|
|
|
|||||||
|
|||||||||
(Received for publication, May 30, 1995; and in revised form, February 1, 1996) From the
The human promyelocytic leukemia cell line HL-60 can be induced
to differentiate toward neutrophils and subsequently die via apoptosis in vitro. In this paper, we investigated the roles of
protein-tyrosine kinases (PTKs) in retinoic acid (RA)-induced
granulocytic differentiation of HL-60 cells. Accompanying the
RA-induced differentiation, activities of src family PTKs Lyn
and Fgr became detected and reached a plateau 2 days after the
stimulation. The immunoblotting using anti-phosphotyrosine antibody
(PY-20) showed that the proteins of 56 and 53 kDa were predominantly
tyrosine-phosphorylated at day 2. Adsorption and immunoprecipitation of
the cell lysate by specific antibodies evidenced that these
phosphotyrosine-containing proteins are Lyn and Fgr PTKs. The degree of
both activities and tyrosine phosphorylation of these PTKs was reduced
to be minimal at day 5 when the HL-60 cells start to die by apoptosis.
The inhibitors of PTKs, herbimycin A and genistein, were demonstrated
to cause premature cell death of HL-60 cells in the presence of RA. The
death was the consequence of an apoptotic process. The RA-treated HL-60
cells, when incubated with specific c-lyn or c-fgr antisense oligodeoxynucleotide, also underwent premature death at
day 2. These data implicate that Lyn and Fgr PTKs prevent programmed
cell death to promote granulocytic differentiation of HL-60 cells.
Retinoic acid (RA) ( The
human promyelocytic leukemia cell line HL-60, upon stimulation with RA in vitro, undergoes differentiation toward neutrophils at day
3 to day 4 and dies via apoptosis at day 6 to day 8(5) .
Neutrophil is the first cell to accumulate at the site of inflammation
and plays a critical role in inducing various inflammatory events. As
soon as neutrophils complete their roles at the inflammatory site, they
die via apoptosis and are removed by macrophages to limit tissue injury
since they release harmful molecules such as proteolytic
enzymes(6, 7) . Therefore, molecular analysis for the
events occurring after stimulation of HL-60 cells with RA will provide
useful information on both the differentiation and the apoptosis of
neutrophils. Apoptosis requires active and coordinated regulation of
specific molecules. Bcl-2 is a potent suppressor of death and the
balances between Bcl-2 and a death-inducing signal determine the
occurrence of apoptosis(8) . It was demonstrated that
expression of Bcl-2 decreased markedly during RA-induced granulocytic
differentiation of HL-60 cells (9, 10) . RA binds
to specific nuclear receptors (RARs) and the RA The protein-tyrosine kinases (PTKs) play crucial roles in the
intracellular signal transduction for growth and differentiation of the
cells(14) . Recently, we reported that PTKs play essential
roles in TPA-induced monocytic differentiation of HL-60
cells(15, 16, 17) , and that Ras and
GTPase-activating protein complex function downstream of PTKs during
the differentiation(18) . In addition, our previous paper
described the induction of src family PTKs, lyn and fgr mRNA during RA-induced granulocytic
differentiation(15) . We have therefore investigated the role
of PTKs in the differentiation. In the current study, during
RA-induced granulocytic differentiation of HL-60 cells, both Fgr and
Lyn PTKs were demonstrated to be superinduced and
tyrosine-phosphorylated. In the presence of RA, treatment with specific
c-lyn or c-fgr antisense oligodeoxynucleotides as
well as that with herbimycin A or genistein, led to premature death of
the HL-60 cells. Thus, Lyn and Fgr PTKs are assumed to exert as
anti-apoptotic agents to promote granulocytic differentiation of HL-60
cells.
The
The antisense and sense PSNs were synthesized on a synthesizer
(model 392; Applied Biosystems, Inc., Foster City, CA), precipitated
with ethanol, and taken up in media containing 20 mM Hepes.
Sense (S) or antisense (AS) c-lyn or S or AS c-fgr PSNs were added to the culture medium for HL-60 cells at the
concentration of 20 µM. After 4 days of PSN treatment, the
culture medium was replaced with fresh medium containing 20 µM S or AS PSNs, and 1 µM of RA was added to the
cultures.
Figure 1:
Induction of
p56
Both mRNAs and proteins of the Lyn
and Fgr PTKs were also detected abundantly 2 days after RA treatment ((15) , Fig. 2). However, we could not determine whether
the PTKs were activated or not since the degrees of their expressions
were very low in untreated HL-60 cells.
Figure 2:
Upper, protein tyrosine phosphorylation in
HL-60 cells after stimulation with retinoic acid. The lysates from the
HL-60 cells (5
Figure 3:
Lyn and Fgr were major
phosphotyrosine-containing proteins in RA-treated HL-60 cells. Left, p53/56
Figure 4:
Tyrosine phosphorylation of
p95
Figure 5:
A,
morphological characteristics of cell death of the HL-60 cells after
treatment with RA plus PTK inhibitors. Morphological characteristics of
granulocytes were observed when HL-60 cells were incubated with RA for
0 days (RA 0d.), 2 days (RA 2d.), 3 days (RA
3d.), and 7 days (RA 7d.); proliferating HL-60 cells 2
days after treatment with 0.2 µg/ml herbimycin A alone (Herbimycin A 2d.); progressive cell death of HL-60 cells
treated with RA plus 0.2 µg/ml herbimycin A for 2 days (RA
+ Herbimycin A 2d.), cell death of HL-60 cells treated with
RA plus 10 µg/ml genistein for 2 days (RA + Genistein
2d.). B, DNA fragmentation in the HL-60 cells treated
with RA plus herbimycin A. The high molecular mass DNA extracted from
untreated HL-60 cells (None), from HL-60 cells treated with
0.2 µg/ml herbimycin A (H0.2), from HL-60 cells induced to
differentiate with 1 µM RA for 2 days (RA), from
HL-60 cells induced to differentiate with 10 ng/ml TPA (TPA)
for 2 days, from HL-60 cells treated with TPA plus herbimycin A (TPA+H0.2), or fragmented DNA from HL-60 cells treated
with RA plus herbimycin A (RA+H0.2) for 2 days were
subjected to agarose gel electrophoresis. The
Apoptosis is
in many cases associated with a characteristic oligonucleosomal DNA
fragmentation induced by intrinsic endonuclease(s). Apoptotic cell
death of HL-60 cells treated with herbimycin A plus RA was further
confirmed by detecting the ladder pattern of DNA cleavage in these
cells (Fig. 5B), whereas DNA remained unfragmented in
preparations obtained from HL-60 cells treated with RA, herbimycin A,
or TPA plus herbimycin A for 48 h (Fig. 5B).
Figure 6:
A, expressions of the
p53/p56
The regulation system of apoptosis is highly organized, and
the balances between inducers and repressors determine the occurrence
of apoptosis. In the current study, two cytoplasmic tyrosine kinases,
Lyn and Fgr, were demonstrated to be members of the repressors for
apoptosis of neutrophils. Both Lyn and Fgr PTKs were shown to be
induced and tyrosine-phosphorylated during differentiation of HL-60
cells toward neutrophils. After completion of the differentiation, the
expressions of these PTKs were reduced to be minimal and the cells die
via apoptosis. Using antisense oligonucleotides specific for Lyn or Fgr
PTK, it was demonstrated that inhibition of expression of either PTK
upon RA stimulation leads to premature cell death via apoptosis.
Consistent with the results, herbimycin A in combination with RA was
exhibited to cause premature cell death of the HL-60 cells. These data
imply that Lyn and Fgr PTKs exert an antiapoptotic effect to promote
differentiation of HL-60 cells toward neutrophils. Antiapoptotic
function of PTKs in neutrophils was also suggested by Yousefi et
al.(25) who demonstrated that GM-CSF-induced tyrosine
phosphorylation prevents apoptosis of human peripheral blood
neutrophils. In our study, at least two possibilities exist to explain
antiapoptotic roles of Lyn and Fgr PTKs in the granulocytic
differentiation of HL-60 cells; one is their functioning in independent
signal transduction pathways which converge to join each other at the
terminal, and the other is their direct interaction or ordered
functions on the same pathway which is required for antiapoptotic
function. As yet, we have no evidence for supporting the one. In
neutrophils, Lyn has been demonstrated to be activated and associated
with phosphatidylinositol 3-kinase accompanying the stimulation with
granulocyte macrophage-colony stimulating factor (GM-CSF)(26) .
It was shown that granulocyte-colony stimulating factor (G-CSF)
activated Lyn and Syk (p72 While our study
is in progress, Manfredini et al.(30) demonstrated
that the HL-60 cells which had been induced to differentiate into
granulocytes underwent premature death when incubated with antisense
oligonucleotide specific for c-fes gene which encodes a Fes
PTK (p92 Several genes have been identified that participate as either
inducers or repressors of programmed cell death. Among these, Bcl-2 and
Bax are homologous proteins that have opposing effects on cell life and
death. Bcl-2 serves to prolong cell survival while Bax acts as an
accelerator of apoptosis(31, 32) . Previous papers
reported that Bcl-2 decreased during RA-induced differentiation of
HL-60 cells into granulocytes which subsequently undergo apoptosis and
that HL-60 cells which hyperexpressed Bcl-2 showed little evidence for
apoptosis(9, 10) . In our study, we also observed the
prompt decrease in expression of Bcl-2 protein by HL-60 cells after RA
stimulation (data not shown). Expression of Bax protein was shown to be
reduced far more slowly accompanying the differentiation (data not
shown). Thus, the ratio of Bcl-2 and Bax was markedly reduced at an
early phase of the differentiation. Therefore, some molecules, for
which we propose Lyn and Fgr PTK, should protect cells from apoptosis
instead of Bcl-2 to promote differentiation toward neutrophils.
Recently, various proteins such as Bcl-x In addition to Lyn and Fgr PTKs, we identified preferentially
tyrosine-phosphorylated proteins as p95 As RA induces growth arrest and terminal differentiation in
some promyelocytic leukemia cell lines, RA has been utilized as a
differentiation therapy for treatment of patients with acute
promyelocytic leukemia(3, 4) . This apparently
resulted in remission of the patients without causing marrow
aplasia(3, 4) . In the current study, RA in
combination with a small amount of herbimycin A was found to be a
potent agent to induce apoptosis of promyelocytic leukemia cell line
HL-60. Although its validity and toxicity should be scrutinized using
experimental animals, careful treatment with the combination of the
agents will improve the remedial value exhibited by RA alone. For more
specifically refined treatment, further studies on the molecular
mechanisms of antiapoptotic functions of tyrosine kinases should be
required.
Volume 271,
Number 19,
Issue of May 10, 1996 pp. 11557-11562
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
)functions as an important
bioregulator in cell differentiation and
development(1, 2) . Due to its potent activity in
inducing differentiation and growth arrest of leukemic cells from acute
promyelocytic leukemia (APL M3) patients, RA has been utilized in
treatment of these leukemia patients (3, 4) .
RAR complex is
thought to regulate the transcription of target
genes(11, 12) . However, little is known about the
intracellular events that lead to differentiation and apoptosis of the
responsive cells subsequent to RARAR interaction(13) .
Cells
HL-60 cells were suspended with RPMI 1640
medium containing 10% fetal calf serum. For differentiation
experiments, growing cells were subcultured at a density of 2 
10
cells/ml, and inducers were added to the medium at the
following concentrations: 1 µM for retinoic acid (RA)
(Sigma) and 10 ng/ml for 12-O-tetradecanoylphorbol-13-acetate
(TPA) (Sigma). Herbimycin A (0.1 and 0.2 µg/ml) (Life Technologies,
Inc.) and genistein (10 µg/ml) (Funakoshi Inc., Tokyo, Japan) were
also added to the medium. After incubation of HL-60 cells with these
drugs for the indicated time, the cells were washed twice with
phosphate-buffered saline.Antibodies
Rabbit polyclonal anti-Fyn, anti-Lyn,
anti-Fgr, anti-Hck antibodies and monoclonal anti-Vav antibody were
purchased from Santa Cruz Biotechnology, Inc., Santa Cruz, CA. Rabbit
polyclonal anti-Syk was obtained from Upstate Biotechnology, Inc., Lake
Placid, NY. Rabbit polyclonal anti-Btk and anti-Fes antibodies were
kindly donated by Drs. S. Tsukada (Osaka University) and Y. Hanazono
(University of Tokyo), respectively. These antibodies were used in the
immunoprecipitation as described below. 
I-Labeled
monoclonal anti-phosphotyrosine PY-20 (ICN Radiochemicals),
peroxidase-conjugated anti-rabbit Ig F(ab`)2 fragments (Amersham), and
peroxidase-conjugated anti-mouse Ig F(ab`)2 fragments (Amersham) were
used in the immunoblotting as described below.Immunoprecipitation
RA-treated cells (1
10
) were collected by centrifugation and lysed at 0 °C
for 60 min in 1 ml of lysis buffer (1% Triton X-100, 20 mM Tris aminomethane, 150 mM NaCl, 2 mM EDTA, 2
µg/ml aprotinin, 2 µg/ml leupeptin, 1 mM phenylmethylsulfonyl fluoride, 1 mM Na
VO
, 10 mM NaF, pH
7.6)(19) . The supernatant was precleared by incubation with an
excess amount of protein G-Sepharose 4B (Pharmacia Biotech Inc.). The
cleared lysate was incubated with various kinds of antibodies and
protein G-Sepharose 4B. The immunoprecipitates were washed with the
lysis buffer extensively.Immunoblotting
The 10 µl of the cell lysate
(10
cells) or the immunoprecipitated proteins were
subjected to electrophoresis on 9% polyacrylamide-SDS gel. The transfer
of the proteins to polyvinylidene difluoride membrane (PVDF, Pharmacia)
and the blotting with I-PY-20 or peroxidase-conjugated
antibody were carried out as described(19) . ECL (enhanced
chemiluminescence) system (Amersham) was applied to detection.Immune Complex Kinase Assay
The immunoprecipitates
described above were then incubated at 30 °C for 10 min with 40
µl of kinase buffer (100 mM NaCl, 20 mM Hepes, pH
7.5, 10 mM MnCl
) containing 1 µM ATP
and 10 µCi of [
-
P]ATP (3000 Ci/mmol; 1
Ci = 37 GBq).P-labeled samples were
subjected to electrophoresis on 9% polyacrylamide-SDS gels. The gels
were treated with 1 M KOH at 55 °C for 2 h to detect
tyrosine-phosphorylated protein molecules, dried, and subjected to Fuji
RX film at -80 °C.Morphologic Analysis
The granulocytic
differentiation was evaluated on Giemsa-Wright stained cytospin
preparation.Analysis of DNA Fragmentation
Fragmentation of DNA
was assayed as described previously(20) . HL-60 cells (5
10) were treated with drugs and lysed in 0.5 ml of
lysis buffer containing 20 mM Tris-HCl, pH 8.0, 1 mM EDTA, 1% sodium dodecyl sulfate (SDS), and 50 µg/ml proteinase
K (Sigma). After 4 h at 37 °C, DNA was extracted with an equal
volume of Tris buffer-saturated phenol and with chloroform/isoamyl
alcohol (24:1) and precipitated with ethanol. DNA was treated with
RNase A (50 µg/ml; Sigma) for 5 h and then with proteinase K (120
µg) for 5 h. DNA was separated (5 µg of DNA per lane) by
horizontal electrophoresis (2 V/cm) in 1% agarose gel with running
buffer containing 90 mM Tris-HCl, 90 mM boric acid,
and 2 mM EDTA, pH 8.0, stained with 0.5 µg/ml ethidium
bromide, and visualized under ultraviolet light.Treatment of HL-60 Cells with Antisense Phosphorothioate
Oligonucleotides (PSNs)
We synthesized antisense PSNs
complementary to positions 142-162 of human c-fgr sequence (CCTGGAATGGGCTGTGTGTTC) and 292-312 of human
c-lyn sequence
(GGAAATATGGGATGTATAAAA)(21, 22) . Sense PSNs
corresponding to each position were prepared as controls. The antisense
PSN sequences did not have significant homology with any other
sequences in the data base. All experiments using antisense PSNs were
repeated three times, and the results obtained were essentially the
same.
Expressions of PTKs in RA- or TPA-treated HL-60
Cells
In our previous reports(15) , we investigated mRNA
expressions and functions of some members of src family PTKs
in monocytic differentiation of HL-60 cells. In this study, we examined
expressions of 9 src-related cytoplasmic PTKs during
granulocytic differentiation of HL-60 cells in comparison with
monocytic one. By in vitro immune complex kinase assay using
specific antibodies, Fgr and Lyn src family PTKs were found to
be induced abundantly within 12 h after RA stimulation, peak at day 2 (Fig. 1), and then decrease to the minimum 5 days after the
stimulation (data not shown). While the activities of Hck and Fyn src family PTKs were specifically detected in TPA-treated
cells (Fig. 1), Btk was expressed abundantly in nontreated HL-60
cells and remained unchanged after stimulation with TPA or RA (Fig. 1). Syk was expressed in either RA- or TPA-treated cells (Fig. 1). Both Src and Yes were expressed weakly without change
in their level upon stimulation, and Lck was not detected during the
differentiation (data not shown).
and p53/p56
PTKs
during RA-induced granulocytic differentiation of HL-60 cells. Lysates
of untreated HL-60 cells (None), the cells treated for 48 h
with retinoic acid (RA) or with TPA (TPA) were
immunoprecipitated with anti-Fgr, anti-Lyn, anti-Fyn, anti-Hck,
anti-Syk, or anti-Btk antibody. The immunoprecipitates were subjected
to immune complex kinase assay and analyzed by SDS-PAGE as described
under ``Materials and Methods.'' The autoradiograph was
exposed for 1 h at -80 °C with an intensifier screen. The
position of each PTK is indicated.
10 cells) stimulated with RA for 0,
1, 2, or 5 days were immunoblotted with I-labeled PY-20.
The autoradiograph was exposed for 24 h at -80 °C with an
intensifier screen. The positions of major bands are indicated with an arrowhead. Molecular masses in kDa are indicated on the left. Lower, expressions of Lyn, Fgr, and actin in HL-60 cells
after stimulation with RA. The lysates from the HL-60 cells (5
10 cells) stimulated with RA for 0, 1, 2, or 5 days were
immunoblotted with anti-Lyn, anti-Fgr, and anti-actin. The bands were
detected by ECL assay system (Amersham).
Tyrosine Phosphorylation of Protein Molecules during
Granulocytic Differentiation
By using immunoblotting with
anti-phosphotyrosine antibody (PY-20), tyrosine phosphorylation of
protein molecules were investigated during RA-induced granulocytic
differentiation of HL-60 cells (Fig. 2). Protein tyrosine
phosphorylation was detected within 12 h after the stimulation, reached
a plateau at day 2, and declined thereafter to the minimum at day 5 (Fig. 2). As shown in Fig. 2, the protein molecules of
molecular mass 53 to 56 kDa were markedly tyrosine-phosphorylated, and
the tyrosine phosphorylation of that of the 95-kDa protein was
relatively weak. To identify the tyrosine-phosphorylated proteins, we
examined the tyrosine phosphorylation of Lyn (p53
and
p56) and Fgr (p56
) because the kinetics of
expressions of both PTKs were similar to those of tyrosine
phosphorylation of the 53- to 56-kDa proteins; that is, expressions of
both Lyn and Fgr were predominantly induced at day 2 after RA
stimulation and declined thereafter ( Fig. 1and Fig. 2).
As shown in Fig. 3, left, Lyn and Fgr PTKs were highly
tyrosine-phosphorylated in RA-treated cells, but not in TPA-treated
cells. Absorption with anti-Lyn and anti-Fgr antibody plus protein
G-Sepharose 4B demonstrated that the major tyrosine-phosphorylated
proteins of 53 to 56 kDa were Lyn and Fgr PTKs (Fig. 3, right). These data suggest the involvement of these PTKs in
the signaling generated by RARAR interaction in HL-60 cells. We
next investigated the tyrosine phosphorylation of a proto-oncogene
product Vav (p95
) as a candidate molecule for the 95-kDa
protein phosphorylated upon RA stimulation (Fig. 4). The Vav is
specifically expressed in hematopoietic cells (23) and is
tyrosine-phosphorylated upon stimulation of the cells with antigen or
mitogen(24) . As shown in Fig. 4, Vav was markedly
(10-fold) tyrosine-phosphorylated at 48 h after stimulation with RA,
while the amount of Vav was not changed during that time.
and p56 were tyrosine-phosphorylated in RA-treated HL-60 cells. The
lysates from the HL-60 cells (2.5 10 cells) treated
with TPA or RA for 48 h were immunoprecipitated with polyclonal
anti-Lyn or anti-Fgr antibodies and protein G-Sepharose 4B. The
immunoprecipitates were subjected to electrophoresis, transferred to a
polyvinylidene difluoride (PVDF) filter, and immunoblotted with I-labeled PY-20. The autoradiograph was exposed for 12 h
at -80 °C with an intensifier screen. The positions of Lyn
and Fgr are indicated by arrowheads on the right.
Molecular masses in kDa are indicated on the left. Right, the
absorption of phosphorylated proteins with anti-Lyn plus anti-Fgr
antibodies. The lysates from RA-treated HL-60 cells (1 10 cells) were immunoprecipitated with polyclonal anti-Lyn plus
anti-Fgr (anti-Lyn + anti-Fgr) or rabbit IgG (RIg) and protein G-Sepharose 4B. The supernatant was
subjected to SDS-PAGE, transferred to a PVDF filter, and immunoblotted
with I-labeled PY-20. The exposure time was 12 h at
-80 °C with an intensifier
screen.
in RA-treated HL-60 cells. Upper,
the RIPA lysates from RA- or TPA-treated HL-60 cells (2.5
10 cells) for 48 h were immunoprecipitated with monoclonal
anti-Vav or mouse IgG (mIg) as a control and protein
G-Sepharose. These immunoprecipitated proteins were subjected to
SDS-PAGE, transferred to a PVDF filter, and immunoblotted with I-labeled PY-20. The autoradiograph was exposed for 12 h
at -80 °C with an intensifier screen. Lower, the
same whole lysates were subjected to SDS-PAGE and transferred to a PVDF
filter and then immunoblotted with anti-Vav antibody. The bands
detected by the ECL assay system (Amersham) showed that an almost equal
amount of Vav protein exists in each
lysate.
Effect of Herbimycin A on Granulocytic Differentiation of
HL-60 Cells
We have reported that herbimycin A prevented
TPA-induced monocytic differentiation of HL-60 cells and suggested an
important role of tyrosine kinases in the differentiation(16) .
To know the role of tyrosine kinases in the RA-induced granulocytic
differentiation of HL-60 cells, we investigated the effects of
herbimycin A on the differentiation. By using a method of Giemsa-Wright
staining of the cells, we observed that RA treatment of HL-60 cells
induced terminal differentiation into granulocytic cells at day 3, and,
subsequently, they died by apoptosis at day 7 (Fig. 5A). Unexpectedly, herbimycin A in combination
with RA inhibited cell growth and caused cell death of HL-60 cells at
48 h after stimulation (Fig. 5, A and B). The
cells treated with RA plus herbimycin A revealed fragments of nuclei
and highly condensed chromatin, which are the most striking feature of
apoptosis (Fig. 5A). Genistein, an another tyrosine
kinase inhibitor, also induced an apoptotic cell death of HL-60 cells
when used together with RA (Fig. 5A). Morphological
change in HL-60 cells characteristic of granulocytic differentiation
was never observed before apoptotic death of the cells. While, neither
herbimycin A alone nor herbimycin A plus TPA did cause apoptosis of
HL-60 cells (Fig. 5, A and B).
phage DNA digested
with restriction endonucleases EcoRI and HindIII is
indicated as a DNA molecular mass marker (Marker).
Induction of Apoptosis in lyn or fgr Antisense
PSN-treated HL-60 Cells in the Presence of RA
As tyrosine
kinases were demonstrated to be involved in the apoptosis of HL-60
cells induced by RA (Fig. 5), we focused on the two tyrosine
kinases, Lyn and Fgr, and prepared antisense phosphorothioate
oligonucleotides (PSNs) specific for them according to the method as
described under ``Materials and Methods.'' We first examined
the effects of antisense PSNs on the expression of Lyn and Fgr PTKs in
HL-60 cells by an immunoblotting. Although both PTKs were detectable in
untreated HL-60 cells after RA stimulation, they were strongly
suppressed when the cells were cultured in the presence of lyn or fgr antisense PSNs (Fig. 6A). In
contrast, the cells treated with each sense PSN expressed levels of Lyn
and Fgr PTKs similar to those in untreated cells after RA stimulation (Fig. 6A). In addition, these antisense PSNs did not
affect the expression of Btk PTK in HL-60 cells (Fig. 6A). When the antisense PSN-treated HL-60 cells
were stimulated with RA for 48 h, more than 80% of the cells were dead
with immature characteristics (Fig. 6B). However, sense
PSN-treated HL-60 cells were demonstrated to have no sign for cell
death. The cell death appeared to be characteristics of apoptosis under
microscopic observation (data not shown).
and p56 in HL-60
cells treated with the c-lyn S or AS or c-fgr S or
AS. Sense (S) or antisense (AS) c-lyn or S or ASc-fgr PSNs were added to the culture medium of HL-60 cells at the
concentration of 20 µM. After 4 days of PSN treatment, the
culture medium was replaced with fresh medium containing 20 µM S or AS PSNs, and 1 µM RA was added to the cultures.
Lysates of the untreated (Untreated) or PSN-treated HL-60
cells (lyn S or AS, or fgr S or AS)
were obtained at 24 h after RA stimulation and subjected to SDS-PAGE,
transferred to a PVDF filter, and immunoblotted with anti-Lyn,
anti-Fgr, or anti-Btk, respectively. The position of Lyn, Fgr, or Btk
was indicated by an arrowhead. B, viability of HL-60 cells
cultured for 2 days in the absence (None) or presence (RA) of RA after treatment with c-lyn or c-fgr S or AS oligomer. Cell viability was assessed by the ability of
the cells to exclude trypan blue. The result is a typical one, and the
experiment was repeated three times with similar results. The average
and S.E. of triplicate determinations are
shown.
), both of which were then
recruited into G-CSF receptor signaling complex in human peripheral
neutrophils(27) . While the evidence has been reported that Fgr
also function in human neutrophils, a chemotactic agonist induces
translocation of Fgr from an intracellular compartment to the plasma
membrane and that Fgr is associated to FcIIR on
neutrophils(28) . Recently, Berton et al.(29) demonstrated that agonists of 
2 integrin
activation such as tumor necrosis factor, TPA, and fMet-Leu-Phe enhance
the kinase activity of Fgr in human neutrophils. These data suggest
that Fgr PTK plays a crucial role in the expression of function by
peripheral neutrophils at the inflammatory site. Our data on the
antiapoptotic role of Lyn and Fgr PTK in the granulocytic
differentiation of HL-60 cells will add a new insight into the function
of these PTKs in the neutrophils. Further studies on the analyses of
HL-60 transfectants expressing active Lyn or Fgr or both PTKs will
provide more information on the roles of these PTKs in the apoptosis
and differentiation of human neutrophils. Identification of the
molecules interacting with these PTKs in RA-stimulated HL-60 cells will
also give information on the function of these PTKs in neutrophils.
These studies are now in progress in our laboratory.
). In our system, accompanying the
differentiation of HL-60 cells toward neutrophils, expression of Fes
PTK is increased without detectable levels of the tyrosine
phosphorylation of Fes PTK (data not shown). To get a clue to
understanding the relation of Lyn, Fgr, and Fes PTK in the
antiapoptotic signaling pathway, we tried to investigate the possible
co-immunoprecipitation with each other during RA-induced
differentiation. However, no association with each other was observed. 
,
Bcl-x
, Bad, and Bag-1 were cloned as molecules associated
with Bcl-2 or Bax and demonstrated to be involved in programmed cell
death(33, 34, 35) . Thus, the mechanisms of
the antiapoptotic function of Lyn and Fgr PTK should be considered by
taking the balances of the above Bcl-2-related molecules into account. (Vav). Vav is
expressed specifically in hematopoietic cells and has the guanine
nucleotide releasing factor activity for Ras which is regulated by
tyrosine kinase(36) . In our previous work, we could not find
activation of Ras during RA-induced differentiation of HL-60 cells
while the activation of Ras was observed accompanying TPA-induced
differentiation(18) . As the degree of tyrosine phosphorylation
of Vav upon RA stimulation is higher than that upon TPA stimulation,
Vav might have functions other than working as a guanine nucleotide
releasing factor for Ras. In this term, study on the differentiation of
HL-60 cells will provide useful information on physiological function
of Vav.
)
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
ABSTRACT
This article has been cited by other articles:
|
|
 |
|
  D. A. Chudakova, Y. H. Zeidan, B. W. Wheeler, J. Yu, S. A. Novgorodov, M. S. Kindy, Y. A. Hannun, and T. I. Gudz Integrin-associated Lyn Kinase Promotes Cell Survival by Suppressing Acid Sphingomyelinase Activity J. Biol. Chem., October 24, 2008; 283(43): 28806 - 28816. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Guan, Z. Zhou, G. E. Gallick, S.-F. Jia, J. Morales, A. K. Sood, S. J. Corey, and E. S. Kleinerman Targeting Lyn inhibits tumor growth and metastasis in Ewing's sarcoma Mol. Cancer Ther., July 1, 2008; 7(7): 1807 - 1816. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. B. Miranda, R. L. Redner, and D. E. Johnson Inhibition of Src family kinases enhances retinoic acid induced gene expression and myeloid differentiation Mol. Cancer Ther., December 1, 2007; 6(12): 3081 - 3090. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Prakash, O. R. Swamy, X. Peng, Z.-Y. Tang, L. Li, J. E. Larson, J. C. Cohen, J. Gill, G. Farr, S. Wang, et al. Activation of Src kinase Lyn by the Kaposi sarcoma-associated herpesvirus K1 protein: implications for lymphomagenesis Blood, May 15, 2005; 105(10): 3987 - 3994. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Lal, Y. Li, J. Smith, A. Sassano, S. Uddin, S. Parmar, M. S. Tallman, S. Minucci, N. Hay, and L. C. Platanias Activation of the p70 S6 kinase by all-trans-retinoic acid in acute promyelocytic leukemia cells Blood, February 15, 2005; 105(4): 1669 - 1677. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Dai, M. Rahmani, S. J. Corey, P. Dent, and S. Grant A Bcr/Abl-independent, Lyn-dependent Form of Imatinib Mesylate (STI-571) Resistance Is Associated with Altered Expression of Bcl-2 J. Biol. Chem., August 13, 2004; 279(33): 34227 - 34239. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Goldenberg-Furmanov, I. Stein, E. Pikarsky, H. Rubin, S. Kasem, M. Wygoda, I. Weinstein, H. Reuveni, and S. A. Ben-Sasson Lyn Is a Target Gene for Prostate Cancer: Sequence-Based Inhibition Induces Regression of Human Tumor Xenografts Cancer Res., February 1, 2004; 64(3): 1058 - 1066. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ishida, Y. Shigemoto-Mogami, H. Kagechika, K. Shudo, S. Ozawa, J.-i. Sawada, Y. Ohno, and K. Inoue Clinically Potential Subclasses of Retinoid Synergists Revealed by Gene Expression Profiling Mol. Cancer Ther., January 1, 2003; 2(1): 49 - 58. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wightman, M. S. Roberson, T. J. Lamkin, S. Varvayanis, and A. Yen Retinoic Acid-induced Growth Arrest and Differentiation: Retinoic Acid Up-Regulates CD32 (Fc{gamma}RII) Expression, the Ectopic Expression of Which Retards the Cell Cycle Mol. Cancer Ther., May 1, 2002; 1(7): 493 - 506. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. V. Grishin, O. Azhipa, I. Semenov, and S. J. Corey Interaction between growth arrest-DNA damage protein 34 and Src kinase Lyn negatively regulates genotoxic apoptosis PNAS, August 17, 2001; (2001) 191130798. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Savoie, V. Lavastre, M. Pelletier, T. Hajto, K. Hostanska, and D. Girard Activation of human neutrophils by the plant lectin Viscum album agglutinin-I: modulation of de novo protein synthesis and evidence that caspases are involved in induction of apoptosis J. Leukoc. Biol., December 1, 2000; 68(6): 845 - 853. [Abstract] [Full Text]
|
|
|
|
|
|
Y. Miura, Y. Tohyama, T. Hishita, A. Lala, E. De Nardin, Y. Yoshida, H. Yamamura, T. Uchiyama, and K. Tohyama Pyk2 and Syk participate in functional activation of granulocytic HL-60 cells in a different manner Blood, September 1, 2000; 96(5): 1733 - 1739. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T.-X. Liu, J.-W. Zhang, J. Tao, R.-B. Zhang, Q.-H. Zhang, C.-J. Zhao, J.-H. Tong, M. Lanotte, S. Waxman, S.-J. Chen, et al. Gene expression networks underlying retinoic acid-induced differentiation of acute promyelocytic leukemia cells Blood, August 15, 2000; 96(4): 1496 - 1504. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Ohigashi, M. Ueno, S. Nonaka, T. Nakanoma, Y. Furukawa, N. Deguchi, and M. Murai Tyrosine kinase inhibitors reduce bcl-2 expression and induce apoptosis in androgen-dependent cells Am J Physiol Cell Physiol, January 1, 2000; 278(1): C66 - C72. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. V. Mikhalap, L. M. Shlapatska, A. G. Berdova, C.-L. Law, E. A. Clark, and S. P. Sidorenko CDw150 Associates with Src-Homology 2-Containing Inositol Phosphatase and Modulates CD95-Mediated Apoptosis J. Immunol., May 15, 1999; 162(10): 5719 - 5727. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Moog-Lutz, E. J. Peterson, P. G. Lutz, S. Eliason, F. Cave-Riant, A. Singer, Y. Di Gioia, S. Dmowski, J. Kamens, Y. E. Cayre, et al. PRAM-1 Is a Novel Adaptor Protein Regulated by Retinoic Acid (RA) and Promyelocytic Leukemia (PML)-RA Receptor alpha in Acute Promyelocytic Leukemia Cells J. Biol. Chem., June 15, 2001; 276(25): 22375 - 22381. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Katagiri, T. Takahashi, T. Sasaki, S. Nakamura, and S. Hattori Protein-tyrosine Kinase Pyk2 Is Involved in Interleukin-2 Production by Jurkat T Cells via Its Tyrosine 402 J. Biol. Chem., June 23, 2000; 275(26): 19645 - 19652. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. V. Grishin, O. Azhipa, I. Semenov, and S. J. Corey Interaction between growth arrest-DNA damage protein 34 and Src kinase Lyn negatively regulates genotoxic apoptosis PNAS, August 28, 2001; 98(18): 10172 - 10177. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |