|
|
|
|||||||
|
|||||||||
(Received for publication, January 3, 1996, and in revised form, March 1, 1996)
From the Department of Pharmacology, Kyoto University Faculty of
Medicine, Yoshida, Sakyo-ku, Kyoto 606, Japan
ABSTRACT Using a mouse embryo cDNA library, we
conducted a two-hybrid screening to identify new partners for the small
GTPase Rho. One clone obtained by this procedure contained a novel
cDNA of 291 base pairs and interacted strongly with RhoA and RhoC,
weakly with RhoB, and not at all with Rac1 and Cdc42Hs. Full-length
cDNAs were then isolated from a mouse brain library. While multiple
splicing variants were common, we identified three cDNAs with an
identical open reading frame encoding a 61-kDa protein that we named
rhotekin (from the Japanese ``teki,'' meaning target). The N-terminal
part of rhotekin, encoded by the initial cDNA and produced in
bacteria as a glutathione S-transferase fusion protein,
exhibited in vitro binding to 35S-labeled
guanosine 5 INTRODUCTION The Ras superfamily of small GTPases encompasses a group of
ubiquitous regulatory proteins related by both structure and function.
The products of such genes are involved in a plethora of intracellular
signaling processes (1). These proteins are generally regarded as being
activated in the GTP-bound form. The intrinsic hydrolytic activity of
these proteins is responsible for the reversion to the resting
GDP-bound form. Proteins of the Rho subfamily play a pivotal role in
the regulation of cytoskeletal organization and the determination of
cell polarity. Strongly linked to the formation of stress fibers and
focal adhesions (2), regulation of cell motility (3), aggregation (4,
5), cell cycle progression (6), and contractile ring formation and
cytokinesis (7, 8), the Rho proteins occupy key positions in many
fundamental cellular processes.
A large number of regulatory proteins for Rho have been characterized,
including nucleotide exchange proteins (9, 10, 11), GTPase-activating
proteins (GAPs)1 (12, 13), and guanine
nucleotide dissociation inhibitors (14, 15). In contrast, there has
been surprisingly little information available on the nature of the
molecules that are directly regulated by Rho. Recently, Rho has been
proposed to regulate phosphatidylinositol-4-phosphate 5-kinase and to
regulate actin polymerization through increases in phosphatidylinositol
4,5-bisphosphate levels (16). However, a direct interaction with a
regulatory element that may give rise to this effect has yet to be
demonstrated.
The two-hybrid system was used successfully to demonstrate in
vivo interactions between Ras and its downstream effectors, Byr-1
(17), Raf-1, and CYR1 (18). More recently, this system has been used to
dissect precisely which features of Ras are involved in interactions
with multiple effectors and how this contributes to oncogenesis (19).
To isolate and examine downstream Rho targets, we conducted a library
screening using the yeast two-hybrid system and complemented our data
with in vitro confirmation of the interaction. By these
procedures, we have identified a Ser/Thr protein kinase (PKN), a
PKN-related protein (rhophilin), and a 180-kDa coiled coil-containing
protein (citron) as potential Rho target molecules (20, 21). We have
also isolated a novel Ser/Thr protein kinase, p160ROCK, as
a potential Rho effector (22) that displays a structural similarity to
citron. The present report describes the isolation of a new
putative target protein that binds to the GTP-bound form of Rho
and inhibits its GTPase activity. The Rho-binding region of this
protein appears to be related to those of PKN and rhophilin.
EXPERIMENTAL PROCEDURES [35S]GTP Two-hybrid system
screening was conducted essentially as described previously (18),
except that strain AMR70 was used in conjunction with L40 in the mating
strategy. The initial screening was conducted with a RhoC mutant with a
deletion at residue 181, lacking the CAAX box and the
polybasic region. Deletion was carried out through PCR amplification
using the original rhoC cDNA (27) as a template. This
PCR, using a 5 A murine brain
oligo(dT)-primed cDNA library in Total RNA was isolated from dissected
murine tissues as described (28), and poly(A)+ RNA was
purified using oligo(dT)-latex beads (Pharmacia Biotech Inc.). Two µg
poly(A)+ RNA was separated by electrophoresis on a 1.2%
formaldehyde-agarose gel, transferred to a nylon membrane, and
immobilized by UV cross-linking. The RNA was then hybridized with a
32P-labeled XhoI-XhoI fragment of the
full-length rhotekin cDNA in 50% formamide, 5 × SSC, 50 mM Tris·HCl, pH 7.5, 5 × Denhardt's solution, 0.1%
SDS, and 200 µg/ml yeast RNA at 42 °C for 16 h. The filter was
washed finally with 0.5 × SSC and 0.1% SDS at 65 °C and analyzed
using a Fuji BAS2000 Bioimage analyzer.
Ligand overlay assays were employed
as an in vitro confirmation of positives. The insert from
pVP16-C21 was transferred to pGEX-3X to give pGEX-C21. pGEX-rhotekin
(amino acids 7-113) was created by introducing the rhotekin coding
sequence between FspI and BamHI sites into
pGEX-3X. The plasmids were expressed as GST fusion proteins in
bacteria, and 5 µg of protein of total bacterial lysate was subjected
to SDS-polyacrylamide gel electrophoresis and electrophoretically
transferred to nitrocellulose membranes (Schleicher & Schuell). The
adherent proteins were renatured on the filter and then incubated with
radiolabeled small GTPase as described (21, 29). Each of the small
GTPases was preloaded either with [35S]GTP GAP protection was carried out
essentially as described previously (29, 30). GST-RhoA (80-100 pmol)
was first loaded with [ RESULTS AND DISCUSSION We conducted a library screening with the yeast two-hybrid system
in order to identify new partners for Rho. The bait vector pBTM116
drives the expression of the LexA transcription factor fused to a bait
protein. The complementary plasmid, pVP16, drives the expression of a
nuclear localization sequence and the VP16 transcription activation
domain (VAD) fused to a random-primed day 10.5 murine embryonic
cDNA library. Positive interactions between the bait and proteins
expressed from the library plasmid led to the assembly of a
transcriptionally active complex driving the expression of yeast
HIS3 and bacterial lacZ genes. An initial
screening bait was constructed by deleting the C-terminal polybasic
region and the CAAX box of human RhoC (LexA-RhoC We identified several clones displaying the same interaction profile.
They appeared to bear the same cDNA in pVP16. Sequencing this
insert revealed a novel 291-base pair cDNA, which we called C21. In
the two-hybrid system, VAD-C21 was strongly positive with RhoC
We then expressed the C21 peptide as a bacterial GST fusion protein and
examined its interaction with various small GTPases in
vitro by the ligand overlay assay (Fig. 1B). A specific
interaction was seen with GTP-RhoA and GTP-RhoB, but not with GDP-RhoA,
GTP-Rac1, or GTP-Cdc42. Our attempts to express RhoC as a GST fusion
protein were unsuccessful. Taken together, these results are in
agreement with the interaction profile observed in the two-hybrid
system and clearly demonstrate a specific interaction with GTP-bound
Rho proteins. However, due to the method of construction of the
library, which included a PCR step, C21 contained one missense PCR
mutation and 24 base pairs of the 5 GST-C21 could be purified from E. coli as a soluble protein,
allowing us to investigate its effect upon the endogenous and
GAP-stimulated GTPase activity of RhoA in vitro. We found
that this peptide inhibited both endogenous and GAP-stimulated GTP
hydrolysis (Fig. 2A), and this inhibition
occurred in a dose-dependent manner (Fig. 2B),
indicating that not only does this protein inhibit the interaction of a
GAP with Rho, but that it can also modify the inherent hydrolytic
activity of the cognate GTPase. Similar interactions between a small
GTPase, its effector, and GAP have been reported on Rac1/Cdc42 and
p65PAK or Rac1 and p120ACK and their GAP, Bcr
(29, 33).
Screening a mouse brain cDNA library using C21 cDNA as a
hybridization probe yielded 15 positives from 1.1 × 106
independent clones. Three 2.7-kilobase cDNAs were found to be
identical and presumed to be full-length (type 1 cDNA) (Fig.
3A). Northern blot analysis of rhotekin
mRNA expression using this cDNA as a probe revealed the
presence of a transcript of ~3 kilobases in brain and kidney tissues
(Fig. 4). Weaker expression was also seen in lung,
testis, skeletal muscle, heart, and thymus. The size of the transcript
appeared to be different in some tissues, and there appeared to be
multiple mRNA species in kidney. Consistent with this finding,
multiple splicing arrangements were detected also in the brain library,
and these inserts appeared also to be full-length (Fig. 3A).
Type 2 cDNA contains two exon changes at nucleotide 376 (sequence
GAG/GC) and at nucleotide 1910 (sequence ATG/GC). The former was
localized in the 5
Each of the putative Rho target molecules we identified by the
two-hybrid system showed some difference in their interaction with Rho
proteins in this assay. While the strength of a signal in the
two-hybrid system is not an absolute indicator of affinity for
interacting molecules, two-hybrid data have been shown to broadly
reflect relative affinities for related molecules (37). Rhotekin
interacted with RhoC and RhoA equally well (this study), whereas
rhophilin interacted exclusively with RhoA (20), and citron acted more
preferentially on RhoC (21). These findings may indicate a degree of
subtlety and complexity of Rho signaling that different Rho proteins
may communicate downstream through different patterns of activation of
various effectors. To date, no specific actions have been assigned for
each member of the Rho protein family. However, differences in
expression and cellular localization have been reported for these Rho
proteins (38, 39, 40). The above finding also raises the possibility that
Rho-effector interaction does not occur through the so-called switch
regions alone because these regions are identical among three members
of the Rho protein family. Indeed, Diekmann et al. (41)
showed that a region other than switch regions of Rho was also
important in elicitation of Rho-mediated stress fiber formation.
In conclusion, we have identified a new putative effector for Rho, with
a region homologous to other Rho effector molecules. This region
specifically binds GTP-Rho and may constitute the first consensus
effector sequence for Rho small GTPases.
FOOTNOTES The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) U54638[GenBank]. Acknowledgments We are indebted to Stan Hollenberg, Rolf
Sternglanz, Stan Fields, and Paul Bartel for the gift of two-hybrid
strains, DNA, and detailed protocols. We thank Alan Hall for
pGEX-rhoGAP and Yoshimi Takai for pGEX-rac1 and
pGEX-CDC42Hs. We are most grateful to Y. Kishimoto for
skilled assistance, K. Okuyama for secretarial work, and to A. Kakizuka
for stimulating discourse. We also thank S. Rutherford and R. M. Leech
for help with photography.
REFERENCES
Volume 271, Number 23,
Issue of June 7, 1996
pp. 13556-13560
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
,
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES
-3-O-(thio)triphosphate-bound Rho, but not to
Rac1 or Cdc42Hs in ligand overlay assays. In addition, this peptide
inhibited both endogenous and GTPase-activating protein-stimulated Rho
GTPase activity. The amino acid sequence of this region shares ~30%
identity with the Rho-binding domains of rhophilin and a
serine/threonine kinase, PKN, two other Rho target proteins that we
recently identified (Watanabe, G., Saito, Y., Madaule, P., Ishizaki,
T., Fujisawa, K., Morii, N., Mukai, H., Ono, Y., Kakizuka, A., and
Narumiya, S. (1996) Science 271, 645-648). Thus, not only
is rhotekin a novel partner for Rho, but it also belongs to a wide
family of proteins that bear a consensus Rho-binding sequence at the N
terminus. To our knowledge, this is the first conserved sequence
for Rho effectors, and we have termed this region Rho effector
motif class 1.
S (1000 Ci/mmol),
[35S]GDP
S (1000 Ci/mmol), and
[-32P]GTP (6000 Ci/mmol) were obtained from DuPont
NEN. Plasmids pGEX-rhoA (23), pGEX-rac1 (24), and
pGEX-CDC42Hs (25) (gifts of Dr. Yoshimi Takai, Osaka
University, Osaka, Japan) and pGEX-KG-rhoGAP (26) (a gift of
Dr. Alan Hall, University College, London) were expressed in
Escherichia coli as GST fusion proteins and were prepared as
described (23). Plasmids pVP16 and pBTM116 for use in the two-hybrid
system were gifts of Drs. Stan Hollenberg, Rolf Sternglanz, Stan
Fields, and Paul Bartel.
-end primer of AGCGGATCCATGGCTGCAATCCGAAAGAAG and a
3-end primer of CCAGAATTCAGACCTGGAGGCCAGCCCGAG, introduced a
BamHI site at the 5-end before codon 1 and a
EcoRl site at the 3-end after codon 181. This cDNA was
then subcloned into the multiple cloning site of a modified pBTM116
plasmid (pBTM116M) (21). This vector was called
pBTM116M-rhoC
C and drove the expression of a
LexA-RhoCC fusion protein. Similar deletions were made also by PCR
for rhoA using a 5-end primer of
AGCGGATCCATGGCTGCCATCCGGAAGAAA and a 3-end primer of
CCAGAATTCAAGCTTGCAGAGCTCTCG and for rhoB with a 5-end
primer of AGCGGATCCATGGCGGCCATCCGCAAGAAG and a 3-end primer of
CCAGAATTCACTTCTGCAGCGCGGCGCGCG with rhoA cDNA (23) and
rhoB cDNA (27) as templates, respectively; the resulting
cDNAs were inserted similarly to pBTM116M. Full-length
rac1 and CDC42Hs cDNAs were excised from the
respective pGEX plasmid DNA with BamHI and inserted into
pBTM116M to produce LexA-Rac1 and LexA-Cdc42, respectively. A murine
day 10.5 embryonic library in pVP16 (18) was screened with a bait
plasmid featuring LexA fused to a RhoC deletion mutant
(pBTM116-rhoCC). These clones were then used directly for
the analysis of LacZ expression. From 1.2 × 107 initial
transformants, we identified 256 LacZ+ histidine
prototrophs, 79 of which were cured of pBTM116-rhoCC.
Interactions with other proteins were evaluated after mating with yeast
strain AMR70 harboring various test baits. Of the 79 cured clones, 22 were LacZ+ with the initial screening bait and
LacZ
with the lamin fusion construct. Of these, 12 clones
appeared to carry pVP16 containing the same cDNA insert. A 291-base
pair insert was excised from the plasmid of clone 21 and designated as
C21.
ZAP II (Stratagene) was used to
isolate a full-length rhotekin cDNA. A total of 1.1 × 106 independent clones were screened on nylon filter
membranes (DuPont NEN PlaqueScreen) by hybridization with a
32P-labeled C21 cDNA. Hybridization of the probe and
subsequent washing of filters were carried out as described (28).
Positives were rescreened once, and plasmid DNA was rescued using XL-1
Blue E. coli and helper phage VCS M13 (Stratagene) according
to the manufacturer's instructions. Nucleotide sequencing was carried
out on both strands by the use of the dideoxy chain termination method.
To examine the interaction of the full-length rhotekin in the
two-hybrid system, the full coding sequence of rhotekin cDNA from
the FspI site to the 3-XhoI site in the multiple
cloning site of pBluescript SK was inserted in the NotI site
of pVP16 to create plasmid pVP16-rhotekin (full length).
S or with
[35S]GDPS (both at 1000 Ci/mmol). The bound
radioactivity was determined by filter assay, and a 5 nM
concentration of the radiolabeled protein was added to the incubation.
After incubation, the filter was washed briefly and rapidly dried.
Interactions were imaged by autoradiography.
-32P]GTP (30 Ci/mmol) in buffer
A (20 mM Hepes/NaOH, pH 7.5, 50 mM NaCl, 1 mM MgCl2, 2 mM EDTA, 1 mg/ml bovine
serum albumin, and 10 mM dithiothreitol). The intrinsic
rate of GTP hydrolysis was examined by incubating 20 pmol of
[32P]GTP-RhoA in 50 µl of buffer B (20 mM
Hepes/NaOH, pH 7.5, 1 mM MgCl2, and 1 mg/ml
bovine serum albumin) at 30 °C. Duplicate aliquots of 5 µl were
removed after 0, 2.5, 5, 10, and 15 min and applied to a BA85 membrane.
The amount of RhoA-bound [32P]GTP remaining unhydrolyzed
after each incubation was determined by the amount of radioactivity
adhering to the filter. The GAP-catalyzed rate of GTP hydrolysis was
examined in the presence of 1 µg of purified GST-rhoGAP. The effect
of GST-C21 on the rate of intrinsic and GAP-stimulated GTP hydrolysis
was determined by preincubating [32P]GTP-RhoA with 5 µg
of GST-C21 on ice for 5 min prior to transfer to a bath at 30 °C.
The dose dependence of the inhibitory effect of GST-C21 on the
intrinsic and GAP-catalyzed GTPase activity of RhoA was determined by
preincubating 0, 1, 2.5, 5, 7.5, or 10 µg of GST-C21 with 8 pmol of
GTP-RhoA in 50 µl of buffer B for 5 min on ice, followed by transfer
to a bath at 30 °C for 5 min, with or without the addition of 0.5 µg of GST-rhoGAP.
C). This
strategy was followed on the premise that this region strongly directs
Ras and related proteins to the plasma membrane (31, 32) and would
interfere with the nuclear localization required for transcriptional
activation of the reporter genes in this assay.
C and
RhoAC and weaker with RhoBC (Fig. 1A).
Truncation of the C-terminal domains of Rho proteins gave rise to a far
stronger interaction than did the full-length forms, possibly either
because of a tendency for the CAAX box to favor localization
to the plasma membrane or through an increased preference of the
full-length baits to interact with endogenous yeast proteins. We
presume that this reduces the amount of bait protein available for the
formation of transcriptionally active complexes. There appeared to be
no interaction with either LexA-Rac1 or LexA-Cdc42.
Fig. 1.
Interaction of rhotekin with members of the
Rho protein family. A, in vivo two-hybrid system.
Shown is the interaction of various LexA fusions with VAD alone
(i), with VAD-C21 (ii), and with VAD-rhotekin
(full-length) (iii). The same interaction profile was seen
with VAD-C21 and VAD-rhotekin (full length). L40 strains harboring the
pVP16 vector, pVP16-C21, or pVP16-rhotekin were mated with strain AMR70
expressing various bait constructs in pBTM116. Diploids were cultured
as patches on selective medium for both plasmids and transferred to
filter papers (Whatman No. 1), and -galactosidase activity was
determined as described (18). B, ligand overlay assays. Five
µg each of lysates of E. coli DH5
without induction
(UB), expressing GST alone (GST), expressing the
GST-C21 fusion peptide (C21), and expressing GST fused to
amino acids 7-113 of full-length rhotekin (Fsp-Bam) were
subjected to the ligand overlay assay. Renatured proteins were probed
with each small GTPase labeled either with [35S]GTPS
(GTP) or with [35S]GDPS (GDP).
Platelet homogenate (PH) was used as a positive control, and
a 160-kDa Rho partner and a Rac/Cdc42 partner, presumed to be
p160ROCK (22) and p65PAK (29), were detected
with [35S]GTPS-RhoA (GTP-rhoA) and
[35S]GTPS-Rac1/Cdc42 (GTP-cdc42 and
GTP-rac1), respectively.
-noncoding region as deduced from
the full-length cDNA for rhotekin (see below). To ensure that these
did not contribute to or interfere with the Rho binding properties of
this peptide, we expressed a fragment of the full-length rhotekin
containing the N-terminal coding sequence (amino acids 7-113). This
peptide was also found to be positive in the overlay assay with
GTP-RhoA (Fig. 1B). Moreover, when the full-length rhotekin
coding region was introduced into pVP16, this, too, displayed an
identical interaction profile in the two-hybrid system as did the
original cDNA clone (Fig. 1A). This indicated that
in vivo Rho binding activity is a property of the
full-length protein as well as the restricted N-terminal fragment.
Fig. 2.
GAP protection studies. A, time
course. Twenty pmol of [-32P]GTP-RhoA was incubated
alone (
), with 1 µg of GAP (
), with 5 µg of GST-C21 (
), or
with both 1 µg of GAP and 5 µg of GST-C21 (
), and GTP hydrolysis
was determined as described under ``Experimental Procedures.''
B, effect of increasing concentrations of GST-C21 on the
intrinsic () and GAP-stimulated () GTPase activity of RhoA. Eight
pmol of [-32P]GTP-RhoA was incubated for 5 min at
0 °C in the presence of varying amounts of GST-C21. At time 0, the
reaction was transferred to 30 °C, and 0.5 µg of GAP was added
(). After 5 min, the remaining [-32P]GTP was
determined by filter binding assay. The results displayed represent
typical results; replicated data varied by ~7%.
-noncoding region, and the latter caused a 185-base
pair insert in the 3-region of type 1 cDNA. The third splicing
variant showed an exon change at nucleotide 662 (sequence GAG/GA) of
type 1 cDNA and had a different 5-end (type 3 cDNA; data not
shown). As only one cDNA clone was obtained for each of types 2 and
3, they were not fully characterized. Type 1 cDNA featured a single
open reading frame starting at the ATG codon at base 591 and encoding a
protein of 551 amino acid residues with a calculated molecular mass of
61 kDa, which we named rhotekin (Fig. 3B). Two proline-rich
motifs were found toward the C terminus of rhotekin (amino acids
421-427 (PAPRKPP) and amino acids 525-533 (PLPPQRSPK)). Such regions
have recently been described as general cognate ligands for numerous
SH3 groups (34). C21 cDNA covers nucleotides 567-858, which
encodes the rhotekin N-terminal peptide (amino acids 1-89). This,
together with the finding obtained with the rhotekin fragment (amino
acids 7-113), could locate the Rho-binding domain between amino acids
7 and 89. This region showed significant homology to the Rho-binding
domains of PKN (35, 36) and rhophilin (Fig. 3C) (20).
Another common feature is that they are localized in the N terminus of
each molecule. However, besides the Rho-binding sites, these proteins
are unrelated. Furthermore, data base searches failed to identify any
other rhotekin-related proteins. This strongly suggests that this
Rho-binding motif is a modular entity that may feature in the
regulation of a range of effectors with a spectrum of unrelated
activities. We have tentatively termed this domain Rho effector motif
class 1 (REM-1). It should be noted that REM-1 has no similarity to the
binding motifs of p65PAK and p120ACK, which are
the Rac/Cdc42 effectors (29, 33), nor is it present in the coiled
coil-bearing Rho effectors such as p160ROCK and citron.
Thus, REM-1 may define a particular class of Rho effectors. PKN and
rhophilin have been proposed to function as Rho effectors because the
kinase activity of PKN is stimulated by Rho binding (20). In addition,
as expected for effector molecules for the small GTPases, the
REM-1-bearing proteins may inhibit the GTPase activity of Rho, as shown
for rhotekin in this study.
Fig. 3.
A, schematic representation of the
isolated rhotekin cDNAs. The open reading frame is shown by a
closed box. Restriction enzyme sites and splicing insertion
found in type 2 cDNA are shown. bp, base pairs.
B, nucleotide and deduced amino acid sequences of rhotekin.
The nucleotide sequence of C21 cDNA and the two C-terminal
proline-rich amino acid sequences are underlined. Splicing
sites are indicated by asterisks. C, alignment of
N-terminal Rho-binding domains of rhotekin, rhophilin, and PKN.
Identical residues are indicated in white type with a
black background. Conservative changes in a
shaded background are grouped as follows: H, K, R; L, I, V;
S, T; D, E, N, Q; Y, W; and A, G.
Fig. 4.
Tissue distribution of the rhotekin
transcript. Poly(A)+ RNA was prepared from murine
tissues, and 2 µg of each sample was loaded. Full-length rhotekin
cDNA was used as template for the probe. Lanes are as follows:
B, brain; H, heart; T, thymus;
Lu, lung; L, liver; SI, small
intestine; LI, large intestine; K, kidney;
S, spleen; Te, testis; and SM,
skeletal muscle.
Supported by a postdoctoral fellowship from the Japan Society for
the Promotion of Science. Present address: Faculté de Pharmacie,
Université Paris-Sud, INSERM CJF 93-01, 5 Rue Jean Baptiste
Clément, 92296 Chatenay Malabry Cedex, France.
§
On leave from CNRS (France) and supported by the Japan Society for
the Promotion of Science.
¶
To whom correspondence should be addressed. Tel.:
81-75-753-4396; Fax: 81-75-753-4693.
1
The abbreviations used are: GAPs,
GTPase-activating proteins; GTPS, guanosine
5-3-O-(thio)triphosphate; GDPS, guanosine
5-(-thio)diphosphate; GST, glutathione S-transferase;
PCR, polymerase chain reaction; VAD, VP16 transcription activation
domain; REM-1, Rho effector motif class 1.
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  D. Kumar and A. B. Lassar The Transcriptional Activity of Sox9 in Chondrocytes Is Regulated by RhoA Signaling and Actin Polymerization Mol. Cell. Biol., August 1, 2009; 29(15): 4262 - 4273. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. S. Rex, L. Y. Chen, A. Sharma, J. Liu, A. H. Babayan, C. M. Gall, and G. Lynch Different Rho GTPase-dependent signaling pathways initiate sequential steps in the consolidation of long-term potentiation J. Cell Biol., July 13, 2009; 186(1): 85 - 97. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Stern, E. Debre, C. Stritt, J. Berger, G. Posern, and B. Knoll A Nuclear Actin Function Regulates Neuronal Motility by Serum Response Factor-Dependent Gene Transcription J. Neurosci., April 8, 2009; 29(14): 4512 - 4518. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Garcia, I. Garcia, F. Marcos, G. R. de Garibay, and Y. Sanchez Fission Yeast Rgf2p Is a Rho1p Guanine Nucleotide Exchange Factor Required for Spore Wall Maturation and for the Maintenance of Cell Integrity in the Absence of Rgf1p Genetics, April 1, 2009; 181(4): 1321 - 1334. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Rajasekharan, K. A. Baker, K. E. Horn, A. A. Jarjour, J. P. Antel, and T. E. Kennedy Netrin 1 and Dcc regulate oligodendrocyte process branching and membrane extension via Fyn and RhoA Development, February 1, 2009; 136(3): 415 - 426. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Garcia, V. Tajadura, and Y. Sanchez The Rho1p Exchange Factor Rgf1p Signals Upstream from the Pmk1 Mitogen-activated Protein Kinase Pathway in Fission Yeast Mol. Biol. Cell, January 1, 2009; 20(2): 721 - 731. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Chaigne-Delalande, G. Guidicelli, L. Couzi, P. Merville, W. Mahfouf, S. Bouchet, M. Molimard, B. Pinson, J.-F. Moreau, and P. Legembre The Immunosuppressor Mycophenolic Acid Kills Activated Lymphocytes by Inducing a Nonclassical Actin-Dependent Necrotic Signal J. Immunol., December 1, 2008; 181(11): 7630 - 7638. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Kondoh, Y. Nakata, T. Yamaoka, M. Itakura, M. Hayashi, K. Yamada, J.-i. Hata, and T. Yamada Altered cellular immunity in transgenic mice with T cell-specific expression of human D4-guanine diphosphate-dissociation inhibitor (D4-GDI) Int. Immunol., October 1, 2008; 20(10): 1299 - 1311. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. T. Costa, F. L. Forti, T. G.F. Matos, A. Dermargos, F. Nakano, J. Salotti, K. M. Rocha, P. F. Asprino, C. K. Yoshihara, M. M. Koga, et al. Fibroblast Growth Factor 2 Restrains Ras-Driven Proliferation of Malignant Cells by Triggering RhoA-Mediated Senescence Cancer Res., August 1, 2008; 68(15): 6215 - 6223. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Yin and F.-S. X. Yu Rho kinases regulate corneal epithelial wound healing Am J Physiol Cell Physiol, August 1, 2008; 295(2): C378 - C387. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. T. Stathopoulos, C. Moschos, H. Loutrari, A. Kollintza, I. Psallidas, S. Karabela, S. Magkouta, Z. Zhou, S. A. Papiris, C. Roussos, et al. Zoledronic Acid Is Effective against Experimental Malignant Pleural Effusion Am. J. Respir. Crit. Care Med., July 1, 2008; 178(1): 50 - 59. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Kinoshita, N. Sasai, K. Misaki, and S. Yonemura Apical Accumulation of Rho in the Neural Plate Is Important for Neural Plate Cell Shape Change and Neural Tube Formation Mol. Biol. Cell, May 1, 2008; 19(5): 2289 - 2299. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Pinar, P. M. Coll, S. A. Rincon, and P. Perez Schizosaccharomyces pombe Pxl1 Is a Paxillin Homologue That Modulates Rho1 Activity and Participates in Cytokinesis Mol. Biol. Cell, April 1, 2008; 19(4): 1727 - 1738. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Yin, J. Lu, and F.-S. X. Yu Role of Small GTPase Rho in Regulating Corneal Epithelial Wound Healing Invest. Ophthalmol. Vis. Sci., March 1, 2008; 49(3): 900 - 909. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. S. Rosman, S. Phukan, C.-C. Huang, and B. Pasche TGFBR1*6A Enhances the Migration and Invasion of MCF-7 Breast Cancer Cells through RhoA Activation Cancer Res., March 1, 2008; 68(5): 1319 - 1328. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. L Forti and H. A Armelin Vasopressin triggers senescence in K-ras transformed cells via RhoA-dependent downregulation of cyclin D1 Endocr. Relat. Cancer, December 1, 2007; 14(4): 1117 - 1125. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Lim, K. J. Choi, Y. Ding, J. H. Kim, B. S. Kim, Y. H. Kim, J. Lee, W. Choe, I. Kang, J. Ha, et al. RhoA/Rho Kinase Blocks Muscle Differentiation via Serine Phosphorylation of Insulin Receptor Substrate-1 and -2 Mol. Endocrinol., September 1, 2007; 21(9): 2282 - 2293. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Zheng and M. Martins-Green Molecular mechanisms of thrombin-induced interleukin-8 (IL-8/CXCL8) expression in THP-1-derived and primary human macrophages J. Leukoc. Biol., September 1, 2007; 82(3): 619 - 629. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. V. Kostenko, O. O. Olabisi, S. Sahay, P. L. Rodriguez, and I. P. Whitehead Ccpg1, a Novel Scaffold Protein That Regulates the Activity of the Rho Guanine Nucleotide Exchange Factor Dbs Mol. Cell. Biol., December 1, 2006; 26(23): 8964 - 8975. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Liu, E. V. Kostenko, G. M. Mahon, O. O. Olabisi, and I. P. Whitehead Transformation by the Rho-specific Guanine Nucleotide Exchange Factor Dbs Requires ROCK I-mediated Phosphorylation of Myosin Light Chain J. Biol. Chem., June 9, 2006; 281(23): 16043 - 16051. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Castellani, E. Salvati, S. Alema, and G. Falcone Fine Regulation of RhoA and Rock Is Required for Skeletal Muscle Differentiation J. Biol. Chem., June 2, 2006; 281(22): 15249 - 15257. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Garcia, V. Tajadura, I. Garcia, and Y. Sanchez Rgf1p Is a Specific Rho1-GEF That Coordinates Cell Polarization with Cell Wall Biogenesis in Fission Yeast Mol. Biol. Cell, April 1, 2006; 17(4): 1620 - 1631. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Salsmann, E. Schaffner-Reckinger, F. Kabile, S. Plancon, and N. Kieffer A New Functional Role of the Fibrinogen RGD Motif as the Molecular Switch That Selectively Triggers Integrin {alpha}IIb{beta}3-dependent RhoA Activation during Cell Spreading J. Biol. Chem., September 30, 2005; 280(39): 33610 - 33619. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. K. Meyer, C. Fischer, U. Becker, I. Gottsching, S. Boutillier, C. Baermann, G. Schmidt, N. Klugbauer, and J. Leemhuis Pituitary Adenylyl Cyclase-activating Polypeptide 38 Reduces Astroglial Proliferation by Inhibiting the GTPase RhoA J. Biol. Chem., July 1, 2005; 280(26): 25258 - 25266. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Lepley, J.-H. Paik, T. Hla, and F. Ferrer The G Protein-Coupled Receptor S1P2 Regulates Rho/Rho Kinase Pathway to Inhibit Tumor Cell Migration Cancer Res., May 1, 2005; 65(9): 3788 - 3795. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Gerhard, H. Tatge, H. Genth, T. Thum, J. Borlak, G. Fritz, and I. Just Clostridium difficile Toxin A Induces Expression of the Stress-induced Early Gene Product RhoB J. Biol. Chem., January 14, 2005; 280(2): 1499 - 1505. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Blumenstein and M. R. Ahmadian Models of the Cooperative Mechanism for Rho Effector Recognition: IMPLICATIONS FOR RhoA-MEDIATED EFFECTOR ACTIVATION J. Biol. Chem., December 17, 2004; 279(51): 53419 - 53426. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. R. Palmby, K. Abe, A. E. Karnoub, and C. J. Der Vav Transformation Requires Activation of Multiple GTPases and Regulation of Gene Expression Mol. Cancer Res., December 1, 2004; 2(12): 702 - 711. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Tajadura, B. Garcia, I. Garcia, P. Garcia, and Y. Sanchez Schizosaccharomyces pombe Rgf3p is a specific Rho1 GEF that regulates cell wall {beta}-glucan biosynthesis through the GTPase Rho1p J. Cell Sci., December 1, 2004; 117(25): 6163 - 6174. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Mori, M. Shibanuma, and K. Nose Invasive Potential Induced under Long-Term Oxidative Stress in Mammary Epithelial Cells Cancer Res., October 15, 2004; 64(20): 7464 - 7472. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Uhlenbrock, A. Eberth, U. Herbrand, N. Daryab, P. Stege, F. Meier, P. Friedl, J. G. Collard, and M. R. Ahmadian The RacGEF Tiam1 inhibits migration and invasion of metastatic melanoma via a novel adhesive mechanism J. Cell Sci., September 15, 2004; 117(20): 4863 - 4871. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Colicelli Human RAS Superfamily Proteins and Related GTPases Sci. Signal., September 14, 2004; 2004(250): re13 - re13. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. L. Berdeaux, B. Diaz, L. Kim, and G. S. Martin Active Rho is localized to podosomes induced by oncogenic Src and is required for their assembly and function J. Cell Biol., August 2, 2004; 166(3): 317 - 323. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Ling and P. E. Lobie RhoA/ROCK Activation by Growth Hormone Abrogates p300/Histone Deacetylase 6 Repression of Stat5-mediated Transcription J. Biol. Chem., July 30, 2004; 279(31): 32737 - 32750. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Wang, M. Liu, T. Kozasa, J. D. Rothstein, P. C. Sternweis, and R. R. Neubig Thrombin and Lysophosphatidic Acid Receptors Utilize Distinct rhoGEFs in Prostate Cancer Cells J. Biol. Chem., July 9, 2004; 279(28): 28831 - 28834. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Pertz and K. M. Hahn Designing biosensors for Rho family proteins -- deciphering the dynamics of Rho family GTPase activation in living cells J. Cell Sci., March 15, 2004; 117(8): 1313 - 1318. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Barac, J. Basile, J. Vazquez-Prado, Y. Gao, Y. Zheng, and J. S. Gutkind Direct Interaction of p21-Activated Kinase 4 with PDZ-RhoGEF, a G Protein-linked Rho Guanine Exchange Factor J. Biol. Chem., February 13, 2004; 279(7): 6182 - 6189. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. D. Gallagher, S. Gutowski, P. C. Sternweis, and M. H. Cobb RhoA Binds to the Amino Terminus of MEKK1 and Regulates Its Kinase Activity J. Biol. Chem., January 16, 2004; 279(3): 1872 - 1877. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. McGrew, R. D. Price, E. Hackler, M. S. S. Chang, and E. Sanders-Bush RNA Editing of the Human Serotonin 5-HT2C Receptor Disrupts Transactivation of the Small G-Protein RhoA Mol. Pharmacol., January 1, 2004; 65(1): 252 - 256. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. Emmert, J. A. Fee, Z. M. Goeckeler, J. M. Grojean, T. Wakatsuki, E. L. Elson, B. P. Herring, P. J. Gallagher, and R. B. Wysolmerski Rho-kinase-mediated Ca2+-independent contraction in rat embryo fibroblasts Am J Physiol Cell Physiol, January 1, 2004; 286(1): C8 - C21. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. K. Surks, C. T. Richards, and M. E. Mendelsohn Myosin Phosphatase-Rho Interacting Protein: A NEW MEMBER OF THE MYOSIN PHOSPHATASE COMPLEX THAT DIRECTLY BINDS RhoA J. Biol. Chem., December 19, 2003; 278(51): 51484 - 51493. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Cascone, E. Giraudo, F. Caccavari, L. Napione, E. Bertotti, J. G. Collard, G. Serini, and F. Bussolino Temporal and Spatial Modulation of Rho GTPases during in Vitro Formation of Capillary Vascular Network: ADHERENS JUNCTIONS AND MYOSIN LIGHT CHAIN AS TARGETS OF Rac1 AND RhoA J. Biol. Chem., December 12, 2003; 278(50): 50702 - 50713. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Tufvesson and G. Westergren-Thorsson Biglycan and decorin induce morphological and cytoskeletal changes involving signalling by the small GTPases RhoA and Rac1 resulting in lung fibroblast migration J. Cell Sci., December 1, 2003; 116(23): 4857 - 4864. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Shimizu, K. Ihara, R. Maesaki, M. Amano, K. Kaibuchi, and T. Hakoshima Parallel Coiled-coil Association of the RhoA-binding Domain in Rho-kinase J. Biol. Chem., November 14, 2003; 278(46): 46046 - 46051. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Genth, R. Gerhard, A. Maeda, M. Amano, K. Kaibuchi, K. Aktories, and I. Just Entrapment of Rho ADP-ribosylated by Clostridium botulinum C3 Exoenzyme in the Rho-Guanine Nucleotide Dissociation Inhibitor-1 Complex J. Biol. Chem., August 1, 2003; 278(31): 28523 - 28527. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. S. Bogatkevich, E. Tourkina, C. S. Abrams, R. A. Harley, R. M. Silver, and A. Ludwicka-Bradley Contractile activity and smooth muscle {alpha}-actin organization in thrombin-induced human lung myofibroblasts Am J Physiol Lung Cell Mol Physiol, August 1, 2003; 285(2): L334 - L343. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. I. Dubreuil, M. J. Winton, and L. McKerracher Rho activation patterns after spinal cord injury and the role of activated Rho in apoptosis in the central nervous system J. Cell Biol., July 21, 2003; 162(2): 233 - 243. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Ogita, S. Kunimoto, Y. Kamioka, H. Sawa, M. Masuda, and N. Mochizuki EphA4-Mediated Rho Activation via Vsm-RhoGEF Expressed Specifically in Vascular Smooth Muscle Cells Circ. Res., July 11, 2003; 93(1): 23 - 31. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Nakazawa, A. M. Watabe, T. Tezuka, Y. Yoshida, K. Yokoyama, H. Umemori, A. Inoue, S. Okabe, T. Manabe, and T. Yamamoto p250GAP, a Novel Brain-enriched GTPase-activating Protein for Rho Family GTPases, Is Involved in the N-Methyl-D-aspartate Receptor Signaling Mol. Biol. Cell, July 1, 2003; 14(7): 2921 - 2934. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Zhai, H. Lin, Z. Nie, J. Wu, R. Canete-Soler, W. W. Schlaepfer, and D. D. Schlaepfer Direct Interaction of Focal Adhesion Kinase with p190RhoGEF J. Biol. Chem., June 27, 2003; 278(27): 24865 - 24873. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Gerhard, H. John, K. Aktories, and I. Just Thiol-Modifying Phenylarsine Oxide Inhibits Guanine Nucleotide Binding of Rho but Not of Rac GTPases Mol. Pharmacol., June 1, 2003; 63(6): 1349 - 1355. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. L. Rossman, L. Cheng, G. M. Mahon, R. J. Rojas, J. T. Snyder, I. P. Whitehead, and J. Sondek Multifunctional Roles for the PH Domain of Dbs in Regulating Rho GTPase Activation J. Biol. Chem., May 9, 2003; 278(20): 18393 - 18400. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. N. Rao, X. Guo, L. Liu, T. Zou, K. S. Murthy, J. X.-J. Yuan, and J.-Y. Wang Polyamines regulate Rho-kinase and myosin phosphorylation during intestinal epithelial restitution Am J Physiol Cell Physiol, April 1, 2003; 284(4): C848 - C859. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. E. Fournier, B. T. Takizawa, and S. M. Strittmatter Rho Kinase Inhibition Enhances Axonal Regeneration in the Injured CNS J. Neurosci., February 15, 2003; 23(4): 1416 - 1423. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. C. Chen, S. Zhuang, T. H. Nguyen, G. R. Boss, and R. B. Pilz Oncogenic Ras Leads to Rho Activation by Activating the Mitogen-activated Protein Kinase Pathway and Decreasing Rho-GTPase-activating Protein Activity J. Biol. Chem., January 24, 2003; 278(5): 2807 - 2818. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. M. Coll, Y. Trillo, A. Ametzazurra, and P. Perez Gef1p, a New Guanine Nucleotide Exchange Factor for Cdc42p, Regulates Polarity in Schizosaccharomyces pombe Mol. Biol. Cell, January 1, 2003; 14(1): 313 - 323. [Abstract] [Full Text]
|
|
|
|
|
|
L. McGrew, M. S. S. Chang, and E. Sanders-Bush Phospholipase D Activation by Endogenous 5-Hydroxytryptamine 2C Receptors Is Mediated by Galpha 13 and Pertussis Toxin-Insensitive Gbeta gamma Subunits Mol. Pharmacol., December 1, 2002; 62(6): 1339 - 1343. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. W. Peck, M. Oberst, K. B. Bouker, E. Bowden, and P. D. Burbelo The RhoA-binding protein, Rhophilin-2, Regulates Actin Cytoskeleton Organization J. Biol. Chem., November 8, 2002; 277(46): 43924 - 43932. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Lin, D. Wang, and W. Sadee Serum Response Factor Activation by Muscarinic Receptors via RhoA. NOVEL PATHWAY SPECIFIC TO M1 SUBTYPE INVOLVING CALMODULIN, CALCINEURIN, AND Pyk2 J. Biol. Chem., October 18, 2002; 277(43): 40789 - 40798. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Cheng, K. L. Rossman, G. M. Mahon, D. K. Worthylake, M. Korus, J. Sondek, and I. P. Whitehead RhoGEF Specificity Mutants Implicate RhoA as a Target for Dbs Transforming Activity Mol. Cell. Biol., October 1, 2002; 22(19): 6895 - 6905. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Wilcox-Adelman, F. Denhez, and P. F. Goetinck Syndecan-4 Modulates Focal Adhesion Kinase Phosphorylation J. Biol. Chem., August 30, 2002; 277(36): 32970 - 32977. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Tsutsumi, S. K. Gupta, V. Hogan, J. G. Collard, and A. Raz Activation of Small GTPase Rho Is Required for Autocrine Motility Factor Signaling Cancer Res., August 1, 2002; 62(15): 4484 - 4490. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Dergham, B. Ellezam, C. Essagian, H. Avedissian, W. D. Lubell, and L. McKerracher Rho Signaling Pathway Targeted to Promote Spinal Cord Repair J. Neurosci., August 1, 2002; 22(15): 6570 - 6577. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Tian, V. Litvak, M. Toledo-Rodriguez, S. Carmon, and S. Lev Nir2, a Novel Regulator of Cell Morphogenesis Mol. Cell. Biol., April 15, 2002; 22(8): 2650 - 2662. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Chikumi, S. Fukuhara, and J. S. Gutkind Regulation of G Protein-linked Guanine Nucleotide Exchange Factors for Rho, PDZ-RhoGEF, and LARG by Tyrosine Phosphorylation. EVIDENCE OF A ROLE FOR FOCAL ADHESION KINASE J. Biol. Chem., March 29, 2002; 277(14): 12463 - 12473. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Eda, S. Yonemura, T. Kato, N. Watanabe, T. Ishizaki, P. Madaule, and S. Narumiya Rho-dependent transfer of Citron-kinase to the cleavage furrow of dividing cells J. Cell Sci., March 11, 2002; 114(18): 3273 - 3284. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Tsuda, S. Tanaka, H. Sawa, H. Hanafusa, and K. Nagashima Signaling Adaptor Protein v-Crk Activates Rho and Regulates Cell Motility in 3Y1 Rat Fibroblast Cell Line Cell Growth Differ., March 1, 2002; 13(3): 131 - 139. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Dan, N. Nath, M. Liberto, and A. Minden PAK5, a New Brain-Specific Kinase, Promotes Neurite Outgrowth in N1E-115 Cells Mol. Cell. Biol., January 15, 2002; 22(2): 567 - 577. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Sorg, U.-M. Goehring, K. Aktories, and G. Schmidt Recombinant Yersinia YopT Leads to Uncoupling of RhoA-Effector Interaction Infect. Immun., December 1, 2001; 69(12): 7535 - 7543. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Thomas, Z. K. Ascott, D. Harmey, L. W. Slice, E. Rozengurt, and A. J. Lax Cytotoxic Necrotizing Factor from Escherichia coli Induces RhoA-Dependent Expression of the Cyclooxygenase-2 Gene Infect. Immun., November 1, 2001; 69(11): 6839 - 6845. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Thomas, G. D. Pullinger, A. J. Lax, and E. Rozengurt Escherichia coli Cytotoxic Necrotizing Factor and Pasteurella multocida Toxin Induce Focal Adhesion Kinase Autophosphorylation and Src Association Infect. Immun., September 1, 2001; 69(9): 5931 - 5935. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Kuncewicz, P. Balakrishnan, M. B. Snuggs, and B. C. Kone Specific association of nitric oxide synthase-2 with Rac isoforms in activated murine macrophages Am J Physiol Renal Physiol, August 1, 2001; 281(2): F326 - F336. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Gong, I. Gorenne, P. Read, T. Jia, R. K. Nakamoto, A. V. Somlyo, and A. P. Somlyo Regulation by GDI of RhoA/Rho-kinase-induced Ca2+ sensitization of smooth muscle myosin II Am J Physiol Cell Physiol, July 1, 2001; 281(1): C257 - C269. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Alblas, L. Ulfman, P. Hordijk, and L. Koenderman Activation of RhoA and ROCK Are Essential for Detachment of Migrating Leukocytes Mol. Biol. Cell, July 1, 2001; 12(7): 2137 - 2145. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Fuchs, G. Rehkamp, O. A. Haas, R. Slany, M. Konig, S. Bojesen, R. M. Bohle, C. Damm-Welk, W.-D. Ludwig, J. Harbott, et al. The human formin-binding protein 17 (FBP17) interacts with sorting nexin, SNX2, and is an MLL-fusion partner in acute myelogeneous leukemia PNAS, June 28, 2001; (2001) 121433898. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X.-R. Ren, Q.-S. Du, Y.-Z. Huang, S.-Z. Ao, L. Mei, and W.-C. Xiong Regulation of CDC42 GTPase by Proline-rich Tyrosine Kinase 2 Interacting with PSGAP, a Novel Pleckstrin Homology and Src Homology 3 Domain Containing rhoGAP Protein J. Cell Biol., March 5, 2001; 152(5): 971 - 984. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Marinissen, M. Chiariello, and J. S. Gutkind Regulation of gene expression by the small GTPase Rho through the ERK6 (p38{gamma}) MAP kinase pathway Genes & Dev., March 1, 2001; 15(5): 535 - 553. [Abstract] [Full Text]
|
|
|
|
 |
|
 Y. Takai, T. Sasaki, and T. Matozaki Small GTP-Binding Proteins Physiol Rev, January 1, 2001; 81(1): 153 - 208. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. A. Bhowmick, M. Ghiassi, A. Bakin, M. Aakre, C. A. Lundquist, M. E. Engel, C. L. Arteaga, and H. L. Moses Transforming Growth Factor-{beta}1 Mediates Epithelial to Mesenchymal Transdifferentiation through a RhoA-dependent Mechanism Mol. Biol. Cell, January 1, 2001; 12(1): 27 - 36. [Abstract] [Full Text]
|
|
|
|
|
|
L. Wang, H. Zhang, P. A. Solski, M. J. Hart, C. J. Der, and L. Su Modulation of HIV-1 Replication by a Novel RhoA Effector Activity J. Immunol., May 15, 2000; 164(10): 5369 - 5374. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Wahl, H. Barth, T. Ciossek, K. Aktories, and B. K. Mueller Ephrin-A5 Induces Collapse of Growth Cones by Activating Rho and Rho Kinase J. Cell Biol., April 17, 2000; 149(2): 263 - 270. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. G. Buchanan, C. M. Elliot, M. Gibbs, and J. H. Exton Translocation of the Rac1 Guanine Nucleotide Exchange Factor Tiam1 Induced by Platelet-derived Growth Factor and Lysophosphatidic Acid J. Biol. Chem., March 24, 2000; 275(13): 9742 - 9748. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Sumi, K. Matsumoto, Y. Takai, and T. Nakamura Cofilin Phosphorylation and Actin Cytoskeletal Dynamics Regulated by Rho- and Cdc42-activated LIM-kinase 2 J. Cell Biol., December 27, 1999; 147(7): 1519 - 1532. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Gimond, A. van der Flier, S. van Delft, C. Brakebusch, I. Kuikman, J. G. Collard, R. Fassler, and A. Sonnenberg Induction of Cell Scattering by Expression of {beta}1 Integrins in {beta}1-deficient Epithelial Cells Requires Activation of Members of the Rho Family of GTPases and Downregulation of Cadherin and Catenin Function J. Cell Biol., December 13, 1999; 147(6): 1325 - 1340. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Inada, H. Togashi, Y. Nakamura, K. Kaibuchi, K.-i. Nagata, and M. Inagaki Balance between Activities of Rho Kinase and Type 1 Protein Phosphatase Modulates Turnover of Phosphorylation and Dynamics of Desmin/Vimentin Filaments J. Biol. Chem., December 3, 1999; 274(49): 34932 - 34939. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. E. Sander, J. P. ten Klooster, S. van Delft, R. A. van der Kammen, and J. G. Collard Rac Downregulates Rho Activity: Reciprocal Balance between Both GTPases Determines Cellular Morphology and Migratory Behavior J. Cell Biol., November 29, 1999; 147(5): 1009 - 1022. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Kawano, Y. Fukata, N. Oshiro, M. Amano, T. Nakamura, M. Ito, F. Matsumura, M. Inagaki, and K. Kaibuchi Phosphorylation of Myosin-binding Subunit (MBS) of Myosin Phosphatase by Rho-Kinase In Vivo J. Cell Biol., November 29, 1999; 147(5): 1023 - 1038. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Reid, A. Bathoorn, M. R. Ahmadian, and J. G. Collard Identification and Characterization of hPEM-2, a Guanine Nucleotide Exchange Factor Specific for Cdc42 J. Biol. Chem., November 19, 1999; 274(47): 33587 - 33593. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. M. Seasholtz, M. Majumdar, D. D. Kaplan, and J. H. Brown Rho and Rho Kinase Mediate Thrombin-Stimulated Vascular Smooth Muscle Cell DNA Synthesis and Migration Circ. Res., May 28, 1999; 84(10): 1186 - 1193. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Fukata, N. Oshiro, N. Kinoshita, Y. Kawano, Y. Matsuoka, V. Bennett, Y. Matsuura, and K. Kaibuchi Phosphorylation of Adducin by Rho-Kinase Plays a Crucial Role in Cell Motility J. Cell Biol., April 19, 1999; 145(2): 347 - 361. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Yamazaki, Y. Zhang, H. Watanabe, T. Yokozeki, S. Ohno, K. Kaibuchi, H. Shibata, H. Mukai, Y. Ono, M. A. Frohman, et al. Interaction of the Small G Protein RhoA with the C Terminus of Human Phospholipase D1 J. Biol. Chem., March 5, 1999; 274(10): 6035 - 6038. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Feng, M. Ito, Y. Kureishi, K. Ichikawa, M. Amano, N. Isaka, K. Okawa, A. Iwamatsu, K. Kaibuchi, D. J. Hartshorne, et al. Rho-associated Kinase of Chicken Gizzard Smooth Muscle J. Biol. Chem., February 5, 1999; 274(6): 3744 - 3752. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Di Cunto, E. Calautti, J. Hsiao, L. Ong, G. Topley, E. Turco, and G. P. Dotto Citron Rho-interacting Kinase, a Novel Tissue-specific Ser/Thr Kinase Encompassing the Rho-Rac-binding Protein Citron J. Biol. Chem., November 6, 1998; 273(45): 29706 - 29711. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Essler, M. Amano, H.-J. Kruse, K. Kaibuchi, P. C. Weber, and M. Aepfelbacher Thrombin Inactivates Myosin Light Chain Phosphatase via Rho and Its Target Rho Kinase in Human Endothelial Cells J. Biol. Chem., August 21, 1998; 273(34): 21867 - 21874. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Fujisawa, P. Madaule, T. Ishizaki, G. Watanabe, H. Bito, Y. Saito, A. Hall, and S. Narumiya Different Regions of Rho Determine Rho-selective Binding of Different Classes of Rho Target Molecules J. Biol. Chem., July 24, 1998; 273(30): 18943 - 18949. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. E. Aplin, A. Howe, S. K. Alahari, and R. L. Juliano Signal Transduction and Signal Modulation by Cell Adhesion Receptors: The Role of Integrins, Cadherins, Immunoglobulin-Cell Adhesion Molecules, and Selectins Pharmacol. Rev., June 1, 1998; 50(2): 197 - 264. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Goto, H. Kosako, K. Tanabe, M. Yanagida, M. Sakurai, M. Amano, K. Kaibuchi, and M. Inagaki Phosphorylation of Vimentin by Rho-associated Kinase at a Unique Amino-terminal Site That Is Specifically Phosphorylated during Cytokinesis J. Biol. Chem., May 8, 1998; 273(19): 11728 - 11736. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |