INTRODUCTION

Folylpolyglutamate synthetase (FPGS¹; tetrahydrofolate:L-glutamate -ligase (ADP-forming), EC) activity is required for the synthesis and cellular retention of functional folate coenzymes and for the conversion of many antifolates to more active forms (1, 2, 3, 4, 5, 6). FPGS activity is highest in proliferating tissues and activity, and mRNA levels increase after mitogen stimulation and decline during differentiation (7, 8, 9, 10). It has been proposed that a coordinate down-regulation of folate enzymes including FPGS, and a consequent limitation in macromolecule synthesis, may be an early programmed event in cell maturation (10). The ability of human leukemia blast cells to metabolize methotrexate to polyglutamate derivatives has been correlated with efficacy of methotrexate treatment (11), and a wide variation in FPGS activity and in FPGS mRNA levels has been found in leukemia blast cells (8, 12). Increased expression of FPGS activity in model cells leads to increased sensitivity to antifolate drugs² while decreased FPGS activity is a mechanism for resistance to many antifolates, both in model cell systems and in clinical samples (5, 13, 14, 15, 16).

Mammalian FPGS is a low abundance protein which has hindered its isolation in sufficient quantities for detailed physical analysis. Pig liver FPGS is the only mammalian enzyme to have been purified to homogeneity (17) although some characterizations of other crude or partially purified mammalian FPGS enzymes have been reported (18, 19, 20, 21, 22). In each case, only small amounts of protein have been obtained which has limited studies to kinetic analyses. The low abundance and instability of mammalian FPGS has complicated its purification in sufficient quantity to carry out mechanistic studies.

Mammalian cells possess both mitochondrial and cytosolic FPGS isozymes (23), and additional isoforms may be expressed in different tissues or in tumor cell (24). The Chinese hamster ovary (CHO) cell mutant AUXB1 lacks FPGS activity and as a result requires exogenous purines, thymidine, and glycine for growth (25, 26, 27, 28). Studies using AUXB1 cells transfected with Escherichia coli folC gene (FPGS) constructs that target the expressed protein to the cytosol or mitochondria have demonstrated that cytosolic FPGS activity is required for cytosolic folate accumulation and purine and thymidylate biosynthesis, while mitochondrial FPGS activity is required for mitochondrial folate accumulation and glycine biosynthesis (23, 29). Expression of E. coli FPGS solely in the mitochondria of AUXB1 cells restored normal folate accumulation and metabolism in the cytosol as well as in the mitochondria, demonstrating that pteroyltriglutamates synthesized in the mitochondria can be released into the cytosol, although these polyglutamate species cannot enter the mitochondria (14, 29).

We previously isolated a human FPGS cDNA (30) which encoded cytosolic FPGS and suggested that it might lack 5 sequences that could also encode the mitochondrial isozyme. Recently, Freemantle et al. (31) have described the organization of the 5 region of the human FPGS gene and have shown that the isolated cDNA lacks the 5 region of the mitochondrial leader sequence and that cytosolic and mitochondrial isozymes could be generated by alternate transcription start sites.

In this report, we describe the expression of human cytosolic FPGS in E. coli and the purification and properties of the enzyme. As a prelude to studying factors regulating the expression of FPGS in mammalian tissues and the role of the different isozymes, we have isolated and characterized the human gene. In this report, we describe the organization of the complete human FPGS gene, its localization, and splicing variants, and present a rationale for the role and need for mitochondrial and cytosolic FPGS isozymes.

EXPERIMENTAL PROCEDURES

L-[U-¹⁴C]Glutamate (specific activity 270 mCi/mmol) was obtained from Amersham, (6S)-5-formyltetrahydro[³H]folate (folinate, 5-formyl-H₄PteGlu, specific activity 20 Ci/mmol) was obtained from Moravek, and [-³⁵S]dATP (1000 Ci/mmol), [-³²P]dCTP (3000 Ci/mmol), and [-³²P]ATP (6000 Ci/mmol) were obtained from DuPont NEN. Folic acid, methotrexate, and aminopterin were obtained from Sigma and (6ambo)-H₄PteGlu from Fluka. Reduced and oxidized folylpolyglutamates were synthesized as described previously (17, 32) or were obtained from Schirck Laboratories. Concentrations of folate derivatives were calculated from their absorption spectra (33). Deficient -minimal essential medium lacking purines, glycine, thymidine, and folate was obtained from JRH BioSciences. DNA restriction and modifying enzymes and RNase A were obtained from Boehringer Mannheim, Promega, or New England Biolabs. AmpliTaq DNA polymerase was from Perkin-Elmer. Nitrocellulose was obtained from Schleicher and Schuell. Oligonucleotides were synthesized at the UC Berkeley Microchemical Facility. E. coli strain JM109(DE3) was obtained from Promega. All other materials were obtained from commercial vendors.

An NdeI restriction site was introduced at the first ATG in the human FPGS cDNA (pTZ18U-25 (30), accession number M98045[GenBank]) by mutagenesis using the procedure of Nakamaye and Ecksteine (34). The antisense primer 5-CTGGTACTCCATATGCTCGGCTCCTG-3 introduced an AT dinucleotide between bases 70 and 71 of the cDNA (Fig. 1). A 2117-bp NdeI-BamHI fragment from pTZ18U-25-NdeI, containing the entire open reading frame of human FPGS, was ligated into similarly treated pET3A (Novagen). Plasmid pET3A has the bacteriophage T7 gene 10 promoter and transcriptional termination sequences. This new construct, pET3A-25 was transformed into E. coli JM109(DE3) for the production of unfused human FPGS.

To improve expression in E. coli, 12 of the first 27 codons in the cDNA ORF were modified for optimal codon usage (35). The complementary oligonucleotides 5-TATGGAATACCAGGACGCTGTTCGCATGCTGAACACCCTGCAGACCAACGCTGGCTACCTGGAACAGGTTAAACGCCAGCGCG-3 and 3-ACCTTATGGTCCTGCGACAAGCGTACGACTTTGTGGGACGTCTGGTTGCGACCGATGGACCTTGTCCAATTTGCGGCGCGCCACTG-5 were lyophilized, resuspended in 90% formamide, and purified by PAGE. Each primer was phosphorylated using T4 polynucleotide kinase, and the primers were annealed to each other by heating at 100 °C for 3 min followed by slow cooling to room temperature in 60 mM Tris buffer, pH 7.5, containing 6 mM MgCl₂, 10 mM dithiothreitol, and 400 µM ATP. Five micrograms of pET3A-25 was digested with NdeI and BstEII and purified by agarose gel electrophoresis. Approximately 0.5 µg of this DNA was ligated with 10 µl of the annealed oligonucleotides in a total volume of 20 µl. Half of this reaction mixture was transformed into JM109(DE3) and 4 transformants, whose inserts lacked an NaeI restriction site, were subjected to double-stranded sequencing (Sequenase, version 2) to verify the new primary structure at the 5 end of the cDNA (pET3A-25*).

Two different constructs of the human FPGS cDNA in plasmid pSVK-3 (Pharmacia Biotech Inc.) were prepared as shown in Fig. 1. Plasmid pSVK-hFPGScyt was constructed by ligating the 2130-bp EcoRI fragment from pSE936-25 (30) into similarly treated pSVK-3. In some constructs, most of the 3-untranslated region was deleted by digesting the plasmid with XbaI and religating (Fig. 1). Plasmid pSVK-hFPGSmit was made by ligating an 1860-bp XbaI fragment from pSE936-3 (30), which contained the human FPGS cDNA with the longest 5 region, into similarly treated pSVK-3. This construct adds an in-frame ATG upstream of the cDNA sequence (Fig. 1). Plasmids were purified by cesium chloride density centrifugation. These plasmid constructs insert the human FPGS cDNA downstream from an SV40 early promoter and transcriptional start region and upstream from a small tumor antigen splice site and a poly(A) signal. The inserts provide the first ATG for translational initiation.

CHO AUXB1 cells were cultured in deficient -minimal essential medium containing 10% dialyzed fetal calf serum, glycine, thymidine, and hypoxanthine as described previously (29, 36). Cells were transfected with pSVK-hFPGScyt or pSVK-hFPGSmit (10 µg), and transfectants were selected by their ability to grow in medium containing folate and glycine but lacking thymidine and purines, and individual transfectants were cloned as described previously (36). The ability of the cloned transfectants to grow in the absence of glycine was assessed as described previously (28). Procedures for the subcellular fractionation of CHO cells, the measurement of subcellular distributions of FPGS and marker enzyme activities, and the measurement of intracellular folate accumulation and folylpolyglutamate chain length distributions have been previously described (23, 29, 36).

FPGS activity was monitored during enzyme purification procedures and in CHO cell extracts by the incorporation of [¹⁴C]glutamate (250 µM) into folylpolyglutamate products using (6ambo)-H₄PteGlu as the substrate, as described previously (23). Assays were normally conducted for 1 h at 37 °C. In kinetic studies with pure enzyme, the assay mixtures contained various concentrations of the substrate under investigation and fixed concentrations of (6ambo)-H₄PteGlu (40 µM), ATP (1 mM), and L-glutamate (2 mM), as appropriate. The amount of FPGS was adjusted to ensure that less than 10% of the limiting substrate was converted to product at the lowest substrate concentration used.

All buffer solutions were adjusted to the indicated pH at room temperature. Extracts were maintained at 0 °C, and all other procedures were performed at 0-4 °C.

JM109(DE3) harboring plasmid pET3A-25 was grown to midlog phase in Luria media containing 50 µg/ml ampicillin and 0.5% glycerol (15 liters). The cells were collected by centrifugation at 650 × g for 10 min. The cell paste (114 g) was resuspended in 100 mM Tris-HCl buffer, pH 7.5 (300 ml), containing 2.5 mM EDTA, 50 mM mercaptoethanol, and 1 mM phenylmethylsulfonyl fluoride, and the cells were disrupted using a Branson sonicator (power setting 8 using a 50% duty cycle for 3 × 8 min). The extract was then centrifuged at 12,000 × g for 45 min, and the supernatant was decanted through a double layer of cheesecloth to give the crude extract (fraction 1).

The crude extract (325 ml) was applied to a hydroxylapatite (Bio-Rad) column (7.5 × 7.5 cm) that had been equilibrated with 100 mM Tris-HCl buffer, pH 7.5, containing 2.5 mM EDTA and 50 mM mercaptoethanol (Buffer A). The column was washed with the equilibration buffer (1000 ml) and eluted with a linear gradient (1500 ml) of potassium phosphate buffer, pH 7.5 (0-150 mM) in the same buffer. Fractions containing FPGS activity were pooled (fraction 2).

Fraction 2 enzyme (450 ml) was applied to an Affi-Gel Blue (Bio-Rad) column (20 × 1.5 cm) that had been equilibrated with Buffer A. The column was washed with Buffer A containing 150 mM KCl (300 ml) and a linear gradient (500 ml) of KCl (0.15-1 M) in the same buffer was used to elute the enzyme. Fractions containing FPGS activity were pooled (fraction 3).

Fraction 3 enzyme (224 ml) was applied to a phenyl-agarose (BRL) column (20 × 1 cm) that had been equilibrated with 100 mM Tris-HCl buffer, pH 7.5, containing 1 mM EDTA, 600 mM KCl, and 50 mM mercaptoethanol. The column was washed with the equilibration buffer (180 ml), and enzyme activity was eluted with 100 mM Tris-HCl buffer, pH 8.2, containing 1 mM EDTA, 50 mM mercaptoethanol, and 20% (v/v) ethylene glycol. Active fractions were pooled and dialyzed against 100 mM Tris-HCl buffer, pH 7.5, containing 0.5 mM EDTA and 50 mM mercaptoethanol (2 × 12 liter).

The dialyzed enzyme (fraction 4; 213 ml) was applied to a heparin-agarose (BRL) column (20 × 1 cm) equilibrated with 100 mM Tris-HCl buffer, pH 7.5, containing 1 mM EDTA and 50 mM mercaptoethanol. The column was washed with 150 ml of equilibration buffer and eluted with a linear gradient (300 ml) of KCl (0-500 mM) in the same buffer. Fractions containing FPGS activity were pooled and dialyzed against 2 × 4 liters of 50 mM Tris-HCl buffer, pH 8.4, containing 0.5 mM EDTA, 50 mM mercaptoethanol, and 10% ethylene glycol (fraction 5).

Fraction 5 enzyme (20 ml) was applied to a DE52 (Whatman) column (20 × 1 cm) equilibrated with 50 mM Tris-HCl buffer, pH 8.4, containing 0.5 mM EDTA, 10% (v/v) ethylene glycol, and 50 mM mercaptoethanol. The column was washed with equilibration buffer (150 ml) and eluted with a linear gradient (300 ml) of KCl (0-500 mM) in the same buffer. Fractions containing FPGS activity were pooled giving fraction 6 (11 ml).

Protein purity was analyzed by polyacrylamide electrophoresis in sodium dodecyl sulfate (SDS-PAGE) using a 4% stacking gel and a 12.5% separating gel (37). Protein bands were visualized by a silver staining procedure. Total protein was determined on pooled fractions by a modified Lowry procedure (38) using bovine serum albumin as the standard.

A human lung fibroblast cell line W138 genomic library in the Lambda FIX II vector (obtained from Stratagene), was screened (10⁶ plaques) with [³²P]dCTP-labeled primers generated using the Random Primed DNA Labeling Kit (Boehringer Mannheim) and a human FPGS cDNA (30) as the template. Following plaque purification, 3 positive clones were obtained. The phage DNA from these clones were purified and characterized by restriction mapping and Southern hybridization using an EcoRI-BamHI 375-bp fragment of the 5 region and a 355-bp XbaI-EcoRI 3 region fragment of the human cDNA. XbaI fragments of the genomic clones, and the entire clones bordered by NotI sites, were subcloned into pBKS⁺ (Stratagene) for further analysis.

DNA was sequenced by the method of Sanger et al. (39) using Sequenase version 2.0 (United States Biochemical Corp.). Exon-intron junctions were determined by direct sequencing across the junctions using oligonucleotide primers based on the cDNA sequence. Intron sizes were determined by sequencing through the region or by PCR using flanking primers. The FPGS gene sequence, with the exception of parts of 4 introns, was determined and verified by sequencing both DNA strands.

5-RACE Analysis of FPGS cDNA Ends

Total RNA was isolated from human HepG2 cells with guanidinium thiocyanate followed by cesium chloride centrifugation (40) or using Tri Reagent (Molecular Research Center) according to the manufacturer's instructions. Primers used in this study are shown in Table I. cDNA corresponding to the 5 end of HepG2 mRNA was synthesized and amplified (41) using a Marathon cDNA Amplification Kit (Clontech) and following kit instructions with the following modifications. Antisense primer L5 was used, instead of oligo(dT), to synthesize the first strand cDNA. After the anchor (Clontech) ligation, the cDNA was first PCR-amplified with the anchor primer (Clontech) and an inner gene specific antisense primer (L4). One µl of the resulting PCR product was reamplified with the anchor primer and another nested gene-specific antisense primer (L2). PCR was carried out at 94 °C for 5 min, and for 35 cycles at 94 °C for 1 min, 57 °C for 0.5 min, and 72 °C for 0.5 min, with a final extension at 72 °C for 5 min. PCR products were analyzed on a 2.0% agarose gel with X174/HaeIII-digested DNA (Promega) as size standards. Bands of interest were excised, and the DNA was purified using a QIAEX gel extraction kit (Qiagen) and cloned into a pGEM-T vector (Promega).

Table I. Primers used in 5-RACE and primer extension studies Primer Sequence (5 to 3) Direction Gene locationa Exon 2J GCGGATCCGCTCCCGAA Antisense 5 L5 CATAGCTTCGGAGGATACATT Antisense 1734 to 1755 4 L4 CCAGTGACGTGGATGATGTT Antisense 1596 to 1615 3 L2 ATGGCTTCCAACTGTGTCTGA Antisense 1438 to 1458 2 L5A1 GTACTCCATGCTCGGCTCCT Antisense 116 to 135 1/1B L5C1 CCTCTTTCCCCACTCTCACT Antisense 461 to 480 1C L5B1 AGCCCCCTTGCGCCACTAAA Antisense  180 to 161 1A L5B2 CCACTAAAAAGCCGCCCCTTC Antisense  192 to 172 1A L51 AGACGCCGCTGCCAGGAATAGA Antisense 33 to 54 1 L52 GGCTCCGCGCCCGCGACATAGT Antisense  3 to 19 1 PR1 GCGGCACCGGCCACGCGCTCAAGCC Antisense 91 to 115 1 PR2 ACCTGCTCCAGGTAGCCGGCATTGG Antisense 1392 to 1416 2 T-1 CAGACTCCGGGATCACTGGAACTC Antisense 430 to 453 1C U2 CAGGAGCCGAGCATGGAGTA Sense 116 to 134 1 a Numbered from the first base (+1) of the ATG codon of the mitochondrial leader sequence.

In other studies, a 5AmpliFINDER RACE kit (Clontech) was used. Primer L5 was used to initiate first strand cDNA synthesis. Anchor primer from the kit and primer L4 were used to amplify the cDNA with the same cycling profile as described above. The resulting PCR products were ethanol-precipitated and directly cloned into the pGEM-T vector. Ampicillin-resistant colonies were screened with a probe generated by amplification of the human FPGS cDNA using primers U2 and L2 labeled with [-³²P]dCTP. Positive colonies were further analyzed by hybridization with ³²P-labeled antisense oligonucleotides L5A1, L5B1, or L5C1 which are specific for human FPGS exons 1 plus 1B, 1A, and 1C, respectively (Fig. 3). Positive colonies recognized by each probe were further characterized by restriction enzyme digestion, and clones with larger size inserts were sequenced.

The 5 transcriptional ends of fetal liver FPGS mRNA was also assessed by RACE using human fetal liver 5-RACE-Ready cDNA (Clontech). Antisense primers 2J, L5, L4, and L2 were used successively to PCR-amplify the 5 transcriptional end.

Oligonucleotide primers complementary to the 5 end of the human FPGS cDNA sense strand sequence (PR1, PR2, L5A1, L51, L52, L5B1, L5B2, T-1, and L5C1) were labeled at the 5 end with [-³²P]ATP (6000 Ci/mmol) using T4 polynucleotide kinase and purified on Sephadex G-25 Quick Spin columns (Boehringer Mannheim). Labeled probe (2 × 10⁶ cpm) was hybridized to 50 µg of HepG2 total RNA in 1 × reverse transcriptase buffer (BRL) at 75 °C for 10 min and 30 °C for 60 min. Primer and RNA were coprecipitated with ethanol, and the pellet was resuspended in 50 µl of reaction solution containing 1 × reverse transcriptase buffer, avian myeloblastosis virus or Moloney murine leukemia virus reverse transcriptase (40 units), 10 mM dithiothreitol, and 0.2 mM concentration of each dNTP with or without 5% dimethyl sulfoxide (26, 27). The primer was first extended at 42 °C for 30 min. Additional reverse transcriptase (40 units) was then added, and the mixture was incubated at 52 °C for 30 min. The RNA was digested with 20 µg of DNase-free RNase A at 37 °C for 30 min. Ammonium acetate (final concentration 2 M) was added, and the samples were extracted with 50 µl of phenol/chloroform/isoamyl alcohol (25:24:1). Following ethanol precipitation, the pellet was washed with 70% ethanol, air-dried, and resuspended in 5 µl of DNA sequencing stop solution (U. S. Biochemical Corp.). The DNA products were analyzed on a 6% polyacrylamide-urea sequencing gel and compared to DNA sequence reaction products obtained with human FPGS genomic DNA (clone 9-4) using the same ³²P-labeled oligonucleotide as the sequencing primers (42).

The 4.5-kb XbaI fragment of genomic clone 9 (Fig. 3) corresponding to the 5 end of the cDNA, was subcloned into pBKS⁺ (Stratagene). The 2.7-kb fragment of the 5-region of this insert, from the NotI site of the vector to the SacII site of the insert, was ligated to the SacII-NotI 3-fragment (17 kb) of genomic clone 5 to construct the entire FPGS gene. The FPGS gene was subcloned into the NotI site of pBKS⁺.

A FPGS cDNA probe were labeled with biotin-11-dUTP by nick translation and hybridized to metaphase chromosomes prepared from normal male peripheral blood by the bromodeoxyuridine synchronization method (43). In situ hybridization, amplification, and detection with avidin-conjugated fluorescein isothiocyanate was as described previously (44). Two amplifications were carried out using biotinylated anti-avidin. Metaphase chromosomes were counterstained with Chromomycin A₃ followed by Distamycin A, by a modification of the procedure of Magenis et al. (45), to generate clear reverse bands.

RESULTS

A variety of constructs of the human FPGS cDNA were cloned into various E. coli expression vectors in an attempt to overexpress the human protein. In the studies described in this report, an NdeI site was introduced at the first ATG in the cDNA, and an NdeI-BamHI fragment encoding the entire open reading frame was subcloned into pET3A and expressed in JM109(DE3). Plasmid pET3A has a bacteriophage T7 gene 10 promoter and ribosome binding site and transcriptional termination sequences. JM109(DE3) is a lysogen that has the bacteriophage T7 RNA polymerase linked to the lacUV5 promoter. FPGS was expressed at about 0.5% of the total soluble protein in E. coli crude extracts. Use of a modified cDNA in which the first 27 codons were optimized for preferred codon usage in E. coli (pET3A-25*) increased expression up to a maximum of about 1.2% of soluble protein. Although a T7 promoter vector was used in these studies, IPTG induction of T7 polymerase reduced or eliminated expression of active human FPGS. High level expression of human FPGS in E. coli appeared to be toxic and loss of plasmid, plasmid rearrangement, and deletions were observed after IPTG induction.³ However, expression of active enzyme above 1% soluble protein could not be achieved and consistent expression at this level required the use of freshly transformed cells. Expression of the cDNA in trp-lac vectors, such as pTRC99 (Pharmacia), resulted in similar or lower levels of expression. We have now modified the culture conditions to allow IPTG induction of the T7 vectors and obtain over 50 mg of human FPGS per liter of culture medium, most of which is in inclusion bodies,³ and have also overexpressed the enzyme using modified Baculovirus expression vectors,³ but report here the purification of enzyme expressed in E. coli as the kinetic data described in this report were obtained with FPGS purified from E. coli.

Table II shows a typical purification obtained with the pET3A-25 construct, which expressed human FPGS at about 0.5% of soluble protein in E. coli. Chromatography on hydroxylapatite resulted in a 2-fold purification of the enzyme and also removed nucleic acids from the crude preparation. FPGS was purified another 10-fold by chromatography on Affi-Gel Blue. Most of the applied protein did not bind to this column, and FPGS was eluted with a KCl gradient. The final purification was achieved by chromatography on phenyl-agarose, heparin-agarose, and DEAE-cellulose, respectively. Purified enzyme was judged to be homogeneous by SDS-PAGE (Fig. 2). A single band was observed with an apparent M_r of about 61,000, which is consistent with the deduced amino acid sequence (545 amino acids, M_r = 60,128). This purification procedure has been repeated multiple times, starting with FPGS enrichments in crude extracts ranging from 0.1 to 1.2% and has resulted in homogeneous enzyme each time.

Table II. Purification of human folylpolyglutamate synthetase Experimental conditions are described under ``Experimental Procedures.'' Experimental conditions are described under ``Experimental Procedures.'' Fraction Volume Activity Protein Specific activity Purification Yield ml units/mla mg/ml units/mg -fold % Crude 325 2,560 30.6 82.5 1 100 Hydroxylapatite 450 1,540 8.90 173 2 83 Affi-Gel blue 224 2,660 1.39 1,910 23 71 Phenyl-agarose 213 1,180 0.156 7,580 92 30 Heparin-agarose 20 7,920 0.671 11,800 143 19 DEAE-cellulose 11 12,900 0.701 18,400 223 17 a Nanomoles of glutamate incorporated into folate product per h. Assay mixtures contained 5 mM ATP, 40 µM H4PteGlu, and 250 µM glutamate.

3

Activity required a monovalent cation. K⁺ (20 mM) was most effective, followed by NH⁺₄ and Rb⁺, while Na⁺, Li⁺, and Cs⁺ were ineffective. There was an absolute requirement for a reducing agent and the enzyme displayed a high pH optimum (pH 9.6). The K_m values for L-glutamate and MgATP were 201 µM and 200 µM. Activity was stimulated by sodium bicarbonate (10 mM), which caused a 4-fold decrease in the K_m for MgATP (54 µM) and a 20% increase in V_max.

The kinetic constants for a variety of folates and folate analogs are shown in Table III. Enzyme concentrations and incubation times were adjusted to minimize the addition of more than one glutamate moiety to the folyl or antifolyl substrate and to ensure initial rate conditions. Marked substrate inhibition was observed with many of the substrates that displayed a high affinity for the enzyme. V_max/K_m values shown in Table III are the on rates for the folate substrates (32) and are a comparison of the reaction rates with the different substrates at concentrations considerably below the K_m for the substrate.

Table III. Kinetic constants of folates and folate analogs for human folylpolyglutamate synthetase Enzyme activity was assayed as described under ``Experimental Procedures.'' Assay mixtures contained various concentrations of the indicated substrate, ATP (1 mM) and L-glutamate (2 mM). Enzyme activity was assayed as described under ``Experimental Procedures.'' Assay mixtures contained various concentrations of the indicated substrate, ATP (1 mM) and L-glutamate (2 mM). Substrate Km Vmax (rel)a Vmax/Km (rel)a µM PteGlu 59 66 4.9 PteGlu2 16 83 23 PteGlu3 20 56 12 PteGlu4 12 34 13 PteGlu5 64 1 0.07 H2PteGlu 0.81 85 460 H2PteGlu2 47 96 8.3 (6ambo)-H4PteGlu 1.6 83 230 (6S)-H4PteGlu 4.4 100 100 (6S)-H4PteGlu2 3.3 82 109 (6S)-H4PteGlu3 1.4 19 60 (6S)-H4PteGlu4 1.6 10 29 (6S)-H4PteGlu5 1.4 0.6 1.9 (6R)-10-formyl-H4PteGlu 3.7 23 27 (6R)-10-formyl-H4PteGlu2 2.7 30 49 (6S)-5-formyl-H4PteGlu 105 85 3.6 (6S)-5-formyl-H4PteGlu2 13 68 23 (6S)-5-methyl-H4PteGlu 48 83 7.6 Aminopterin 4.4 118 118 Methotrexate (Glu-1) 71 94 5.8 Methotrexate (Glu-2) 50 16 1.4 Methotrexate (Glu-3) 148 3.2 0.086 5-Deazaacyclotetrahydrofolate 5.3 107 89 2-Methyl-5,8-dideazaisofolate 2.8 101 158 a Values are relative to that obtained with (6S)-H4PteGlu (equals 100). Vmax 59 µmol/h/mg, kcat 0.99 s1; kcat/Km 0.225 × 106 M1 · s1.

Unsubstituted reduced folates are the preferred substrates for FPGS. H₂PteGlu was the most effective substrate with the lowest K_m value. H₄PteGlu was almost as effective and the 6ambo mixture displayed a lower K_m than the 6S isomer, suggesting a preference for the unnatural 6R diastereoisomer of H₄PteGlu. PteGlu was a fairly poor substrate due to its high K_m value. 10-Formyl-H₄PteGlu displayed a low K_m value but 10-substitution caused a drop in V_max. Substitution at the 5-position of folates resulted in a large increase in K_m values. (6S)-5-Formyl-H₄PteGlu was a poor substrate although previous studies (21, 46), using partially purified enzyme, had suggested that it was an effective substrate for human FPGS.

H₄PteGlu_n derivatives were the most effective polyglutamate substrates. Extension of the glutamate chain decreased K_m values but also caused a decrease in V_max with chain lengths beyond the diglutamate. With most folates, the diglutamate derivative was a more effective substrate than the monoglutamate due primarily to a decrease in K_m value, a decrease that was most pronounced for 5-formyl-H₄PteGlu₂. However, H₂PteGlu₂ was a poor substrate due to a large increase in K_m value.

The folate analogs 5-deazaacyclotetrahydrofolate, an inhibitor of transformylases involved in purine synthesis (47), and 2-methyl-5,8-dideazaisofolate, an inhibitor of thymidylate synthase (48), were very effective substrates of human FPGS (Table III). Polyglutamates of these compounds are much more potent inhibitors of their target enzymes than the monoglutamate derivatives. Aminopterin was a very good substrate for the enzyme with the 4-amino substitution decreasing K_m values by about 15-fold compared to PteGlu, while methotrexate was less effective due to an increased K_m. Extension of the glutamate chain of methotrexate decreased substrate effectiveness primarily due to a drop in V_max values, and the triglutamate derivative was an extremely poor substrate.

A Lambda Fix II library was screened as described under ``Experimental Procedures,'' and three clones were obtained, two of which were found to be identical by restriction enzyme mapping and Southern analysis. One clone (C5, Fig. 3) lacked the 5 region of the FPGS cDNA. The second clone (C9) overlapped clone C5 and contained an additional 10 kb of 5 region, but lacked the region corresponding to the 3 end of the cDNA (Fig. 3). XbaI fragments were subcloned into pBKS⁺ and intron/exon junctions were sequenced using primers to various regions of the cDNA (Table IV). All intron/exon splice junctions follow the GT-AG rule (49). The XbaI fragments were sequenced in both directions, and the sequence of the gene, with the exception of parts of four intronic regions, was obtained. The human FPGS gene spans about 12 kb and consists of 15 exons and 14 introns (Fig. 3, Table IV). Two sequences, corresponding to the 5 region of the gene to the 5 end of intron 4 (accession number U24252[GenBank]) and the 3 region of intron 4 to the 5 region of intron 11 (accession number U24253[GenBank]), have been deposited in the GenBank^TM data base. The coding sequence of the gene was in agreement with our previously published cDNA sequence (30).

Table IV. Exon-intron splice junctions of the human FPGS gene Exon Positiona Intron 5-Splice donor Intron size 3-Splice acceptor bp 1 1 -138 1 G GAG TAC CAG gtatcaggcg 1222 tggttgccag GAT GCC GTG CGC ATG Glu Tyr Gln Asp Ala Val Arg Met 1A 1A CGCAAGGGGGCTG gtcggtggta 1519 tggttgccag GAT GCC GTG CGC ATG Asp Ala Val Arg MET 1B 1B GCTAGCCGAGAGG gtatcgggag 1128 tggttgccag GAT GCC GTG CGC ATG Asp Ala Val Arg MET 1C 1C GTGGGGAAAGAGG gtagggaaga 880 tggttgccag GAT GCC GTG CGC ATG Asp Ala Val Arg MET 2 139 -267 2 T GGG CTG CAG gtaaggtaga 85 tctgtcccag GTG GAG GAC T Gly Leu Gln Val Glu Asp 3 268 -321 3 G AAG GGG AAG gtgaggggca 83 ttctttcaag GGC TCC ACC T Lys Gly Lys Gly Ser Thr 4 322 -386 4 GA TTC TTT AG gtactggctt  ~2000b gtcccggcag C TCT CCC CAC Phe Phe Ser Ser Pro His 5 387 -501 5 G GAG ACC AAG gtgccgcatg 120 tgtgccacag GAT GGC AGC T Glu Thr Lys Asp Gly Ser 6 502 -579 6 C CAA GAG AAG gtgtgtgccc 134 tctttgacag GTG GAC CTG G Gln Glu Lys Val Asp Leu 7 580 -641 7 AC ATC ATC AG gtgagcgcag 101 tcccctgcag G AAG CCT GTG Ile Ile Arg Lys Pro Val 8 642 -744 8 C ATC TTT AAG gtgaccaggc 545 ccctccacag CAA GGT GTC C Ile Phe Lys Gln Gly Val 9 745 -822 9 G CAG ATC TCA gtaagtctga 246 tctcccctag TGT CCT CTA T Gln Ile Ser Cys Pro Leu 10 823 -970 10 GAC CGC CAT G gtgagtgggc 94 caccccgcag GT GCT GGG GA Asp Arg His Gly Ala Gly 11 971 -1060 11 ATG CGG CTC G gtgagttaga  ~800b cctcccccag GG CTT CGG AA Met Arg Leu Gly Leu Arg 12 1061 -1211 12 GG CCG AGC GG gtgaggggca 196 tctgtcgcag T GGC CCC GAG Pro Ser Gly Gly Pro Glu 13 1212 -1287 13 CTG CTG CAG gtgaggggcc  ~850b ggccttctag CCC TGC CAG T Leu Leu Gln Pro Cys Gln 14 1288 -1354 14 GGC AAC GCA G gtgagaggtg  ~2000b tgccccacag AC CAA CAG AA Gly Asn Ala Asp Gln Gln 15 1355 -2214 AATTAAAGCCTTTGTTTTT pre-1Ac ATTTCCTAGCA gtggggcca 334 tggtcccgag GCCTGCCCCTCAC a Position in cDNA starting from first base of ATG of mitochondrial leader sequence. b Intron sizes were assessed by PCR. All others were determined by PCR and direct sequencing. c Potential upstream exon to exon 1A. Intronic region bases 556 to 223, numbered from ATG of mitochondrial leader sequence (+1).

Freemantle et al. (31, U14939[GenBank]) recently reported the sequence of the 5 genomic region of human FPGS and demonstrated that the originally isolated cDNA lacked 56 bp of coding region, including an upstream ATG which was preceded by Sp1 sites, and that multiple transcription start sites in this region can result in cytosolic and mitochondrial forms of FPGS. Our sequence is in agreement except for some differences in intron 1. These include additional C residues at +160, +167, and +337 (numbered from the ATG codon of the mitochondrial leader sequence) and GC transpositions at +215/216 and +350/351, and G instead of A at +982. An additional 170-bp BamHI fragment (residues +396 to +566) is not present in U14939[GenBank]. This additional region is not a cloning artifact as it contains part of an alternate exon 1 identified by 5-RACE of human mRNA (see below). The C5 clone starts at a Sau3aI (BamHI) site at residue +566.

5-RACE analysis of RNA from HepG2 cells using nested antisense primers to exon 3 and exon 2 regions resulted in multiple species of different length. The products were cloned and sequenced, and the longest form obtained for the exon 1 region started at 43 (Fig. 3), which agrees with the transcription start site suggested by Freemantle et al. (22). The sequences of the RACE products were identical with the gene and cDNA sequences except HepG2 mRNA had a G at position +64 instead of an A. Additional alternate exon 1 regions (Fig. 3, Table IV), that were distinct from exon 1 and from any previously isolated cDNA sequence, were also detected and, in each case, the 5 sequence of the product obtained (Fig. 3) was identical with a region of the gene and the junction of the 5 region with exon 2 matched consensus splice junctions (Table IV). Several of these species were due to alternate splicing in intron 1 at positions +233 (exon 1B) and +481 (exon 1C) (Fig. 3).

The 5 end of the longest 5-RACE products obtained encoding exon 1B (+122, Fig. 3) extended into exon 1 suggesting that some of the exon 1B forms arose by splicing of an exon 1 transcript at +233 rather than at +139. However, some of the exon 1B RACE products did not extend into exon 1 and may represent separate transcripts. It may be that transcripts that start late in the exon 1 region do not get spliced at position +139. If exon 1B arose by extension of exon 1, and the translation product started at the exon 1 cytosolic ATG (+127), the resulting mRNA would be out of frame with codons in the exon 2 region. However, translation of this variant could start at an alternate ATG at the beginning of exon 2 at position +1373 (Table IV) equivalent to amino acid residue 9 in the cytosolic form of the protein, although this unlikely (see below).

None of the 5-RACE products obtained for exon 1C, which varied in size, extended as far upstream as exon 1B and the longest form obtained started at +285 (Fig. 3). Primer extension analysis, using primers specific to the exon 1C region (L5C1 and T-1), indicated multiple species with major starts at +330 and +373 and failed to indicate longer species that extended into exon 1B. This region is preceded by potential Sp1 binding sites (+264 to +269 and +356 to +361) and an E2A site (+331 to +338). Exon 1C lacks an in-frame start ATG although translation of this variant could also start at the alternate ATG at the beginning of exon 2 (Table IV).

An additional splice variant encoded an upstream exon (exon 1A, Table IV, Fig. 3) spliced to exon 2. Again, 5-RACE products of various lengths, with different 5 ends, were obtained, the longest starting at position 213 (Fig. 3). All 5 sequences terminated at residue 160, a consensus splice junction (Table IV). Primer extension analysis using exon 1A specific probes (L5B1, L5B2, Table I) indicated several starts equivalent to positions 288 and 226, assuming no additional splicing in this region (see below).

Exon 1A precedes all the Sp1 binding sites but is preceded by a computer identified Adh1 promoter site (256 to 251), imperfect TATA sites (240 to 235, 434 to 429), an APRT promoter site (469 to 462), and an E-box insulin-responsive element (456 to 449) (50). Exon 1A does not contain a start ATG, although translation of the longest 5-RACE product for exon 1A would give a peptide (SPGWCTRKGRLFSGARGL) with characteristics of a mitochondrial leader sequence (51). Thr-6 in this sequence is encoded by an ACG codon (198), which is a possible alternate translation start codon. An examination of the sequence upstream of exon 1A also indicates a potential splice site 9 bases upstream of the longest 5-RACE product (223, Table IV). The upstream region also contains various ATG codons, one of which at position 565 is followed by a potential splice junction (556). Translation from this ATG, which removal of a potential intron (556 to 223) would generate the peptide MLAACPSPGWCTRKGRLFSGARGL. The longest primer extension products obtained with exon 1A specific primers were of sufficient size to start prior to this potential ATG. The region upstream of this potential start ATG contains a consensus CTF/NF-1 site (803 to 795) (52).

In initial 5-RACE studies, the major transcripts obtained from HepG2 mRNA encoded the exon 1A variant while exon 1 and exon 1C variants predominated in the human fetal liver library. Further 5-RACE studies indicated all four variants in HepG2 mRNA. Differences in distributions between experiments probably reflected PCR variations. To further investigate the distribution of these variants and to check for other variants, 5-RACE was performed on HepG2 mRNA using an exon 4 primer (L5) for first strand cDNA synthesis and PCR was performed with an exon 3 antisense primer (L4), but no nested primer was used. The products obtained were cloned into a pGEM-T vector and 1000 individual colonies of E. coli transformants expressing this vector were screened with a labeled probe composed of the most 3 23 bp of exon 1 and the most 5 98 bp of exon 2. 548 clones gave a positive signal. The positive clones were then screened with labeled primers L5A1, L5B1, or L5C1 (Table I) which are specific for exons 1 and 1B, 1A, and 1C, respectively. The exon 1/1B probe hybridized with 287 colonies (52%). Nine of these clones were sequenced and seven encoded the exon 1 variant while 2 encoded the exon 1B variant. The exon 1A probe hybridized with 87 colonies (16%). However, only 3 of 11 clones sequenced encoded the exon 1A variant, the remainder encoded the exon 1C variant. The exon 1C probe hybridized to 82 colonies (15%), and all 6 clones sequenced encoded the exon 1C variant. Seventeen percent (92) of the clones recognized by the exon 1/exon 2 primer were negative when probed with the exon 1 variant specific primers. Five of these were sequenced. Three extended only 5 bp into exon 1, while 2 were unspliced at the 5 end of exon 2 and contained a short region of the 3 end of intron 1. Whether the latter represents a splicing intermediate or an additional variant was not ascertained.

Preliminary Northern analyses using exon 1 variant specific probes have been conducted to overcome the bias that might be introduced by PCR. The predominant variants in MCF7 cells were the exon 1 (2.5 kb) and exon 1C (2.4 kb) forms, which were approximately equally distributed, while exon 1 variants predominated over exon 1C variants in HepG2 cells. Transfection of CHO AUXB1 cells with a genomic construct that could only express the exon 1C variant failed to restore growth in medium lacking thymidine and purines but the transcribed message was not spliced in these cells. Expression of a cDNA construct containing exons 2 to 15, but lacking all exon 1 regions, under the control of an SV40 promoter, also failed to restore growth under these conditions. As synthesis of a functional FPGS from the exon 1B and 1C variants would require translation from an ATG at the start of exon 2 (Table IV), it is unlikely that exon 1B and 1C mRNA variants are translated to produce a functional FPGS.

FPGS is located in the mitochondria and cytosol of eukaryotic cells and mitochondrial FPGS activity is required for mitochondrial 1-carbon metabolism (23, 29) and for a normal 1-carbon flux in the cytosol.⁴ In our initial report on the human FPGS cDNA (30), expression of the cDNA in CHO AUXB1 cells restored cytosolic thymidylate and purine synthesis, but the cells remained auxotrophic for glycine, suggesting the absence of FPGS activity and a folate pool in the mitochondria. Freemantle et al. (31) showed that expression of the complete cDNA containing the entire mitochondrial leader sequence restored glycine prototrophy to these cells, suggestive of at least mitochondrial expression of FPGS.

cDNA constructs were prepared containing (hFPGSmit) or lacking (hFPGScyt) an upstream ATG codon (Fig. 1), and the constructs were expressed in AUXB1 cells. hFPGSmit was constructed prior to knowledge of the exact nature of the FPGS leader sequence to investigate whether the 5-untranslated region of the cDNA could encode part of a leader sequence and to develop model cells expressing human FPGS in the mitochondria. The subcellular distribution of FPGS activity and folylpolyglutamates and their chain length distribution in representative AUXB1 transfectants are shown in Table V. About 50% of the FPGS activity and 40% of cellular folate are associated with the mitochondrial fraction in wild type CHO cells. AUX-hFPGScyt transformants grew in the absence of thymidine and purines but not glycine and expressed a wide range of FPGS activities (e.g. cyt1 and cyt2, Table V). No obvious differences were noted in the range of expression levels when the majority of the 3-untranslated region of the cDNA was deleted (Fig. 1). Essentially all the FPGS activity and cellular folate was associated with the cytosol in these transformants (Table V). The trace amount of folate in the mitochondrial fraction was of identical glutamate chain length distribution to cytosolic folate, suggesting cytosolic contamination of this fraction. Cells expressing higher levels of FPGS contained longer folylpolyglutamate species.

Table V. Subcellular distribution of FPGS activity and folylpolyglutamates in CHO cells Folate-depleted cells were cultured in deficient -minimal essential medium containing glycine, thymidine, hypoxanthine, and (6S)-5-formyl-H4[3H]PteGlu (10 nM) for 24 h, and subcellular fractions were prepared as described under ``Experimental Procedures.'' Folylpolyglutamates in mitochondrial (mito) and cytoplasmic (cyto) fractions were identified as described under ``Experimental Procedures.'' FPGS activity was measured in parallel experiments in cells cultured in identical medium lacking labeled folate. Glutamate dehydrogenase (GDH), a mitochondrial marker enzyme, was assayed as described under ``Experimental Procedures.'' Folate-depleted cells were cultured in deficient -minimal essential medium containing glycine, thymidine, hypoxanthine, and (6S)-5-formyl-H4[3H]PteGlu (10 nM) for 24 h, and subcellular fractions were prepared as described under ``Experimental Procedures.'' Folylpolyglutamates in mitochondrial (mito) and cytoplasmic (cyto) fractions were identified as described under ``Experimental Procedures.'' FPGS activity was measured in parallel experiments in cells cultured in identical medium lacking labeled folate. Glutamate dehydrogenase (GDH), a mitochondrial marker enzyme, was assayed as described under ``Experimental Procedures.'' Cell Cell fraction FPGS GDH distribution Folate distribution Polyglutamate chain length distribution Activity Distribution 1 2 3 4 5 6 7 8 9 10 pmol/h/mg % % % % CHO WTT2a Cyto 155 54 26 62 3 1 1 3 24 42 20 6 1 0 Mito 529 46 74 38 2 1 1 1 7 22 48 13 5 0 AUX-hFPGScyt1 Cyto 273 96 25 98 0 0 0 1 9 33 43 14 1 0 Mito 35 4 75 2 0 0 0 0 9 32 43 16 0 0 AUX-hFPGScyt2 Cyto 3582 98 26 99 0 0 0 2 9 19 35 27 7 1 Mito 79 2 74 1 AUX-hFPGSmit Cyto 44 25 27 31 0 0 3 2 31 41 18 5 0 0 Mito 388 75 73 69 0 0 0 1 5 19 49 25 1 0 a Data for wild type CHO cell from Ref. 29.

Cells transfected with hFPGSmit constructs (AUX-hFPGSmit) were prototrophic for glycine, thymidine, and purines, and contained mitochondrial FPGS activity and folate (Table V). The latter half of the human FPGS mitochondrial leader sequence is sufficient to direct the protein to the mitochondria. The proportion of cellular FPGS activity recovered in the cytosolic fraction was similar to that of glutamate dehydrogenase, a mitochondrial matrix marker, suggesting that most, if not all, of the FPGS activity was mitochondrial in this transfectant. Similarly, most of the intracellular folate was mitochondrial although the proportion recovered in the cytosolic fraction was consistently slightly higher than that of glutamate dehydrogenase (Table V). AUX-hFPGSmit transfectants contain a small cytosolic folate pool of glutamate chain length distinct from, and shorter than, the mitochondrial folate pool, which was sufficient to allow growth in the absence of thymidine and purines.

AUXB1 cells co-transfected with the reconstructed complete FPGS gene and pCDNA3, a vector containing the neomycin gene, demonstrated similar transfection frequencies when selected for growth in the absence of glycine, purines, and thymidine or for G418 resistance. Most cells initially selected for G418 resistance were also prototrophic for glycine, purines, and thymidine.

Human FPGS was previously localized to chromosome 9 by somatic cell hybridization (53). The 2.2-kb FPGS cDNA was used to localize the gene to human chromosome band 9q34.1 (Fig. 4). Three independent experiments were performed and over 100 metaphase cells were evaluated. Signals were clearly seen on two chromatids of at least one chromosome band 9q34.1 in 40% of cells and at no other sites in greater than one cell.

DISCUSSION

Mammalian FPGS enzymes are low abundance and unstable proteins which has hampered their purification or isolation in significant quantities. Overexpression of a FPGS cDNA has allowed the purification of the human enzyme to homogeneity and characterization of its properties. The only other mammalian FPGS enzyme to have been purified, the pig liver protein, required about a 200,000-fold purification (30). Human FPGS has similar general properties to other mammalian FPGS enzymes. The K_m for MgATP reported here is similar to values previously reported for the human enzyme (21, 54) and is about 20-fold higher than the value for the pig liver enzyme (32). Bicarbonate is a nonessential activator of human FPGS (21, 54) and increases the affinity of the nucleotide substrate.

The enzyme has a pH optimum of approximately 9.4, which is similar to the pH optima of bacterial (55, 56, 57), yeast,⁵ and pig liver (17) enzymes. Other studies have reported a pH optima of about 8.3 (18, 21). This discrepancy is most likely due to the use of higher concentrations of glutamate in previous assays and possibly decreased stability of the enzyme in crude extracts at the higher pH. Studies with the pig liver enzyme showed that V_max/K_m values for glutamate demonstrated a steep pH profile with an optimum at pH 9.4 (17), similar to the pK of the amino group of glutamate, and that the enzyme functioned well at physiological pH provided higher levels of glutamate were provided. The K_m for glutamate reported here is lower than that reported for extracts from human leukemia cells (54) or liver (21) (0.4 to 1.2 mM), which presumably reflects the lower pH values of the assays used in the other studies.

The folate substrate specificity of the human enzyme was qualitatively similar to that reported for the purified pig liver enzyme (32) although some differences were noted from that reported for cruder preparations from leukemia cells (54) and human liver (21). This may reflect that the specific activity of the enzyme used in the current study was about 50,000-fold higher than that used in the previous studies (21). The maximal catalytic rate of human FPGS (1 s¹) is about 40% that of the pig liver enzyme (32). The unsubstituted reduced folates, H₂PteGlu and H₄PteGlu, and aminopterin were the preferred substrates for the enzyme while PteGlu bound less effectively. 10-Formyl-H₄PteGlu was also a good substrate although with a reduced V_max, while 5-substitution of reduced folate caused a large elevation in K_m. Previous studies have suggested that (6S)- and (6ambo)-5-formyl-H₄PteGlu are very good substrates (K_m about 5 µM) for human FPGS while the 6R isomer is a poor substrate (K_m about 100 µM) (21, 46). However, the high K_m obtained for (6S)-5-formyl-H₄PteGlu in the current study (105 µM) is consistent with values obtained for other folates substituted at the 5-position, and also with the value obtained with homogeneous pig liver enzyme (32). The lower values obtained by other investigators may have been due to metabolism of (6S)-5-formyl-H₄PteGlu to 10-formyl-H₄PteGlu. This conversion is catalyzed by 5,10-methenyltetrahydrofolate synthetase and 5,10-methylene tetrahydrofolate cyclohydrolase, enzymes that would be present in crude tissue extracts. The FPGS reaction mixture contains all the substrates necessary for this interconversion, and this would also explain the poor substrate activity of (6R)-5-formyl-H₄PteGlu.

Studies with model systems have demonstrated that cellular accumulation of folate, which requires its conversion to polyglutamate derivatives of chain length at least three, is dependent on FPGS activity levels with physiological levels of poor substrates for the enzyme and becomes highly dependent on FPGS activity levels with pharmacological levels of all folates (28, 36). Pharmacological doses of 5-formyl-H₄PteGlu are used in combination with thymidylate synthase inhibitors in some chemotherapeutic regimens to elevate tissue folate levels (58). The poor substrate activity of 5-formyl-H₄PteGlu for human FPGS suggests that the ability of tissues to accumulate 5-formyl-H₄PteGlu will be highly dependent on the level of FPGS activity. In addition, 5-formyl-H₄PteGlu accumulation may also be dependent on the level of 5,10-methenyltetrahydrofolate synthetase activity, which metabolizes this folate to 10-formyl-H₄PteGlu, a more effective substrate for FPGS. This enzyme has a K_m of about 1 µM for 5-formyl-H₄PteGlu (59) and would be operating under V_max conditions when pharmacological levels of 5-formyl-H₄PteGlu are provided.

The specificity for folylpolyglutamate substrates is qualitatively similar to that reported for the pig liver enzyme (32) except that diglutamate derivatives, with the exception of H₄PteGlu₂, compared to their respective pteroylmonoglutamates, tended to be somewhat better substrates. This was most pronounced for 5-formyl-H₄PteGlu₂ which exhibited a 7-fold decrease in K_m compared to the monoglutamate. V_max values fell beyond the diglutamate and H₄PteGlu_n derivatives were the most effective polyglutamate substrates.

The 4-amino substitution of pteroylmonoglutamate increases its substrate effectiveness for mammalian FPGS but greatly impairs substrate activity with di- and longer polyglutamate derivatives (60, 61, 62). Methotrexate is a fairly poor substrate for mammalian FPGS enzymes and activity drops significantly with extension of the glutamate chain. The major drop in activity for the pig liver and CHO enzymes occurs at the diglutamate. However, activity falls off less sharply with the human enzyme and the large fall off in activity occurs at the triglutamate. The improved substrate activity of the diglutamate makes human cells particularly sensitive to methotrexate. Methotrexate accumulation by mammalian cells, which involves metabolism to at least the triglutamate, and its cytotoxic efficacy are very sensitive to the level of FPGS activity (13). CHO cell transfectants expressing human FPGS activity accumulate methotrexate more effectively than wild type CHO cells expressing the same levels of CHO FPGS activity and are more sensitive to the antifolate (13).

AUX-hFPGScyt transfectants, which expressed human FPGS activity solely in the cytoplasm, were unable to accumulate folate in the mitochondria and remained glycine auxotrophs. These data support our earlier findings that mitochondrial folate accumulation is dependent on mitochondrial FPGS activity and that the defect in glycine biosynthesis was due to a lack of mitochondrial folate despite the presence of cytoplasmic folates (23, 29). AUX-hFPGSmit transfectants, which appeared to express FPGS activity solely in the mitochondria, also contained long chain cytosolic folylpolyglutamates and were prototrophic for thymidine and purines, which are synthesized in the cytosol, as well as glycine. These results mirrored our observations with transfectants expressing E. coli FPGS in the mitochondria of AUXB1 cells (AUX-mcoli) (14, 29). Pulse-chase studies with AUX-mcoli and wild type CHO cells indicated a slow release of folylpolyglutamates from the mitochondria to the cytosol of these cells, and this was more pronounced in the AUX-mcoli transfectants, which synthesize shorter polyglutamate species (predominantly triglutamate) than wild type cells. Although the possibility that AUX-hFPGSmit transfectants express trace levels of human FPGS in the cytosol can not be totally eliminated, previous studies suggest that cytosolic metabolism of folate to polyglutamates cannot account for the cytosolic folate pool in AUX-hFPGSmit cells. AUXB1 cells transfected with human genomic DNA and expressing human FPGS at the trace levels that could be present in AUX-hFPGSmit cells (36) contain folylpolyglutamates that are of shorter chain length than was found in this study.

The proportion of cellular folate in the cytosol of AUX-hFPGSmit transfectants was much lower than in AUX-mcoli transfectants, ranging from about 4 to 8% of total cell folate after adjustment for mitochondrial folate contamination (as judged by glutamate dehydrogenase distributions), and was of shorter glutamate length than mitochondrial folate, suggesting that efflux of polyglutamates from the mitochondria shows a preference for the shorter chain length species. About 60% of folate in wild type CHO cells is cytosolic. Although expression of mammalian FPGS in the mitochondria is sufficient to generate a cytosolic folylpolyglutamate pool and to allow cytosolic 1-carbon metabolism, expression of a cytosolic FPGS is required for the generation of a normal folate pool in the cytosol.

The FPGS gene was mapped to chromosome region 9q34.1 and no additional chromosomal signals, suggestive of a second closely related gene, were observed, and the reconstructed FPGS gene restored AUXB1 cells to the wild type phenotype. Reversion frequencies of the AUXB1 mutant are also consistent with a single genetic mutation causing the multiple auxotrophy (25, 26, 63). The organization of the 5 region of the human gene is in general agreement with that described recently by Freemantle et al. (31). The exon 1 variant contains two ATG codons and alternate transcription start sites in this region generate mRNAs encoding mitochondrial and cytosolic FPGS isozymes (31). However, we have identified two additional splice variants (exons 1B and 1C) that arise by alternate splicing in the intron 1 region and an additional variant (exon 1A) that is transcribed by a promoter upstream of the exon 1 promoter region. All variants are spliced to exon 2.

The exon 1C variant is not an extended form of exon 1, and primer extension and RACE analyses suggested multiple transcription start sites in the intron 1 region. This region contains a number of potential promoter sites including Sp1 binding sites. Preliminary studies suggest that exon 1B and 1C variants are unlikely to generate functional FPGS. Exon 1A is preceded by a number of potential promoter sites including a binding site for CTF/NF-1 (CCAAT-binding transcription factors, nuclear factor 1) with the consensus sequence GCCAAT (52) and an E-box, generally represented by the sequence CANNTG. We have not yet identified the transcription start site(s) of exon 1A, and the possibility of further upstream introns cannot be excluded. The deduced sequence of the peptide encoded by exon 1A is characteristic of a mitochondrial leader sequence and exon 1A may encode an additional mitochondrial isoform of FPGS.

In our original cloning of a human FPGS cDNA from an Epstein Barr virus-transformed lymphocyte library, we obtained four clones, all of which encoded the exon 1 variant (30). As the cDNAs were cloned by functional complementation of an E. coli FPGS mutant, this may suggest that the other splice variants may not encode functional protein or may reflect an absence of these variants in the library used. However, it should be noted that we did not obtain any exon 1 forms with a complete mitochondrial leader sequence and, if any of the variants encode additional mitochondrial isoforms, it is probable that they would not be isolated by the complementation cloning procedure used. A single 2.5-kb band was observed in Northern analyses of HepG2 and MCF-7 cell mRNA using the human FPGS cDNA as a probe. However, the other exon 1 variants would be of similar expected size (within 0.1 kb) and would not be distinguished by Northern analyses. We have shown, using exon 1 variant specific probes, that the exon 1C variant is a major species (2.4 kb) in MCF-7 cells.

Decreased FPGS activity has been identified as a mechanism for cellular resistance to antifolates (5, 13, 14, 15, 16, 64). However, the decreased FPGS activity is not always accompanied by decreases in FPGS mRNA levels (65). Although this may reflect modulation of translation rates or the presence of a mutation in the mRNA, this could also be due to down-regulation of a functional mRNA species being masked by the presence of variant mRNAs which do not encode active FPGS. Future studies on the regulation of FPGS activity should quantitate individual mRNA variants before conclusions on the absence of transcriptional control are reached. If some of the different mRNA species encode functional FPGS, this may explain the report of differences in substrate specificity for enzyme from different tissues of the same animal (24). We are currently investigating whether the different splice variants observed in this study are translated and whether they encode functional FPGS.