine kinase inhibitor, also induced an apoptotic cell death of HL-60 cells when used together with RA (Fig. 5A). Morphological change in HL-60 cells characteristic of granulocytic differentiation was never observed before apoptotic death of the cells. While, neither herbimycin A alone nor herbimycin A plus TPA did cause apoptosis of HL-60 cells (Fig. 5, A and B).


Figure 5: A, morphological characteristics of cell death of the HL-60 cells after treatment with RA plus PTK inhibitors. Morphological characteristics of granulocytes were observed when HL-60 cells were incubated with RA for 0 days (RA 0d.), 2 days (RA 2d.), 3 days (RA 3d.), and 7 days (RA 7d.); proliferating HL-60 cells 2 days after treatment with 0.2 µg/ml herbimycin A alone (Herbimycin A 2d.); progressive cell death of HL-60 cells treated with RA plus 0.2 µg/ml herbimycin A for 2 days (RA + Herbimycin A 2d.), cell death of HL-60 cells treated with RA plus 10 µg/ml genistein for 2 days (RA + Genistein 2d.). B, DNA fragmentation in the HL-60 cells treated with RA plus herbimycin A. The high molecular mass DNA extracted from untreated HL-60 cells (None), from HL-60 cells treated with 0.2 µg/ml herbimycin A (H0.2), from HL-60 cells induced to differentiate with 1 µM RA for 2 days (RA), from HL-60 cells induced to differentiate with 10 ng/ml TPA (TPA) for 2 days, from HL-60 cells treated with TPA plus herbimycin A (TPA+H0.2), or fragmented DNA from HL-60 cells treated with RA plus herbimycin A (RA+H0.2) for 2 days were subjected to agarose gel electrophoresis. The phage DNA digested with restriction endonucleases EcoRI and HindIII is indicated as a DNA molecular mass marker (Marker).



Apoptosis is in many cases associated with a characteristic oligonucleosomal DNA fragmentation induced by intrinsic endonuclease(s). Apoptotic cell death of HL-60 cells treated with herbimycin A plus RA was further confirmed by detecting the ladder pattern of DNA cleavage in these cells (Fig. 5B), whereas DNA remained unfragmented in preparations obtained from HL-60 cells treated with RA, herbimycin A, or TPA plus herbimycin A for 48 h (Fig. 5B).

Induction of Apoptosis in lyn or fgr Antisense PSN-treated HL-60 Cells in the Presence of RA

As tyrosine kinases were demonstrated to be involved in the apoptosis of HL-60 cells induced by RA (Fig. 5), we focused on the two tyrosine kinases, Lyn and Fgr, and prepared antisense phosphorothioate oligonucleotides (PSNs) specific for them according to the method as described under ``Materials and Methods.'' We first examined the effects of antisense PSNs on the expression of Lyn and Fgr PTKs in HL-60 cells by an immunoblotting. Although both PTKs were detectable in untreated HL-60 cells after RA stimulation, they were strongly suppressed when the cells were cultured in the presence of lyn or fgr antisense PSNs (Fig. 6A). In contrast, the cells treated with each sense PSN expressed levels of Lyn and Fgr PTKs similar to those in untreated cells after RA stimulation (Fig. 6A). In addition, these antisense PSNs did not affect the expression of Btk PTK in HL-60 cells (Fig. 6A). When the antisense PSN-treated HL-60 cells were stimulated with RA for 48 h, more than 80% of the cells were dead with immature characteristics (Fig. 6B). However, sense PSN-treated HL-60 cells were demonstrated to have no sign for cell death. The cell death appeared to be characteristics of apoptosis under microscopic observation (data not shown).


Figure 6: A, expressions of the p53/p56and p56 in HL-60 cells treated with the c-lyn S or AS or c-fgr S or AS. Sense (S) or antisense (AS) c-lyn or S or ASc-fgr PSNs were added to the culture medium of HL-60 cells at the concentration of 20 µM. After 4 days of PSN treatment, the culture medium was replaced with fresh medium containing 20 µM S or AS PSNs, and 1 µM RA was added to the cultures. Lysates of the untreated (Untreated) or PSN-treated HL-60 cells (lyn S or AS, or fgr S or AS) were obtained at 24 h after RA stimulation and subjected to SDS-PAGE, transferred to a PVDF filter, and immunoblotted with anti-Lyn, anti-Fgr, or anti-Btk, respectively. The position of Lyn, Fgr, or Btk was indicated by an arrowhead. B, viability of HL-60 cells cultured for 2 days in the absence (None) or presence (RA) of RA after treatment with c-lyn or c-fgr S or AS oligomer. Cell viability was assessed by the ability of the cells to exclude trypan blue. The result is a typical one, and the experiment was repeated three times with similar results. The average and S.E. of triplicate determinations are shown.




DISCUSSION

The regulation system of apoptosis is highly organized, and the balances between inducers and repressors determine the occurrence of apoptosis. In the current study, two cytoplasmic tyrosine kinases, Lyn and Fgr, were demonstrated to be members of the repressors for apoptosis of neutrophils. Both Lyn and Fgr PTKs were shown to be induced and tyrosine-phosphorylated during differentiation of HL-60 cells toward neutrophils. After completion of the differentiation, the expressions of these PTKs were reduced to be minimal and the cells die via apoptosis. Using antisense oligonucleotides specific for Lyn or Fgr PTK, it was demonstrated that inhibition of expression of either PTK upon RA stimulation leads to premature cell death via apoptosis. Consistent with the results, herbimycin A in combination with RA was exhibited to cause premature cell death of the HL-60 cells. These data imply that Lyn and Fgr PTKs exert an antiapoptotic effect to promote differentiation of HL-60 cells toward neutrophils. Antiapoptotic function of PTKs in neutrophils was also suggested by Yousefi et al.(25) who demonstrated that GM-CSF-induced tyrosine phosphorylation prevents apoptosis of human peripheral blood neutrophils. In our study, at least two possibilities exist to explain antiapoptotic roles of Lyn and Fgr PTKs in the granulocytic differentiation of HL-60 cells; one is their functioning in independent signal transduction pathways which converge to join each other at the terminal, and the other is their direct interaction or ordered functions on the same pathway which is required for antiapoptotic function. As yet, we have no evidence for supporting the one.

In neutrophils, Lyn has been demonstrated to be activated and associated with phosphatidylinositol 3-kinase accompanying the stimulation with granulocyte macrophage-colony stimulating factor (GM-CSF)(26) . It was shown that granulocyte-colony stimulating factor (G-CSF) activated Lyn and Syk (p72), both of which were then recruited into G-CSF receptor signaling complex in human peripheral neutrophils(27) . While the evidence has been reported that Fgr also function in human neutrophils, a chemotactic agonist induces translocation of Fgr from an intracellular compartment to the plasma membrane and that Fgr is associated to FcIIR on neutrophils(28) . Recently, Berton et al.(29) demonstrated that agonists of beta2 integrin activation such as tumor necrosis factor, TPA, and fMet-Leu-Phe enhance the kinase activity of Fgr in human neutrophils. These data suggest that Fgr PTK plays a crucial role in the expression of function by peripheral neutrophils at the inflammatory site. Our data on the antiapoptotic role of Lyn and Fgr PTK in the granulocytic differentiation of HL-60 cells will add a new insight into the function of these PTKs in the neutrophils. Further studies on the analyses of HL-60 transfectants expressing active Lyn or Fgr or both PTKs will provide more information on the roles of these PTKs in the apoptosis and differentiation of human neutrophils. Identification of the molecules interacting with these PTKs in RA-stimulated HL-60 cells will also give information on the function of these PTKs in neutrophils. These studies are now in progress in our laboratory.

While our study is in progress, Manfredini et al.(30) demonstrated that the HL-60 cells which had been induced to differentiate into granulocytes underwent premature death when incubated with antisense oligonucleotide specific for c-fes gene which encodes a Fes PTK (p92). In our system, accompanying the differentiation of HL-60 cells toward neutrophils, expression of Fes PTK is increased without detectable levels of the tyrosine phosphorylation of Fes PTK (data not shown). To get a clue to understanding the relation of Lyn, Fgr, and Fes PTK in the antiapoptotic signaling pathway, we tried to investigate the possible co-immunoprecipitation with each other during RA-induced differentiation. However, no association with each other was observed.

Several genes have been identified that participate as either inducers or repressors of programmed cell death. Among these, Bcl-2 and Bax are homologous proteins that have opposing effects on cell life and death. Bcl-2 serves to prolong cell survival while Bax acts as an accelerator of apoptosis(31, 32) . Previous papers reported that Bcl-2 decreased during RA-induced differentiation of HL-60 cells into granulocytes which subsequently undergo apoptosis and that HL-60 cells which hyperexpressed Bcl-2 showed little evidence for apoptosis(9, 10) . In our study, we also observed the prompt decrease in expression of Bcl-2 protein by HL-60 cells after RA stimulation (data not shown). Expression of Bax protein was shown to be reduced far more slowly accompanying the differentiation (data not shown). Thus, the ratio of Bcl-2 and Bax was markedly reduced at an early phase of the differentiation. Therefore, some molecules, for which we propose Lyn and Fgr PTK, should protect cells from apoptosis instead of Bcl-2 to promote differentiation toward neutrophils. Recently, various proteins such as Bcl-x(L), Bcl-x(S), Bad, and Bag-1 were cloned as molecules associated with Bcl-2 or Bax and demonstrated to be involved in programmed cell death(33, 34, 35) . Thus, the mechanisms of the antiapoptotic function of Lyn and Fgr PTK should be considered by taking the balances of the above Bcl-2-related molecules into account.

In addition to Lyn and Fgr PTKs, we identified preferentially tyrosine-phosphorylated proteins as p95 (Vav). Vav is expressed specifically in hematopoietic cells and has the guanine nucleotide releasing factor activity for Ras which is regulated by tyrosine kinase(36) . In our previous work, we could not find activation of Ras during RA-induced differentiation of HL-60 cells while the activation of Ras was observed accompanying TPA-induced differentiation(18) . As the degree of tyrosine phosphorylation of Vav upon RA stimulation is higher than that upon TPA stimulation, Vav might have functions other than working as a guanine nucleotide releasing factor for Ras. In this term, study on the differentiation of HL-60 cells will provide useful information on physiological function of Vav.

As RA induces growth arrest and terminal differentiation in some promyelocytic leukemia cell lines, RA has been utilized as a differentiation therapy for treatment of patients with acute promyelocytic leukemia(3, 4) . This apparently resulted in remission of the patients without causing marrow aplasia(3, 4) . In the current study, RA in combination with a small amount of herbimycin A was found to be a potent agent to induce apoptosis of promyelocytic leukemia cell line HL-60. Although its validity and toxicity should be scrutinized using experimental animals, careful treatment with the combination of the agents will improve the remedial value exhibited by RA alone. For more specifically refined treatment, further studies on the molecular mechanisms of antiapoptotic functions of tyrosine kinases should be required.


FOOTNOTES

*
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence and reprint requests should be addressed: Dept. of Molecular Immunology, Center for Basic Research, The Kitasato Institute, 5-9-1 Shirokane, Minato-ku, Tokyo 108, Japan. Tel: 81-3-3444-6161 (Ext. 2109); Fax: 81-3-3444-6637.

(^1)
The abbreviations used are: RA, retinoic acid; RAR, retinoic acid receptor; PTK, protein-tyrosine kinase; TPA, 12-O-tetradecanoylphorbol-13-acetate; PVDF, polyvinylidene difluoride; PSN, antisense phosphorothioate oligonucleotide; GM-CSF, granulocyte macrophage-colony stimulating factor; PAGE, polyacrylamide gel electrophoresis.


REFERENCES

  1. Strickland, S., and Mahdavi, V. (1978) Cell 15, 393-403 [CrossRef][Medline] [Order article via Infotrieve]
  2. Breitman, T. R., Selonick, S. E., and Collins, S. J. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 2936-2940 [Abstract/Free Full Text]
  3. Huang, M., Ye, Y., Chen, S., Chai, J., Lu, J., Zhoa, L., Gu, L., and Wang, Z. (1988) Blood 72, 567-572 [Abstract/Free Full Text]
  4. Castaigne, S., Chomienne, C., Daniel, M. T., Ballerini, P., Berger, R., Fenaux, P., and Degos, L. (1990) Blood 76, 1704-1709 [Abstract/Free Full Text]
  5. Martin, J., Bradley, J. G., and Cotter, T. G. (1990) Clin. Exp. Immunol. 79, 448-453 [Medline] [Order article via Infotrieve]
  6. Grigg, J. M., Savill, J. S., Saraff, C., Haslett, C., and Silverman, M. (1991) Lancet 338, 720-722 [CrossRef][Medline] [Order article via Infotrieve]
  7. Afford, S. C., Pongracz, J., Stockley, R. A., Crocker, J., and Burnett, D. (1992) J. Biol. Chem. 267, 21612-21616 [Abstract/Free Full Text]
  8. Nunez, G., Merino, R., Grillot, D., and Gonzalez-Garcia, M. (1994) Immunol. Today 15, 582-588 [CrossRef][Medline] [Order article via Infotrieve]
  9. Delia, D., Aiello, A., Soligo, D., Fontanella, E., Melani, C., Pezzella, F., Pierotti, M. A., and Della Porta, G. (1992) Blood 79, 1291-1298 [Abstract/Free Full Text]
  10. Naumovski, L., and Cleary, M. L. (1994) Blood 83, 2261-2267 [Abstract/Free Full Text]
  11. Evans, R. M. (1988) Science 240, 889-894 [Abstract/Free Full Text]
  12. Collins, S. J., Robertson, K. A., and Mueller, M. (1990) Mol. Cell. Biol. 10, 2154-2163 [Abstract/Free Full Text]
  13. Porfiri, E., Hoffbrand, A. V., and Wickremasinghe, R. G. (1991) Blood 78, 1069-1077 [Abstract/Free Full Text]
  14. Hunter, T., and Cooper, J. A. (1985) Annu. Rev. Biochem. 54, 897-930 [Medline] [Order article via Infotrieve]
  15. Katagiri, K., Katagiri, T., Koyama, Y., Morikawa, M., Yamamoto, T., and Yoshida, T. (1991) J. Immunol. 146, 701-707 [Abstract]
  16. Katagiri, K., Katagiri, T., Kajiyama, K., Uehara, Y., Yamamoto, T., and Yoshida, T. (1992) Cell Immunol. 140, 282-294 [CrossRef][Medline] [Order article via Infotrieve]
  17. Katagiri, K., Katagiri, T., Kajiyama, K., Yamamoto, T., and Yoshida, T. (1993) J. Immunol. 150, 585-593 [Abstract]
  18. Katagiri, K., Hattori, S., Nakamura, S., Yamamoto, T., Yoshida, T., and Katagiri, T. (1994) Blood 84, 1780-1789 [Abstract/Free Full Text]
  19. Katagiri, T., Urakawa, K., Yamanashi, Y., Semba, K., Takahashi, T., Toyoshima, K., Yamamoto, T., and Kano, K. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 10064-10068 [Abstract/Free Full Text]
  20. Oritani, K., Kaisho, T., Nakajima, K., and Hirano, T. (1992) Blood 80, 2298-2305 [Abstract/Free Full Text]
  21. Nishizawa, M., Semba, K., Yoshida, M., Yamamoto, T., Sasaki, M., and Toyoshima, K. (1986) Mol. Cell. Biol. 6, 511-517 [Abstract/Free Full Text]
  22. Yamanashi, Y., Fukushige, S., Semba, K., Miyajima, K. Matsubara, K., Yamamoto, T., and Toyoshima. (1987) Mol. Cell. Biol. 7, 237-243 [Abstract/Free Full Text]
  23. Bustelo, X. R., Ledbetter, J. A., and Barbacid, M. (1992) Nature 356, 68-71 [CrossRef][Medline] [Order article via Infotrieve]
  24. Gulbins, E., Coggeshall, K. M., Baier, G., Katzav, S., Burn, P., and Altman, A. (1993) Science 260, 822-825 [Abstract/Free Full Text]
  25. Yousefi, S., Green, D. R., Blaser, K., and Simon, H.-U. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 10868-10872 [Abstract/Free Full Text]
  26. Corey, S., Eguinoa, A., Puyana-Theall, K., Bolen, J. B., Cantley, L., Mollinedo, F., Jackson, T. R., Hawkins, P. T., and Stephens, L. R. (1993) EMBO J. 12, 2681-2690 [Medline] [Order article via Infotrieve]
  27. Corey, S. J., Burkhardt, A. L., Bolen, J. B., Geahlen, R. L., Tkatch, L. S., and Tweardy, D., J. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 4683-4687 [Abstract/Free Full Text]
  28. Hamada, F., Aoki, M., Akiyama, T., and Toyoshima, K. (1993) Proc. Natl. Sci. U. S. A. 90, 6305-6309 [Abstract/Free Full Text]
  29. Berton, G., Fumagalli, L., Laudanna, C., and Sorio, C. (1994) J. Cell Biol. 126, 1111-1121 [Abstract/Free Full Text]
  30. Manfredini, R., Grande, A., Tagliafico, E., Barbieri, D., Zucchini, P., Citro, G., Zupi, G., Franceschi, C., Torelli, U., and Ferrari, S. (1993) J. Exp. Med. 178, 381-389 [Abstract/Free Full Text]
  31. Oltvai, Z. N., Milliman, C. L., and Korsmeyer, S. J. (1993) Cell 74, 609-619 [CrossRef][Medline] [Order article via Infotrieve]
  32. Yin, X.-M., Oltvai, Z. N., and Korsmeyer, S. J. (1994) Nature 369, 321-323 [CrossRef][Medline] [Order article via Infotrieve]
  33. Boise, L., Gonzalez-Garcia, M., Postema, C. E., Ding, L., Lindsten, T., Turka, L. A., Mao, X., Nunez, G., and Thompson, C. B. (1993) Cell 74, 597-608 [CrossRef][Medline] [Order article via Infotrieve]
  34. Takayama, S., Sato, T., Krajewski, S., Kochel, K., Irie, S., Millan, J. A., and Reed, J. C. (1995) Cell 80, 279-284 [CrossRef][Medline] [Order article via Infotrieve]
  35. Yang, E., Zha, J., Jockel, J., Boise, L. H., Thompson, C. B., and Korsmeyer, S. J. (1995) Cell 80, 285-291 [CrossRef][Medline] [Order article via Infotrieve]
  36. Margolis, B., Hu, P., Katzav, S., Li, W., Oliver, J. M., Ullrich, A., Weiss, A., and Schlessinger, J. (1992) Nature 356, 71-74 [CrossRef][Medline] [Order article via Infotrieve]

©1996 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
D. A. Chudakova, Y. H. Zeidan, B. W. Wheeler, J. Yu, S. A. Novgorodov, M. S. Kindy, Y. A. Hannun, and T. I. Gudz
Integrin-associated Lyn Kinase Promotes Cell Survival by Suppressing Acid Sphingomyelinase Activity
J. Biol. Chem., October 24, 2008; 283(43): 28806 - 28816.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
H. Guan, Z. Zhou, G. E. Gallick, S.-F. Jia, J. Morales, A. K. Sood, S. J. Corey, and E. S. Kleinerman
Targeting Lyn inhibits tumor growth and metastasis in Ewing's sarcoma
Mol. Cancer Ther., July 1, 2008; 7(7): 1807 - 1816.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
M. B. Miranda, R. L. Redner, and D. E. Johnson
Inhibition of Src family kinases enhances retinoic acid induced gene expression and myeloid differentiation
Mol. Cancer Ther., December 1, 2007; 6(12): 3081 - 3090.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
O. Prakash, O. R. Swamy, X. Peng, Z.-Y. Tang, L. Li, J. E. Larson, J. C. Cohen, J. Gill, G. Farr, S. Wang, et al.
Activation of Src kinase Lyn by the Kaposi sarcoma-associated herpesvirus K1 protein: implications for lymphomagenesis
Blood, May 15, 2005; 105(10): 3987 - 3994.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Lal, Y. Li, J. Smith, A. Sassano, S. Uddin, S. Parmar, M. S. Tallman, S. Minucci, N. Hay, and L. C. Platanias
Activation of the p70 S6 kinase by all-trans-retinoic acid in acute promyelocytic leukemia cells
Blood, February 15, 2005; 105(4): 1669 - 1677.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Dai, M. Rahmani, S. J. Corey, P. Dent, and S. Grant
A Bcr/Abl-independent, Lyn-dependent Form of Imatinib Mesylate (STI-571) Resistance Is Associated with Altered Expression of Bcl-2
J. Biol. Chem., August 13, 2004; 279(33): 34227 - 34239.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Goldenberg-Furmanov, I. Stein, E. Pikarsky, H. Rubin, S. Kasem, M. Wygoda, I. Weinstein, H. Reuveni, and S. A. Ben-Sasson
Lyn Is a Target Gene for Prostate Cancer: Sequence-Based Inhibition Induces Regression of Human Tumor Xenografts
Cancer Res., February 1, 2004; 64(3): 1058 - 1066.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
S. Ishida, Y. Shigemoto-Mogami, H. Kagechika, K. Shudo, S. Ozawa, J.-i. Sawada, Y. Ohno, and K. Inoue
Clinically Potential Subclasses of Retinoid Synergists Revealed by Gene Expression Profiling
Mol. Cancer Ther., January 1, 2003; 2(1): 49 - 58.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
J. Wightman, M. S. Roberson, T. J. Lamkin, S. Varvayanis, and A. Yen
Retinoic Acid-induced Growth Arrest and Differentiation: Retinoic Acid Up-Regulates CD32 (Fc{gamma}RII) Expression, the Ectopic Expression of Which Retards the Cell Cycle
Mol. Cancer Ther., May 1, 2002; 1(7): 493 - 506.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. V. Grishin, O. Azhipa, I. Semenov, and S. J. Corey
Interaction between growth arrest-DNA damage protein 34 and Src kinase Lyn negatively regulates genotoxic apoptosis
PNAS, August 17, 2001; (2001) 191130798.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Savoie, V. Lavastre, M. Pelletier, T. Hajto, K. Hostanska, and D. Girard
Activation of human neutrophils by the plant lectin Viscum album agglutinin-I: modulation of de novo protein synthesis and evidence that caspases are involved in induction of apoptosis
J. Leukoc. Biol., December 1, 2000; 68(6): 845 - 853.
[Abstract] [Full Text]


Home page
BloodHome page
Y. Miura, Y. Tohyama, T. Hishita, A. Lala, E. De Nardin, Y. Yoshida, H. Yamamura, T. Uchiyama, and K. Tohyama
Pyk2 and Syk participate in functional activation of granulocytic HL-60 cells in a different manner
Blood, September 1, 2000; 96(5): 1733 - 1739.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T.-X. Liu, J.-W. Zhang, J. Tao, R.-B. Zhang, Q.-H. Zhang, C.-J. Zhao, J.-H. Tong, M. Lanotte, S. Waxman, S.-J. Chen, et al.
Gene expression networks underlying retinoic acid-induced differentiation of acute promyelocytic leukemia cells
Blood, August 15, 2000; 96(4): 1496 - 1504.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
T. Ohigashi, M. Ueno, S. Nonaka, T. Nakanoma, Y. Furukawa, N. Deguchi, and M. Murai
Tyrosine kinase inhibitors reduce bcl-2 expression and induce apoptosis in androgen-dependent cells
Am J Physiol Cell Physiol, January 1, 2000; 278(1): C66 - C72.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. V. Mikhalap, L. M. Shlapatska, A. G. Berdova, C.-L. Law, E. A. Clark, and S. P. Sidorenko
CDw150 Associates with Src-Homology 2-Containing Inositol Phosphatase and Modulates CD95-Mediated Apoptosis
J. Immunol., May 15, 1999; 162(10): 5719 - 5727.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Moog-Lutz, E. J. Peterson, P. G. Lutz, S. Eliason, F. Cave-Riant, A. Singer, Y. Di Gioia, S. Dmowski, J. Kamens, Y. E. Cayre, et al.
PRAM-1 Is a Novel Adaptor Protein Regulated by Retinoic Acid (RA) and Promyelocytic Leukemia (PML)-RA Receptor alpha in Acute Promyelocytic Leukemia Cells
J. Biol. Chem., June 15, 2001; 276(25): 22375 - 22381.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Katagiri, T. Takahashi, T. Sasaki, S. Nakamura, and S. Hattori
Protein-tyrosine Kinase Pyk2 Is Involved in Interleukin-2 Production by Jurkat T Cells via Its Tyrosine 402
J. Biol. Chem., June 23, 2000; 275(26): 19645 - 19652.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. V. Grishin, O. Azhipa, I. Semenov, and S. J. Corey
Interaction between growth arrest-DNA damage protein 34 and Src kinase Lyn negatively regulates genotoxic apoptosis
PNAS, August 28, 2001; 98(18): 10172 - 10177.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Katagiri, K.
Right arrow Articles by Katagiri, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Katagiri, K.
Right arrow Articles by Katagiri, T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1996 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement