![]()
|
|
||||||||
(Received for publication, January 17, 1996) From the
D1R
The vaccinia virus mRNA capping enzyme catalyzes three of the
four reactions required for cap I formation, including RNA
5`-triphosphatase(1, 2) , guanylyltransferase, and
(guanine-7-)methyltransferase
activities(3, 4, 5) . The RNA
5`-triphosphatase, nucleoside triphosphate phosphohydrolase, and
guanylyltransferase active sites have been mapped to a 60-kDa
NH In this report, we describe the
kinetic properties of the RNA 5`-triphosphatase and nucleoside
triphosphate phosphohydrolase activities of the vaccinia virus mRNA
capping enzyme. Through competitive inhibition analyses, we demonstrate
that both activities are carried out at a single active site. We also
present UV photo-cross-linking mapping data which locates the
phosphohydrolysis active site to the 25-kDa NH
Previous work demonstrated that the mRNA capping enzyme
possesses the ability to hydrolyze ATP and GTP in addition to the
5`-terminal phosphate of triphosphorylated
RNA(6, 12, 23, 24) . To characterize
the kinetic properties of the nucleoside triphosphate phosphohydrolase
activity and to determine whether the RNA 5`-triphosphatase and
nucleoside triphosphate phosphohydrolase activities are carried out at
a single active site, the following kinetic and biochemical studies
were conducted.
Figure 1:
Magnesium concentration dependence of
ATPase and RNA 5`-triphosphatase activities. The ATPase and RNA
5`-triphosphatase activities in D1R
Figure 2:
The
effect of RNA chain length on RNA 5`-triphosphatase substrate
saturation kinetics.
To determine whether
the mRNA capping enzyme is a general nucleoside triphosphate
phosphohydrolase, additional nucleoside triphosphates were tested as
potential substrates. A broad substrate specificity was observed, Table 1. The kinetic properties were comparable for each
substrate, exhibiting a range of K
Figure 3:
Competitive inhibition of RNA
5`-triphosphatase by ATP. RNA saturation kinetics were measured in a
modified RNA 5`-triphosphatase assay containing 10 nM D1R
In a second approach, the ability of
various oligonucleotides to inhibit ATPase activity was assessed, Fig. 4. Inhibition was measured at 5 mM ATP while
varying the concentration of the oligonucleotide present in the assay.
The oligonucleotides employed were all 23 nucleotides in length and
possessed the same nucleotide sequence but differed in the nature of
their 5` terminus, and in the case of single-stranded DNA, the
substitution of thymidine for uracil. As expected, triphosphorylated
RNA 23-mer was an effective inhibitor of ATPase, inhibiting activity by
50% at a concentration of approximately 35 µM.
Diphosphorylated RNA, the product of the RNA 5`-triphosphatase
activity, also inhibited the hydrolysis of ATP, although to a lesser
extent in comparison to the inhibition by triphosphorylated RNA. 5`-OH
RNA was a relatively weak inhibitor of ATPase activity while
single-stranded DNA did not significantly inhibit ATP hydrolysis. The
inhibition of ATP hydrolysis by these oligonucleotides is consistent
with their relative inhibition of RNA 5`-triphosphatase
activity(12) . Although RNA 5`-triphosphatase and ATPase
differed in the relative extent to which their activities were
inhibited by these reagents, both activities were inhibited in a
similarly graded fashion by the same oligonucleotides. The most
effective inhibition of either ATPase or RNA 5`-triphosphatase activity
was observed with a nucleic acid possessing either a triphosphorylated
or diphosphorylated 5` terminus. Taken together, these kinetic
competition data argue for a common active site for RNA
5`-triphosphatase and ATPase.
Figure 4:
Inhibition of ATPase activity by
oligonucleotides. D1R
Figure 5:
Inability of ATP to inhibit
guanylyltransferase activity. The ability of ATP to competitively
inhibit either guanylyltransferase half-reaction was measured. A, Inhibition of E
Figure 6:
Direct UV photo-cross-linking of ATP to
D1R
Figure 7:
Parallel inhibition of both ATP UV
photo-cross-linking and ATP hydrolysis by oligonucleotides. Both ATP
cross-linking (
In an attempt to localize the site(s) of ATP photo-linkage,
D1R
Figure 8:
Localization of the ATP binding site in
D1R
A low cross-linking efficiency (less
than 1% ATP cross-linked to D1R In an attempt to localize the RNA
binding site in D1R
Figure 9:
Localization of the RNA binding site in
D1R
We have investigated the RNA 5`-triphosphatase and nucleoside
triphosphate phosphohydrolase activities of the mRNA capping enzyme. In
the previous report(12) , we demonstrated that both activities,
along with the guanylyltransferase, reside entirely within the fully
active D1R The ability of the mRNA
capping enzyme to employ ATP, GTP, and triphosphorylated RNA as a
substrate for phosphohydrolysis raises questions related both to
substrate specificity and to the presence of a single or multiple
phosphohydrolysis active site(s). In regard to the question of
substrate specificity, the capping enzyme exhibits comparable substrate
saturation kinetics for a broad range of nucleoside triphosphates. The
ability of each NTP to serve equally as substrates indicates that the
enzyme exhibits little specificity based on sugar or base. In regard to
the number of phosphohydrolase active sites, we conclude, based on two
kinetic observations, that a common active site exists. First, ATP is a
linear competitive inhibitor of RNA 5`-triphosphatase activity. The
calculated K A
major goal in our study of the mRNA capping enzyme is to identify the
amino acid residues present in the active sites catalyzing each of the
three reactions in the cap formation pathway. The straight-forward
method of direct UV photo-cross-linking specific substrates to the
methyltransferase domain has permitted the preliminary localization of
the S-adenosylmethionine and GTP binding regions of the
methyltransferase active center(17, 18) . Using this
same general approach, we attempted to localize the phosphohydrolase
active site in the D1R Using this same experimental approach, the
major RNA binding site was also localized to the same
NH The identification of specific residues
involved in nucleotide binding was not possible by the
photo-cross-linking method as a low cross-linking efficiency prohibited
the isolation of a modified peptide in amounts sufficient for
sequencing. Moreover, an evaluation of the D1R amino acid sequence
failed to reveal any consensus sequences in D1R An RNA 5`-triphosphatase activity
for the West Nile virus has been reported(21) . The authors
have suggested the amino acids ILRPRW as comprising the putative RNA
5`-triphosphatase active site and note its homology to the vaccinia
virus mRNA capping enzyme sequence LKPR starting at position 492. This
sequence is based entirely on homology to other flaviviruses in a
region of the viral genome to which no functional predictions had been
previously made. No structure-function correspondence has actually been
demonstrated. By analysis of D1R carboxyl-terminal deletion
mutations, both the guanylyltransferase and ATPase activities have been
mapped to the same 60 kDa amino-terminal domain. This fact suggests a
close structural linkage between the two activities(12) .
However, the inability of ATP to inhibit either E Employing a 23-mer triphosphorylated RNA substrate in
vitro, D1R
Volume 271,
Number 20,
Issue of May 17, 1996 pp. 11945-11952
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
DEMONSTRATION THAT BOTH ACTIVITIES ARE CARRIED OUT AT THE SAME
ACTIVE SITE (*)
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
, an active subdomain of the large
subunit of vaccinia virus mRNA capping enzyme possessing ATPase, RNA
5`-triphosphatase, and guanylyltransferase activities, was expressed in Escherichia coli and shown to be functionally equivalent to
the heterodimeric enzyme (Myette, J. R., and Niles, E. G. (1996) J.
Biol. Chem. 271, 11936-11944). A detailed characterization
of the phosphohydrolytic activities of D1R
demonstrates that, in addition to ATPase and RNA
5`-triphosphatase activities, the capping enzyme also possesses a
general nucleoside triphosphate phosphohydrolase activity that lacks a
preference for the nucleoside base or sugar. Nucleoside triphosphate
and mRNA saturation kinetics are markedly different, with RNA
exhibiting a K
and turnover number 100-
and 10-fold less, respectively, than those values measured for any NTP.
The linear competitive inhibition of RNA 5`-triphosphatase activity by
ATP, and the relative manner by which both ATPase and RNA
5`-triphosphatase activities are inhibited by specific
oligonucleotides, kinetically demonstrate that each activity is carried
out at a common active site. Direct UV photo-cross-linking of either
P-radiolabeled ATP or 23-mer triphosphorylated RNA,
followed by cyanogen bromide cleavage of the photo-linked enzyme,
localizes the major binding site for both ATP and RNA to a region
between amino acids 1 and 221. The inability of ATP to competitively
inhibit either E
GMP formation or the transfer of GMP to
RNA kinetically differentiates the phosphohydrolase active site from
the guanylyltransferase active site.
-terminal domain of the D1R
subunit(7, 8, 10) , while the
methyltransferase resides in a independent domain comprised of the
carboxyl terminus of D1R together with
D12L(9, 10, 11) . In an accompanying
report(12) , kinetic analyses demonstrated that the
D1R
subdomain expressed in Escherichia coli is functionally equivalent to the full-size capping enzyme with
respect to RNA 5`-triphosphatase, ATPase, and guanylyltransferase
activities, indicating that the methyltransferase domain exerts little
influence on catalysis carried out at the active sites within
D1R
. In addition to triphosphorylated RNA, the
mRNA capping enzyme employs ATP and GTP as substrates for
phosphohydrolysis(1, 6, 23, 24) ,
raising the question whether both the nucleoside triphosphate
phosphohydrolase activity and the RNA 5`-triphosphatase activity are
carried out at the same active site.
-terminal
region of D1R (amino acids 1-221). A kinetic argument is made for
the separation of this active site from the guanylyltransferase active
site, supporting a three-active site model for the mRNA capping enzyme.
RNA Synthesis
Triphosphorylated RNA substrate was synthesized by in
vitro transcription of linearized plasmid DNA templates as
described(12) . Linearization of either pGEM3Zf(+) or
pGEM9Zf(+) plasmids at different restriction sites enabled the
synthesis of RNA of discrete lengths.Preparation of Diphosphorylated RNA
Diphosphorylated RNA was generated in vitro through
the RNA 5`-triphosphatase activity of the capping enzyme using
triphosphorylated 23-mer RNA as substrate. D1R
(100 pmol, specific activity 50 pmol of P
/min/pmol of
enzyme) was added to a 500-µl reaction containing 50 mM Tris-HCl, pH 8.0, 2 mM MgCl
, 10 mM
-mercaptoethanol, 10% glycerol, and 10 nmol of
triphosphorylated RNA 23-mer. The reaction was incubated at 37 °C
for 30 min. Dephosphorylation of RNA was monitored by inclusion of a
small amount of high specific activity
[
-
P]RNA 23-mer (>2000 cpm/pmol) in the
reaction and assaying for the release of
P
by
PEI-cellulose thin layer chromatography as described for the RNA
5`-triphosphatase assay(12) . The reaction was quenched and
extracted by adding an equal volume of 24:24:1
phenol:chloroform:isoamyl alcohol. RNA was precipitated with 3 volumes
of 95% ethanol, washed, dried and resuspended in 300 µl of diethyl
pyrocarbonate-treated water. The sample was further desalted and
concentrated by ultrafiltration in a Micron 3 concentrator (Amicon).Enzyme Assays
ATPase, RNA 5`-triphosphatase, and guanylyltransferase assays
were conducted as described elsewhere(12) .Inhibition of ATPase by
Oligonucleotides
D1R
ATPase activity was
measured in a standard assay containing 10 mM MgCl
, in the presence of varying concentrations of
oligonucleotides (see below). In the measurement of triphosphorylated
23-mer RNA inhibition of ATPase activity, a 2-min reaction time was
employed to ensure that less than 20% of the mRNA was dephosphorylated. Nucleoside Triphosphate Phosphohydrolase
Assay
Nucleoside triphosphate phosphohydrolase activity was
measured by a colorimetric phosphate assay as described
elsewhere(13) . A standard assay contained 50 mM Tris-HCl, pH 8.0, 20 mM MgCl
, 10 mM
-mercaptoethanol, 10% glycerol, 5 mM nucleoside
triphosphate (U. S. Biochemical Corp., ultrapure grade), and 100 nM enzyme, in a 50-µl reaction volume. Enzyme was added last to
the chilled assay mixture, and the reaction was transferred to 37
°C for 5 min. Reactions were quenched by the addition of 5 µl
of 0.5 M EDTA and assayed for the release of phosphate using a
molybdate-based colorimetric assay. Sterox was omitted from the color
development reagent. Color development reagent (800 µl, malachite
green:ammonium molybdate 3:1) was added to the enzyme assay mix at room
temperature, gently vortexed, and developed for 1 min at room
temperature. Development was quenched by the addition of 100 µl of
34% sodium citrate (w/v), pH 8.5. Moles of phosphate were determined
from the absorbance at 660 nm by use of a KH
PO
standard curve. Absorbances were corrected for background
phosphate generated by the nonenzymatic hydrolysis of nucleoside
triphosphates. Absorbances were linear up to 1 mM phosphate
and did not vary over the time course of the assay. The assay was
linear for 15 min at an enzyme concentration between 20 nM and
150 nM.UV Photo-cross-linking
Photo-cross-linking of ATP to
D1R
The standard photo-cross-linking
reactions were carried out in a 96-well microtiter dish floating in an
ice water slurry. Direct UV photo-linkage was achieved using a single
GE G15T8 15-watt germicidal ultraviolet lamp held at a distance of 10
cm for 45 min. A standard reaction mixture of 30 µl contained 50
picomol of D1R
, 50 mM Tris-HCl,
pH 8.0, 10 mM
-mercaptoethanol, 10% glycerol (w/v), 50
µM cold ATP, and 10-20 µCi of
[![]()
P]ATP (DuPont NEN, 800 Ci/mmol). The
reaction was quenched by adding 10 µl of 4 SDS sample
buffer, and the samples were boiled for 5 min and separated by SDS-PAGE (
)on 10% acrylamide gels. Modified enzyme was visualized by
autoradiography of dried gels and incorporated radiolabel quantified by
Cerenkov counting. Approximately 1% direct photo-cross-linking product
was achieved at saturating ATP concentrations.Inhibition of ATP Photo-cross-linking by
Oligonucleotides
ATP photo-cross-linking was carried out in the
presence of varying concentrations of oligonucleotide and nucleotide
competitors. Oligonucleotide competitors included triphosphorylated
RNA, diphosphorylated RNA, 5`-OH RNA (Oligos, Etc.), and DNA 23-mers,
all of the sequence GGGCGAAUUAAUAUAUUUGAAUU (with uracil replaced by
thymidine in DNA). Nucleotide competitors included ADP, AMP, adenosine,
and the dinucleotides ApU and GpppA (a methyl acceptor in the
methyltransferase reaction). In a parallel experiment, the inhibition
of ATP hydrolysis by these same reagents was also examined. ATPase
activity was measured as described previously (12) except a
subsaturating concentration of 50 µM ATP and 10 mM MgCl
were employed.UV Photo-cross-linking of RNA to
D1R
Direct UV photo-cross-linking of
triphosphorylated 23-mer RNA to D1R
was conducted
as described (12) except 200 pmol of D1R
were employed in a 200-µl reaction volume.Cyanogen Bromide Cleavage of
D1R
D1R
(200 pmol)
were UV photo-cross-linked with 50 µM ATP or 1 µM 23-mer triphosphorylated RNA as described above. Cross-linking
reactions were scaled up to a 200-µl reaction volume and split into
four microtiter wells containing 50 µl each. Following
cross-linking, samples were pooled and precipitated with ice-cold 10%
trichloroacetic acid. Pellets were washed twice with 200 µl of
acetone, dried, and resuspended in 200 µl of 70% formic acid
containing 20 mg/ml CNBr (Pierce)(17) . The digestions were
carried out for 18-20 h at room temperature while under nitrogen.
Samples were then dried three times under a stream of nitrogen, each
time resuspending in 200 µl of water. The final wash and
concentration step was by Speed-Vac desiccation, after which samples
were resuspended in 20 µl of 1 peptide sample buffer and
boiled, and the pH was adjusted when necessary by addition of 1-2
µl of 1 M Tris-HCl, pH 8.5, 0.1% SDS. Samples were
resolved on Tricine gels(14) , stained with Coomassie Brilliant
Blue (Sigma), and dried. Radiolabeled peptides were visualized by
autoradiography. To prepare cleavage products for microsequencing, 600
picomol of D1R
were directly digested with CNBr.
The dried cleavage products were resuspended in 45 µl of 1
peptide sample buffer, and the peptides were resolved by
electrophoresis on Tricine gels pre-run at a low voltage in the
presence of 100 µM thioglycolic acid as recommended
(Probe-Design Peptide Separation System Technical Manual, Promega,
1992). Approximately 200 picomol of protein were loaded per lane. The
peptides were transferred to a Transblot (Bio-Rad) polyvinylidene
difluoride membrane and the peptides were visualized by Coomassie
Brilliant Blue staining (0.1% Coomassie Brilliant Blue R-250 in 45%
methanol and 5% acetic acid). The N-terminal amino acid sequence of the
cleavage products was determined by the CAMBI Peptide Sequencing
Facility (SUNY-Buffalo).
Kinetic Properties
The magnesium ion concentration
dependence of both ATPase and RNA 5`-triphosphatase activities is
presented in Fig. 1. Although both activities require MgCl
for catalysis, the concentrations needed for optimal activity are
substantially different. RNA 5`-triphosphatase shows optimal activity
between 1 and 2 mM MgCl
, followed by a sharp
inhibition at higher concentrations. ATPase requires a roughly 10-fold
higher concentration of MgCl
and reaches a stable plateau.
Both activities exhibited a modest sensitivity to NaCl concentration,
each being inhibited by 25% at 50 mM (data not
shown).Substrate saturation kinetics for both RNA and ATP also
demonstrate marked differences(12) , Fig. 2. For an RNA
23-mer substrate, the RNA 5`-triphosphatase K
is
approximately 1 µM, roughly 1000-fold lower than the K
measured for ATP. Moreover, RNA turnover is
considerably slower, 50 min
for RNA as compared to
500-600 min
for ATP. RNA substrates of defined
lengths from 9 to 42 nucleotides exhibit similar kinetic properties
which demonstrates that beyond 9 bases, RNA chain length has little
influence on RNA 5`-triphosphatase activity.
were measured
at saturating ATP (5 mM) and RNA (20 µM)
substrate concentrations, 100 nM (ATPase) and 20 nM (RNA 5`-triphosphatase) enzyme concentrations, and in the presence
of varying concentrations of MgCl
. Additional conditions
for both assays are as described under ``Experimental
Procedures.'' ATPase (); RNA 5`-triphosphatase
(
).
-
P-Labeled RNA of defined
lengths were synthesized by in vitro transcription of
linearized plasmid DNA templates and employed as substrates in a
standard RNA 5`-triphosphatase assay at 20 nM enzyme and 2
mM MgCl
. Substrate saturation kinetics were
measured for the full-size capping enzyme. Kinetic values are obtained
from initial velocities measured at varying concentrations of
triphosphorylated RNA. The kinetic values for ATP hydrolysis, measured
in parallel under standard ATPase assay conditions (100 nM enzyme, 20 mM MgCl
), are plotted as length
= 1 nucleotide.
values from 0.8
to 1.3 mM and turnover numbers from approximately 500 to 800
min
. This enzyme is able to hydrolyze equally well
both purine and pyrimidine nucleoside triphosphates, containing either
ribose or 2` deoxyribose. However, the capping enzyme does not possess
a general phosphatase activity, since phosphohydrolysis is specific for
the
-
-phosphoester bond (data not shown). In general, the
D1R
subdomain exhibited comparable nucleoside
triphosphate phosphohydrolase kinetics to the holoenzyme, demonstrating
that this activity is not affected by the methyltransferase domain (12) .
The Number of Active Sites
The fact that the mRNA
capping enzyme possesses both RNA 5`-triphosphatase and general
nucleoside triphosphate phosphohydrolase activities raises the question
of whether the catalysis of each reaction is carried out at a common
active site or at two independent sites. Two approaches were taken to
investigate this issue. In the first, the ability of ATP to
competitively inhibit RNA 5`-triphosphatase was assessed. ATP was shown
to be a linear competitive inhibitor of RNA 5`-triphosphatase, Fig. 3, strongly suggesting that ATP binds to the RNA
5`-triphosphatase active site and prohibits the binding of the RNA 5`
terminus. The apparent K
for this ATP inhibition
was calculated from a Dixon plot to be approximately 1.4 mM.
This value is comparable to the K
for ATPase
activity (12) as would be predicted if both substrates are
competing for the same active site. The minor variation in the K
and K
values is a result of
the different MgCl
concentrations (Fig. 1) employed
in the two measurements.
, 10 mM MgCl
, and
varying concentrations of
-
P-labeled 23-mer RNA, in a
10-µl reaction volume. Velocities were measured at each RNA
concentration in the absence or presence of different concentrations of
unlabeled ATP. Reactions were carried out for 2 min at 37 °C,
quenched with EDTA, and assayed for the release of
P
by spotting a 2-µl aliquot onto PEI-cellulose thin layer
chromatography plates. The data is presented as a Lineweaver-Burke
transformation of the velocity versus substrate plot: 0 ATP
(); 0.5 mM ATP (
), 1 mM ATP (
), and
5 mM ATP (
).
ATPase activity was
measured in a 20-µl reaction containing 10 mM MgCl
, 100 nM D1R
, 5
mM ATP, and varying concentrations of oligonucleotides. All
oligonucleotides possessed the same 23-nucleotide sequence, differing
only in the nature of their 5` terminus and, in the case for
single-stranded DNA, thymine substituted for uracil. All velocities
were measured as a percentage of activity relative to the control (100%
activity). Triphosphorylated RNA (); diphosphorylated RNA
(
); 5`-OH RNA (
); single-stranded DNA
(
).
Relationship of Phosphohydrolase and Guanylyltransferase
Active Sites
A close structural relationship between the RNA
5`-triphosphatase/nucleoside triphosphate phosphohydrolase and
guanylyltransferase activities is inferred from the relative levels of
each activity measured in a set of carboxyl-terminal deletions of D1R
which were used to delineate the D1R
subdomain(12) . To determine the degree to which the
nucleotide binding regions of each active site overlap, ATP was tested
as a potential competitive inhibitor of guanylyltransferase activity.
ATP is known not to be a substrate for guanylyltransferase (15) since it can neither form a phosphoryl intermediate with
the enzyme nor serve in the transfer of AMP to RNA. Inclusion of up to
5 mM ATP does not inhibit either E
GMP formation (Fig. 5A) or the transfer of GMP to RNA at saturating
concentrations of RNA (Fig. 5B). Under the conditions
for E
GMP formation, less than 1% of the 5 mM ATP
is hydrolyzed by the ATPase activity in D1R
(data
not shown), ruling out the possibility that the ATP is significantly
depleted and therefore, unable to effectively inhibit
guanylyltransferase activity. We conclude from this lack of inhibition
that the ATP binding site in the RNA 5`-triphosphatase/NTPase active
site does not overlap with either the GTP or the diphosphorylated RNA
binding site in the guanylyltransferase active site. As a further
indication of separate active sites, the catalytic lysine (lysine 260)
of guanylyltransferase(16, 22) , required for
formation of the phosphoryl GMP intermediate, is not required for ATP
binding or hydrolysis since a mutation of K
to methionine
eliminates E
GMP formation but does not affect ATPase
activity (data not shown).
GMP formation. Varying
concentrations of ATP were included in a 20-µl reaction containing
200 nM of intact capping enzyme, 10 µM GTP, 1
µCi of [
-
P]GTP, and 5 mM MgCl
. Reactions were carried on ice and quenched after
60 s by the addition of 2 SDS-PAGE sample buffer. E
GMP was resolved by SDS-PAGE on 10% polyacrylamide gels
and visualized by autoradiography. B, Inhibition of the
transguanylylation of 23-mer RNA. Reactions contained 50 nM capping enzyme, 5 µM triphosphorylated 23-mer RNA,
100 µM GTP, 2 µCi of
[
-
P]GTP, 2 mM MgCl
,
and varying concentrations of ATP in a 10-µl reaction volume.
Reactions were carried out at 37 °C for 4 min, quenched with 2
RNA sample buffer, the samples heated for 5 min at 95 °C,
and the guanylylated RNA resolved by electrophoresis on 10%
polyacrylamide gels containing 8 M urea. The radiolabeled RNA
was visualized by autoradiography.
Localization of the Nucleotide Binding Site
In an
attempt to localize the nucleoside triphosphate binding site within
D1R
, we employed direct UV photo-cross-linking of
ATP followed by the specific chemical cleavage of the covalently
modified enzyme. The extent of ATP photo-cross-linking to
D1R
was found to be dependent upon the time of
the reaction and enzyme concentration, and was saturable by ATP, Fig. 6. Spurious covalent linkage of ITP (a minor deamination
product of ATP present in some preparations of
[
-
P]ATP) to the guanylyltransferase active
site was prevented by utilizing the mutant D1R
(22) which lacks the catalytic lysine 260 required for E
GMP formation, but possesses wildtype ATPase activity
(data not shown). The specificity of ATP photo-linkage was further
assessed by testing the ability of either triphosphorylated RNA (a
competing substrate) or various analogues to inhibit both cross-linking
and ATPase activity at 50 µM ATP, Fig. 7. As
expected, triphosphorylated RNA 23-mer was a good inhibitor of both
ATPase and photo-cross-linking activities. In contrast, compounds such
as single-stranded DNA, ApU, and GpppA which are poor inhibitors of
ATPase activity were also poor inhibitors of UV photo-linkage. In
comparison to 5` triphosphorylated 23-mer RNA, 5` OH RNA was a
relatively poor inhibitor of ATPase activity and also a less effective
inhibitor of the UV photo-linkage of ATP to D1R
.
. A, ATP was photo-linked to
D1R
as described using a single 15-watt
germicidal UV bulb held at a distance of 10 cm. Cross-linking reactions
contained 50 mM Tris-HCl, pH 8.0, 10 mM
-mercaptoethanol, 10% glycerol, 50 µM ATP, 15
µCi of [![]()
P]ATP (800 Ci/mmol), and 50
pmol of D1R
in a 30-µl reaction
volume. At various times, the cross-linking reaction was quenched with
10 µl of 4 sample buffer, the samples were boiled for 5
min, and the radiolabeled enzyme was separated from free ATP by
SDS-PAGE. B, cross-linking reactions were as in the standard
reaction described except UV photo-linkage was measured as a function
of D1R
concentration. C, photo-linkage
reactions were carried out as in A, in the presence of varying
concentrations of ATP. For all three experiments, the moles of
cross-linked product was quantified by Cerenkov counting of
radiolabeled enzyme excised from the dried
gel.
) and ATPase activity (
) were measured in the
presence of varying concentrations of different oligonucleotides (A-E). ATPase was measured under standard conditions
except reactions included 50 µM ATP and 10 mM MgCl
. Both ATP cross-linking and ATPase activity are
plotted as a percentage of activity relative to the control (no
inhibitor).
photo-labeled with ATP in the presence or
absence of triphosphorylated RNA 23-mer, was cleaved with CNBr and the
cleavage products were resolved by electrophoresis on Tricine gels, Fig. 8. The products obtained were assigned to the D1R primary
sequence, Fig. 8A, according to their apparent
molecular weights. This assignment was confirmed by N-terminal amino
acid sequence analysis of the isolated peptides, generated by CNBr
cleavage of D1R
in the absence of UV
photo-linkage. Based on the location of methionine residues in
D1R
primary sequence, complete digestion by CNBr
should yield six fragments whose respective molecular weights and
location are depicted in Fig. 8A. The typical cleavage
products, including some partial digestion fragments, are represented
by the Coomassie-stained Tricine gel in Fig. 6B.
NH
-terminal amino acid sequence analysis of the 15-kDa
fragment demonstrates that this peptide is a partial cleavage product
(denoted by the P
in Fig. 8B)
corresponding to the 10.0- and 5.2-kDa fragments. On the basis of size,
we also conclude that P
is a partial cleavage
product comprised of the 25.1 and 2.1 fragments. The persistence of
these partial cleavage products indicate that the respective
methionines at positions 221 and 410 in the primary sequence are less
efficiently cleaved by CNBr.
. [
-
P]ATP was
photo-linked to D1R
and the ATP-labeled enzyme
subject to chemical cleavage by cyanogen bromide. UV
photo-cross-linking reactions were scaled up to a 200-µl reaction
volume containing 50 µM ATP, 60 µCi of
[
-
P]ATP (800 Ci/mmol), and 200 pmol of
D1R
. Following cross-linking, the photo-linked
product was precipitated with 10% trichloroacetic acid and subjected to
CNBr cleavage (20 mg/ml CNBr in 70% formic acid) for 18-20 h at
room temperature. CNBr cleavage products were resolved by
electrophoresis on Tricine gels, and the gels were stained with
Coomassie Brilliant Blue R-250. The radiolabeled peptides were
visualized by autoradiography of the dried gel. A, CNBr
cleavage map for D1R
indicating the size and
location of the expected products from a complete cleavage by CNBr at
the indicated methionine residues. B, representative
Coomassie-stained Tricine gel of D1R
CNBr
cleavage products. The identification of each cleavage product (based
on NH
-terminal amino acid sequencing of the isolated
peptides) is indicated on the left. Partial cleavage products
are denoted by the letter P. C, CNBr cleavage of ATP
photo-linked D1R
. Lanes 1 and 2, Coomassie-stained Tricine gel of uncleaved E
ATP (100 pmol), lane 1, or CNBr cleavage
products (200 pmoles), lane 2. Lanes 3-5, autoradiograph
of
P-radiolabeled CNBr cleavage peptides; lane 3,
uncleaved radiolabeled D1R
; lane 4,
radiolabeled cleavage products; lane 5, same as lane
4, except 10 µM triphosphorylated 23-mer RNA was
included in the photo-cross-linking reaction prior to CNBr cleavage. Arrow indicates the most prominent radiolabeled cleavage
product obtained, corresponding to the 25.1 NH
-terminal
fragment shown in A. Results in panels B and C represent two separate experiments.
at saturating
ATP) prohibited the isolation of a specific radiolabeled peptide in
sufficient amounts for sequencing. However, an analysis of the
distribution of radiolabel in the CNBr cleavage products of ATP
photo-linked enzyme was informative, Fig. 8C, lanes
4 and 5. Greater than 75% of the radiolabeled nucleotide
typically cross-linked to the amino-terminal 25.1-kDa peptide
corresponding to amino acids 1-221 (Fig. 8C, lane 4) with additional radiolabeled peptides also resolved by
gel electrophoresis. These additional cleavage products always
represented a minor portion of the total radioactivity. The labeling of
each peptide was competed by including 10 µM triphosphorylated RNA in the cross-linking reaction prior to
cleavage by CNBr (Fig. 8C, lane 5). Inclusion
of RNA in the reaction diminished the extent of ATP cross-linking and
not the pattern of radiolabeled cleavage products obtained. From these
analyses, we conclude that the major ATP binding site resides within
the first 221 amino acids of D1R.
,
P-radiolabeled
RNA was UV photo-cross-linked to D1R
, the
modified enzyme was treated with RNase A and was then subject to CNBr
cleavage. The resulting cleavage products were resolved by
electrophoresis on Tricine gels, Fig. 9. As was the case for
ATP, RNA was cross-linked primarily to the 25.1-kDa NH
terminus of D1R, Fig. 9B, lanes 4 and 5. Additional radiolabeled peptides of lower molecular weight
(not evident in Fig. 9B) were also detected in longer
autoradiographic exposures. The percentage of radioactivity present in
these fragments somewhat varied between experiments. However, these
bands always represented less than 25% of the total radiolabeled
peptide present. Prominent photo-linkage to the 25.1-kDa region of D1R
was observed whether the RNA employed as a cross-linking reagent was
radiolabeled at internal guanosines located primarily in the 5` region (Fig. 9, A and B, lane 4) or
exclusively in the
phosphate at the 5` terminus, Fig. 9B, lane 5. This latter result
demonstrates that RNA binding to this region of D1R is specific to the
5` terminus of RNA and presumably at the phosphohydrolysis active site.
.
P-Radiolabeled 23-mer RNA was
UV photo-cross-linked to D1R
and subject to
chemical cleavage by CNBr as described for ATP. Photo-linkage reactions
included 1 µM of either
[
-
P]GMP or
-
P-radiolabeled 23-mer RNA and 200 pmol of
D1R
, in a 200-µl reaction volume. Following
the photo-linkage reaction, the samples were treated with RNase A for
30 min at 37 °C. Samples were then precipitated with 10%
trichloroacetic acid and subjected to CNBr cleavage as described for
the ATP-labeled enzyme. A, sequence of radiolabeled RNA used
in photo-linkage reactions. The positions of
-
P-radiolabeled GMP residues are denoted by an asterisk. B, lanes 1 and 2,
Coomassie-stained Tricine gel of either uncleaved RNA photo-linked
enzyme, lane 1, or photo-linked enzyme subject to CNBr
cleavage, lane 2. Lanes 3-5, autoradiograph of
radiolabeled D1R
cleavage products. Lane
3, uncleaved RNA labeled enzyme; lane 4, CNBr cleavage of
D1R
photo-cross-linked with
[
-
P]GMP RNA; lane 5, CNBr cleavage
of D1R
photo-cross-linked with
[
-
P]RNA. The specific activities of
radiolabeled [
P]RNA (
and
) are not
equivalent. The radiolabeled cleavage product in lane 5 represents an approximately 5-fold longer autoradiographic
exposure.
subdomain. We report here that the
kinetic properties of the two phosphohydrolytic activities vary
markedly. First, the two activities differ in the MgCl
concentration at which maximal catalysis is achieved: 2 mM MgCl
versus 20 mM MgCl
for RNA 5`-triphosphatase and ATPase, respectively. Second, the
capping enzyme exhibits an approximately 1000-fold lower K
for RNA compared to the K
for ATP and an approximately 10-fold slower turnover of RNA
compared to ATP, indicating substantive binding differences for the two
substrates. Catalytically relevant binding of RNA at the RNA
5`-triphosphatase active site must occur in a region of the RNA
downstream from the 5` terminus. The ability of a 5` OH RNA
oligonucleotide to inhibit RNA 5`-triphosphatase activity (12) reflects this fact. Based on the influence of RNA chain
length on RNA 5`-triphosphatase kinetics, this binding site resides
within 9 nucleotides from the 5` terminus.
of 1.4 mM is comparable to
the K
measured for ATPase activity(12) ,
consistent with ATP acting as a competing substrate at the RNA
5`-triphosphatase active site. Second, ATPase and RNA 5`-triphosphatase
activities (12) are inhibited in a similarly graded manner by
the same set of oligonucleotides. The degree of competition of ATPase
activity by these oligonucleotides reflects the need for either a tri-
or diphosphorylated 5` RNA terminus. The concentration at which
triphosphorylated 23-mer RNA effectively inhibits ATPase (with 50%
inhibition occurring at approximately 35 µM) is
substantially higher than the approximately 1 µMK
measured for RNA 5`-triphosphatase
activity(12) . However, this inequivalence may be explained by
an inhibition of RNA binding at the high MgCl
concentration
present in the kinetic competition assay; at 10 mM MgCl
, RNA 5`-triphosphatase activity is inhibited
approximately 70% (Fig. 1). The apparent K
for 23-mer triphosphorylated RNA under such conditions is greater
than 10-fold higher than the K
measured under
optimal divalent cation conditions (data not shown). Nevertheless, the
inhibition measured is both valid and specific. These competition data,
taken together with the differential kinetic properties of the two
activities, indicate that within this active site, triphosphorylated
RNA preferentially binds. The strong substrate bias toward RNA reflects
the fact that the primary function of this active site is the
dephosphorylation of mRNA prerequisite to mRNA cap formation.
subdomain. Specific UV
photo-cross-linking of ATP to D1R
was achieved as
evidenced by several criteria. First, the extent of cross-linking was
found to be dependent upon time and enzyme concentration, and was
saturable by ATP. Second, the cross-linking of ATP to
D1R
was effectively inhibited by
triphosphorylated 23-mer RNA in a manner which paralleled the
inhibition of ATP hydrolysis by this RNA. In contrast, reagents such as
single-stranded DNA, and the dinucleotides ApU and GpppA (a substrate
for methyltransferase) which were poor inhibitors of ATPase activity
were likewise poor inhibitors of ATP cross-linking. Direct
photo-linkage of ATP to D1R
, coupled with the
specific chemical cleavage of this subdomain by CNBr, has identified a
major ATP binding site in a 25 kDa amino terminus of D1R from amino
acids 1-221. The minor but specific labeling of other peptides
indicate, however, that other regions in D1R
interact with ATP. The observation of multiple radiolabeled
cleavage products is not surprising given the approach taken. Direct
photo-cross-linking of nucleotides to proteins is likely to result in a
covalent linkage to any amino acids in juxtaposition to the nucleotide
with a most efficient linkage to those residues that are most proximal
to the adenine base.
-terminal 25-kDa region of D1R to which ATP binds. RNA
cross-linking to this region represents specific binding to the RNA
5`-triphosphatase active site based on the following observations.
First, photo-linkage to the same NH
-terminal 25-kDa
fragment occurred when either
- or
-
P-radiolabeled 23-mer RNA was employed as a ligand.
This result clearly indicates that D1R is binding to the 5` terminus of
RNA and protecting this region of RNA from RNase digestion. Second,
kinetic competition data demonstrate that both ATPase and RNA
5`-triphosphatase activities share a common active site. Therefore, the
observation that both ATP and RNA cross-link to the same region of D1R
is consistent with both substrates binding at the same
phosphohydrolysis site.
for nucleotide binding. However a few sequences which show some
homology to nucleotide binding sequences should be noted. In particular
is the sequence GSGAQSKS located at position 167-174. This
sequence falls within the 25-kDa amino-terminal CNBr peptide
representing the major ATP (and RNA) cross-linking product and loosely
fits the Walker A NTP binding motif GXXXXGK(S/T) (19) . Another sequence in D1R which partially matches this
motif is at position 434-443 and consists of the sequence
GX
GXGK. This sequence lacks the typical S
or T at the carboxyl terminus. However, following this sequence is a
hydrophobic stretch of amino acids comprising a sequence motif reported
for some herpesvirus proteins possessing ATPase functions(20) .
Other consensus sequences for nucleotide binding including the Walker B
type, (R/K)X
GX
L-hydrophobic-D (19) , and the GTP binding motif, NKXD(25) ,
are not present in D1R
. This is not surprising
given that the preferred substrate for phosphohydrolysis is RNA and not
single nucleoside triphosphates.
GMP
formation or the transfer of GMP to RNA clearly demonstrates that the
two active sites do not overlap. This conclusion is noteworthy given
that GTP is a substrate for both reactions. Based on the apparently
rate-limiting kinetics for the transfer of GMP to
RNA(2, 12) , one would also expect some degree of
inhibition by any nucleotide binding which interferes with this
transfer. Clearly ATP does not inhibit this step. Two additional lines
of evidence also argue for separate active sites. First, ATP does not
effectively cross-link to the 14.2-kDa CNBr fragment containing the
lysine 260 required for E
GMP formation. This result
demonstrates that the major ATP binding site is not proximal to this
lysine, at least not in the primary sequence. Second, the mutation of
this lysine to methionine, while eliminating E
GMP
formation(9, 16) , had no effect on ATPase activity,
indicating that this lysine is not required for phosphohydrolase
activity.
exhibits a 50-fold greater RNA
5`-triphosphatase than guanylyltransferase activity(12) ; 50
dephosphorylations occur for each nucleotidyl transfer event. This
observation implies that the probability of dissociation of
diphosphorylated RNA from the RNA 5`-triphosphatase active site is
50-fold greater than the transfer of GMP to the RNA 5` terminus. Since
guanylyl transfer measured in vitro is linear with respect to
time at the earliest time points analyzed (data not shown), the
diphosphorylated RNA must serve as an acceptor for this transfer
without dissociating from the enzyme. The poor coupling of
guanylyltransferase to RNA 5` triphosphatase in vitro demonstrates, however, that the capping enzyme lacks the ability
to effectively retain the nascent diphosphorylated RNA product and
transfer it to the guanylyltransferase active site. It is believed that
nascent RNA is capped in vivo without the release of the
intermediate products. This presumed greater in vivo catalytic
efficiency is likely to be due to the existence of a ternary complex
containing the capping enzyme, nascent RNA, and the RNA
polymerase(26, 27) . A tethering of the nascent RNA to
the RNA polymerase rather than to a site in the mRNA capping enzyme (12) would retain the intermediate products and ensure a
proximity of substrate RNA to each capping enzyme active site. In turn,
this favorable arrangement would increase the efficiency of catalysis
by physically coupling each reaction in the cap formation pathway.
)
We thank Drs. Cecile Pickart and Dan Kosman for a
critical evaluation of this manuscript.
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
M. F. Souliere, J.-P. Perreault, and M. Bisaillon Magnesium-binding studies reveal fundamental differences between closely related RNA triphosphatases Nucleic Acids Res., February 2, 2008; 36(2): 451 - 461. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. P. Su, J. H. Shien, H. J. Liu, H. S. Yin, and L. H. Lee Avian reovirus core protein {micro}A expressed in Escherichia coli possesses both NTPase and RTPase activities J. Gen. Virol., June 1, 2007; 88(6): 1797 - 1805. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Keppetipola, R. Jain, and S. Shuman Novel Triphosphate Phosphohydrolase Activity of Clostridium thermocellum TTM, a Member of the Triphosphate Tunnel Metalloenzyme Superfamily J. Biol. Chem., April 20, 2007; 282(16): 11941 - 11949. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gong, P. Smith, and S. Shuman Structure-function analysis of Plasmodium RNA triphosphatase and description of a triphosphate tunnel metalloenzyme superfamily that includes Cet1-like RNA triphosphatases and CYTH proteins RNA, August 1, 2006; 12(8): 1468 - 1474. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Samuilova, C. Krogerus, I. Fabrichniy, and T. Hyypia ATP Hydrolysis and AMP Kinase Activities of Nonstructural Protein 2C of Human Parechovirus 1 J. Virol., January 15, 2006; 80(2): 1053 - 1058. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Jing, T. M. Chong, C. L. McClurkan, J. Huang, B. T. Story, and D. M. Koelle Diversity in the Acute CD8 T Cell Response to Vaccinia Virus in Humans J. Immunol., December 1, 2005; 175(11): 7550 - 7559. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kim, J. S. L. Parker, K. E. Murray, and M. L. Nibert Nucleoside and RNA Triphosphatase Activities of Orthoreovirus Transcriptase Cofactor {micro}2 J. Biol. Chem., February 6, 2004; 279(6): 4394 - 4403. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Saha, S. Shuman, and B. Schwer Yeast-Based Genetic System for Functional Analysis of Poxvirus mRNA Cap Methyltransferase J. Virol., July 1, 2003; 77(13): 7300 - 7307. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Pei, B. Schwer, S. Hausmann, and S. Shuman Characterization of Schizosaccharomyces pombe RNA triphosphatase Nucleic Acids Res., January 15, 2001; 29(2): 387 - 396. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. K. Ho, A. Martins, and S. Shuman A Yeast-Based Genetic System for Functional Analysis of Viral mRNA Capping Enzymes J. Virol., June 15, 2000; 74(12): 5486 - 5494. [Abstract] [Full Text] |
||||
![]() |
Y. Pei, K. Lehman, L. Tian, and S. Shuman Characterization of Candida albicans RNA triphosphatase and mutational analysis of its active site Nucleic Acids Res., May 1, 2000; 28(9): 1885 - 1892. [Abstract] [Full Text] [PDF] |
||||
![]() |
|