|
Volume 271, Number 24,
Issue of June 14, 1996
pp. 14020-14027
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
Cooperation between Core Binding Factor and Adjacent Promoter
Elements Contributes to the Tissue-specific Expression of
Interleukin-3*
(Received for publication, August 10, 1995, and in revised form, December 20, 1995)
Douglas S.
Taylor
,
Jacob P.
Laubach
,
David G.
Nathan
and
Bernard
Mathey-Prevot
§
From the Divisions of Pediatric Hematology and Oncology, Dana
Farber Cancer Institute and Children's Hospital and the Department of
Pediatrics, Harvard Medical School, Boston, Massachusetts 02115
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES
ABSTRACT
Tissue-specific expression of interleukin-3
(IL-3) is mediated via cis-acting elements located within 315 base
pairs of the transcription start. This is achieved in part through the
positive activities of the AP-1 and Elf-1 sites in the IL-3 promoter.
The contribution to T cell-specific expression by other promoter sites
was assessed in a transient expression assay with IL-3 promoter
constructs linked to a luciferase gene, focusing initially on the core
binding factor (CBF) site, which is footprinted in vivo
upon T cell activation. Activity of the CBF site is shown to be
critically dependent on the adjacent activator site Act-1. Together the
Act-1 and CBF sites form a functional unit (AC unit) with dual
activity. The AC unit is demonstrated to enhance basal activity of
promoters both in fibroblasts and T cells. This activity is further
inducible in activated T cells, but not in fibroblasts. In addition to
the already identified NIP repressor site, evidence is presented for a
second repressor region that restricts promoter activity in
fibroblasts. Finally, a novel positive regulatory element has been
mapped in the IL-3 promoter between nucleotide 180 and 210 that
leads to increased expression in T cells. Together these results
demonstrate that T cell expression of IL-3 is not specified by the
activity of a single tissue-specific element, but instead involves
multiple interacting elements that provide both specific positive
regulation in T cells and specific negative regulation in
fibroblasts.
INTRODUCTION
Interleukin-3 (IL-3)1 is involved in
the proliferation and differentiation of hematopoietic progenitor cells
(1). Consistent with its potent biologic activity, IL-3 gene expression
is highly regulated and is restricted to human T and NK cells (2).
Therefore, the IL-3 promoter has been extensively studied, and multiple
regulatory elements have been identified within 315 bp of the
transcription start site (3, 4, 5, 6). These elements include several
activator sites: AP-1, Elf-1, and Act-1 (NFIL3); a repressor site, NIP;
and a ``permissive'' site that binds core binding factor (CBF).
The activity of individual regulatory elements has been extensively
studied in the context of multiple promoters/enhancers (7, 8, 9, 10, 11).
However, the emphasis on identifying novel regulatory elements has
prevented a complete understanding of the functional interactions
between elements already identified. These interactions are important
as they represent another possible level of regulatory activity and may
in part specify the differential expression of genes despite impressive
similarities of their promoters. For example, the promoter for both
granulocyte-macrophage-colony-stimulating factor (GM-CSF) and IL-3 bind
many similar proteins but exhibit different patterns of expression,
with GM-CSF being produced by fibroblasts, macrophages, and endothelial
cells (4, 5, 8, 10). Therefore, the activity of a particular site may
vary according to the context within which it is found, as adjoining
regulatory sites may modulate its activity (4, 12).
The IL-3 promoter is well suited to address possible functional
interactions between different regulatory elements, since a relatively
small region of DNA contains several well characterized sites that are
important outside the context of IL-3 regulation. We initially focused
on the normal function of CBF, since mutations of this protein complex
are associated with specific subtypes of acute myelogenous leukemia
(AML) and myelodyspastic syndrome (MDS) (13, 14, 15, 16, 17). In the present study
we demonstrate that the CBF site and adjacent Act-1 element form a
regulatory unit that provides inducible promoter activity in Jurkat T
cells, but not in NIH3T3 fibroblasts. We also demonstrate that two
additional upstream portions of the IL-3 promoter inhibit promoter
activity in NIH3T3 cells. Finally, an initial characterization of a
previously unknown positive regulatory region of the IL-3 promoter
between nt 180 and nt 207 is provided.
MATERIALS AND METHODS
Cell Culture
The human Jurkat T cell line E6.1 and NIH3T3
cells were obtained from ATCC and maintained in 5% CO2 at
37 °C. Jurkat T cells were cultured in RPMI medium supplemented with
penicillin (50 units/ml), streptomycin (50 µg/ml), and 10% fetal
calf serum (RPMI complete). NIH3T3 cells were cultured in DMEM
supplemented with penicillin, streptomycin, 1 mM sodium
pyruvate, and 10% fetal calf serum (DMEM complete). Jurkat cells were
stimulated with a combination of TPA (10 ng/ml) and ionomycin (0.5 µM). NIH3T3 cells were stimulated with TPA alone.
IL-3 Promoter Constructs
Isolation of the 315-bp IL-3
promoter and insertion into an IL-3 reporter gene has already been
described (18). Similarly, G-C mutation of the CBF site of the IL-3
promoter has been described (18). Briefly, guanine 139, 137, and
136 within the CBF binding site were selectively mutated to cytosine
using standard polymerase chain reaction methodology. This mutation
abrogates CBF protein binding. Flanking HindIII sites were
added to transfer the full-length 315-bp promoter, or G-C mutant
( 315/GC), to the luciferase reporter gene previously described by
DeWet et al. ( 315pL, 315/GCpL) (19). An independent,
higher yield luciferase reporter gene (pFlash*) was derived from the
pFlash vector (SynapsSys Corp., Burlington, MA) by excision of the
downstream polylinker between ApaI and SmaI,
followed by replacement of the SstI-XbaI
(luciferase nt 57) pFlash upstream polylinker with the equivalent
fragment from the luciferase reporter gene, pXp1 (pFlash*). The IL-3
promoter was then inserted at the new upstream HindIII site
( 315pF*/ 315/GCpF*). All reporter genes used in a particular
experiment were derived from the same root plasmid. Specific constructs
are depicted schematically within individual figures and were derived
as follows.
A second CBF site (CBF*) was created at nt 192 using standard
polymerase chain reaction methodology to introduce a C-G and T-G
mutation at nt 191 and nt 189, respectively. Replacement of the DNA
fragment between nt 180 and nt 207 with an AC unit was done via two
intermediate cloning steps. The resultant promoter had an inserted
oligonucleotide, 5 -atggATGAATAATTACGTCTGTGGTTTtcta-, that contained an
AC unit (upper case letters) in place of the 27-bp MseI (nt
207) Sau3a (nt 180) fragment in the 315pL expression
vector ( 315NACpL). The equivalent replacement was made in an IL-3
promoter containing a G-C mutation at the endogenous CBF site
( 315NAC/GCpL).
AC units were also inserted at nt 180 of the 315 promoter in
315pL to create promoters without deletion of endogenous nucleotides.
AC cassettes contained mutations in none, one, or both members of the
AC unit. The individual cassettes were synthetic oligonucleotides
obtained from the Dana Farber Cancer Institute core facility (Table
IA).
Addition of AC units containing either wild type or mutant Act-1 and
CBF sites to a minimal ( 61 bp) IL-3 promoter was accomplished via
replacement of the IL-3 promoter upstream of nt 61 with one of the
synthetic oligonucleotides summarized in Table IB. This was
accomplished using the 315pF* vector digested at the 5
SstI site of the 315pF* polylinker and the 3
SmaI site at nt 61 of the IL-3 promoter ( 61pF*). This
construct contained 61 bp of the IL-3 promoter upstream of the
transcription start site, including the TATA box at nt 30. The
various Act-1-CBF oligonucleotides were inserted in place of the 254 deleted nucleotides between nt 61 and nt 315.
Intermediate length IL-3 promoters were derived from 315pF* via
deletion of upstream regions of the promoter from nt 173
(ScaI), nt 180 (Sau3a) or nt 210
(MseI). All constructs were confirmed by restriction
analysis. Any construct made using polymerase chain reaction techniques
or utilizing synthetic oligonucleotides was also confirmed by DNA
sequencing. Plasmid DNA was twice purified over cesium chloride prior
to transfection.
Transient Transfection
Jurkat T cells were transfected with
1 µg of DNA/106 cells using either the DEAE-dextran
method as described (Stratagene, La Jolla, CA) or by electroporation in
serum free conditions using a 300-V, 980-µF, and 14-ms discharge (PG
200 Progenitor 2, Hoeffer Scientific Instruments, San Francisco, CA).
Cells were cultured in RPMI medium supplemented as above for 16 h after
transfection and were then stimulated with a combination of TPA and
ionomycin. Cell lysates were harvested 6-9 h after stimulation and
assayed for luciferase activity (Analytical Luminescence Laboratory,
San Diego, CA).
NIH3T3 cells were grown in DMEM supplemented as above and transfected
at 20% confluence with 15 µg of DNA/10 cm2 tissue
culture plate (Becton Dickinson, Lincoln Park, NJ) using a standard
calcium phosphate method. Sixteen to 24 h after adding CaP, plates were
washed three times with calcium/magnesium-free phosphate-buffered
saline. Cells were grown overnight in fresh DMEM complete prior to
stimulation with TPA. Stimulation of NIH3T3 cells with a combination of
TPA and ionomycin decreased expression of all reporter constructs as
compared with unstimulated or TPA-stimulated cells. Cell extracts were
obtained 6-9 h after stimulation and assayed for luciferase activity
(Analytical Luminescence Laboratory).
Normalizing data of a test reporter gene according to the relative
activity of a second, -galactosidase, gene is a standard
methodology. However, we2 and others have
found that the measured -galactosidase activity (or that of another
co-transfected construct) is dependent on several factors other than
efficiency of transfection (20, 21). Therefore, it is an unreliable
method for normalization. It has also been our experience that
spectrophotometry has not quantitated plasmid DNA as precisely as
expected and that the efficiency of transfection is critically
dependent on the purity of the transfected plasmid. Therefore, we
perform replicate experiments using independently isolated and purified
plasmids. All luciferase constructs in a particular experiment are:
(a) derived from the same root plasmid, (b)
differ only by a small number of nucleotides, (c) are twice
purified over cesium chloride, and (d) quantitated by both
spectrophotometry and on agarose gel. This is consistent with the
methods proposed by others (21). Using this procedure, replicate
transfections using independent isolates of the same luciferase
construct have yielded differences in luciferase activity of <10%.
This is more consistent, and accurate, than normalizing data to the
independently variable activity of a co-transfected second construct.
Luciferase activity was measured as relative light units (RLU)
(Monolight Luminometer model 2010). All data are presented as the mean
relative luciferase activity as calculated by the formula (RLUtest
construct/RLUreference construct). Error Bars
indicate 1 standard deviation of the mean relative luciferase
activity.
Eectrophoretic Mobility Shift Assay
Nuclear extracts were
prepared from either Jurkat T cells or NIH3T3 cells using the Andrews
procedure and were used in gel shift assays as described (22). Labeling
of the oligonucleotide probe was accomplished either by filling the 5
ends using DNA polymerase large fragment (Klenow) in the presence of
dATP, dGTP, dTTP, and [ -32P]dCTP (>3,000 Ci/mmol;
DuPont NEN) or by phosphorylation of the oligonucleotide probe at the
free 5 -hydroxyl group using polynucleotide kinase and
[ -32P]ATP (>3,000 Ci/mmol; DuPont NEN). Labeled
probes were purified by gel electrophoresis. A 50-100 molar excess of
competitor oligonucleotides were added to the binding reaction 15-20
min prior to the probe. The AP-1-specific oligonucleotide was kindly
provided by N. C. Andrews. Antiserum specific for NFATp and Oct-1 was
kindly provided by A. Rao and G. R. Crabtree, respectively.
RESULTS
The CBF Site within the Human IL-3 Promoter Is
Position-sensitive
We previously demonstrated that CBF is
necessary for IL-3 promoter activity (3). To further characterize the
functional role of CBF, a new site (CBF*) was introduced 51 bp upstream
of the endogenous location and tested for its capacity to rescue the
activity of an IL-3 promoter mutated at the resident CBF site. These
experiments were carried out in the human Jurkat T cell line JKE6.1. As
indicated in Fig. 1A, there is little
promoter activity in unstimulated Jurkat cells ( 315pL). Upon
stimulation with TPA and ionomycin, there is up-regulation of promoter
activity, which is significantly reduced by a G-C mutation of the
endogenous CBF binding site ( 315/GCpL). Introduction of a
second CBF site ( 315*CBFpL) neither increased the base-line
promoter activity nor completely rescued activity of the CBF/GC mutant
promoter ( 315*CBF/GCpL). To ensure that the created *CBF site bound
the CBF complex, gel shift assays were performed. Both the CBF and the
*CBF sites bind a protein complex with a similar mobility and
cross-compete with one another for binding to that complex (Fig.
1B). Equivalent results were obtained using nuclear extract
from both stimulated and unstimulated Jurkat cells (data not shown).
Since the *CBF site is capable of binding the CBF protein complex, but
does not alter promoter activity, the location of the CBF site in the
IL-3 promoter appears critical for its biologic activity.
Fig. 1.
*CBF only partially overcomes CBF (G-C)
mutation. A, Jurkat T-cells were transfected with the
individual promoter constructs depicted schematically in the
lower portion of the panel. Single base mutations were
introduced to create the *CBF site and are indicated in boldface
type. Sixteen hours after transfection cells were mock-stimulated
or stimulated with a combination of TPA and ionomycin. Six hours after
stimulation luciferase activity was measured in cell lysates.
Luciferase activity was measured as RLU. The data from three
independent experiments are presented as the mean relative luciferase
activity as calculated by the formula (RLUtest
construct/RLUreference construct). Error
bars indicate 1 standard deviation of the mean relative luciferase
activity. The stimulated wild type IL-3 promoter ( 315pL) is the
reference construct in this experiment and has a relative luciferase
activity of 1.0. B, nuclear extracts were prepared from
Jurkat T cells. The nuclear extracts were incubated with the indicated
competitor oligonucleotide and an oligonucleotide probe corresponding
to either the endogenous CBF site or the newly introduced CBF site
(*CBF). The CBF binding site is indicated by a
bracket.
The Act-1 and CBF Sites Form a Functional Unit
The endogenous
CBF site within the IL-3 promoter is interesting as it is juxtaposed to
another important regulatory element, Act-1. Such juxtaposition of CBF
and another regulatory site is a recurring motif in other
promoter/enhancer elements (Table II), and suggests a
functional interdependence between the CBF and Act-1 sites in the
context of the IL-3 promoter.
To evaluate the functional interdependence of the Act-1 and CBF sites,
a second Act-1/CBF (AC) unit, or a mutant thereof, was introduced
upstream of the wild type site at nt 180. Introduction of either the
wild type, or one of several mutants of the AC unit, did not involve
the deletion of endogenous nucleotides and resulted in extension of the
IL-3 promoter by 34-42 bp. In contrast to our previous experiments
with promoters containing the *CBF site ( 315*CBFpL), the AC unit
significantly up-regulates promoter activity (Fig. 2) in
Jurkat T cells upon stimulation with TPA and ionomycin. Insertion of
this unit also resulted in a tendency to increase the basal
(constitutive/unstimulated) activity of the IL-3 promoter.
In addition, the inserted AC unit overcomes the inhibition of promoter
activity caused by a G-C mutation of the endogenous CBF site. Mutation
of either the Act-1 or CBF component of the AC unit resulted in a sharp
decrease in promoter activity. Thus, in Jurkat T cells the Act-1 and
CBF sites function only as a unit (not individually) to provide
inducible promoter activity.
Fig. 2.
Act-1 and CBF form a functional unit and
overcomes a CBF (G-C) mutation. Jurkat T cells were transfected
with the individual promoter constructs depicted schematically on the
left portion of the figure. 16 h after transfection cells
were mock-stimulated or stimulated with a combination of TPA and
ionomycin. 6 h after stimulation luciferase activity was measured in
cell lysates. Data from three independent experiments are presented as
outlined in Fig. 1. The stimulated wild type IL-3 promoter (top
construct) is the reference construct in this experiment and has a
relative luciferase activity of 1.0.
The AC Unit Is Functional in a Minimal Promoter
Having
established the functional interdependence of the Act-1 and CBF sites,
we next evaluated its function outside the context of an intact,
full-length proximal IL-3 promoter. To this end, a normal AC unit or an
AC unit containing a mutant CBF site was inserted 31 bp upstream of the
TATA box in the 61-bp minimal IL-3 promoter. As seen in Fig.
3A, the minimal promoter has significant
activity in unstimulated Jurkat cells compared with the full-length
315-bp proximal IL-3 promoter. This activity is further augmented by
stimulation with TPA and ionomycin, and addition of a complete AC unit
increases both basal and stimulated activity of the minimal promoter.
The enhancement in activity was abrogated upon introduction of a G-C
mutation to the CBF site. Thus, the AC unit is functional both in the
absence of upstream elements within the IL-3 promoter and within 31 bp
of the TATA box.
Fig. 3.
The Act-1/CBF unit enhances transcription
activity of a minimal promoter in both Jurkat T cells and NIH3T3
fibroblasts. A, Jurkat T cells were transfected with the
indicated promoter constructs and stimulated as described in the legend
to Fig. 1. An AC unit containing either a wild type or mutant CBF
binding site was appended to the 5 portion of the minimal ( 61 bp)
IL-3 promoter as outlined under ``Materials and Methods'' and
compared with the minimal IL-3 promoter. Data from five independent
experiments are presented as outlined in Fig. 1. The stimulated minimal
( 61 bp) promoter (second construct) is the reference construct in
this experiment and has a relative luciferase activity of 1.0. In one
of five experiments the full-length ( 315 bp) proximal IL-3 promoter
(bottom construct) was included for the purpose of
comparison. B, murine NIH3T3 fibroblast cells were
transfected with the indicated promoter constructs using the calcium
phosphate method. Cells were grown for 24 h after transfection, then
stimulated for 7 h with TPA only as stimulation of NIH3T3 cells with a
combination of TPA and ionomycin substantially decrease activity of all
promoter constructs. Cell lysates were isolated and assessed for
luciferase activity. Data from four independent experiments are
presented as outlined in Fig. 1. The stimulated minimal ( 61 bp)
promoter (second construct) is the reference construct in this
experiment and has a relative luciferase activity of 1.0. The 173 bp
IL-3 promoter construct was present in one of four experiments.
An AC Unit Is Functional in Heterologous Cells
The activity
of the full-length, 315-bp proximal IL-3 promoter is highly tissue
restricted. It is functional only in human T and NK cells (2). Such
observed tissue-specific activity may result from specific positive
regulation in a permissive cell type, specific inhibition in
nonpermissive cells, or a combination thereof. Previous work in this
laboratory identified a T cell-specific complex that, upon activation,
binds the 5 portion of the Act-1 region, suggesting that the AC unit
may contribute to the observed selective activity of the IL-3 promoter
(18). Therefore, the activity of the minimal IL-3 promoter with, and
without, a functional AC unit was compared with the full-length
315-bp IL-3 promoter in heterologous, murine NIH3T3 cells (Fig.
3B). In contrast to the full-length IL-3 promoter, the
minimal IL-3 promoter has significant activity in unstimulated NIH3T3
cells. The activity of the minimal promoter in these fibroblasts is
enhanced approximately 2-fold by the addition of a single AC unit. The
AC unit increases basal (unstimulated) promoter activity
when upstream of the minimal ( 61 bp) IL-3 promoter in both Jurkat
T-cells and NIH3T3 fibroblasts (Fig. 3, A and B).
However, the AC unit increases the stimulation index
(stimulated/unstimulated) in the context of Jurkat T cells
but not NIH3T3 fibroblasts. By virtue of its inducible positive
activity in T cells, the AC unit contributes to the tissue-specific
regulation of IL-3 gene expression.
Both the Act-1 and CBF segments of the AC unit bind protein complexes
common to nuclear extracts from both Jurkat and NIH3T3 cells (Fig.
4). The CBF segment of the AC unit binds a major complex
in NIH3T3 cells that migrates and competes identically to the
previously identified CBF protein complex present in nuclear extracts
from Jurkat T cells (Fig. 4A). The more diffuse appearance
of this complex in NIH3T3 cells may result from more than one closely
migrating complex and suggests the presence of more than a single
isoform of CBF in these cells (23, 24). The Act-1 region of the AC unit
binds to a slowly migrating complex present in both cell types (Fig.
4B). This band was previously identified in this laboratory
as Oct-1 or an Oct-1-like protein. It is possible that the faster
migrating complex that is specifically competed by Act-1 in the Jurkat
nuclear extract represents the recently identified E4BP4 protein,
NFIL3A (25).
Fig. 4.
The Act-1 and CBF sites of the IL-3 promoter
bind similar protein complexes in nuclear extracts from both Jurkat T
cells and NIH3T3 fibroblasts. Nuclear extracts were prepared from
either unstimulated Jurkat T cells or unstimulated NIH3T3 cells. The
nuclear extracts were incubated with the indicated competitor
oligonucleotide and an oligonucleotide probe corresponding to either
the endogenous CBF (A) or endogenous Act-1 (B)
site. A, the arrow indicates the CBF protein
complex, and the bracket indicates the CBF binding site.
B, the arrow indicates the Oct-1 protein complex.
The boxed nucleotides of the Act-1 probe correspond to the
previously defined Act-1 region of the IL-3 promoter.
Brackets indicate the Oct-1 and E4BP4/NFIL3A binding
sites.
A Positive Regulatory Element (CK3) Is Present between nt 180 and
nt 207 of the IL-3 Promoter
Insertion of the AC unit into the
full-length proximal IL-3 promoter resulted both in elongation of the
promoter and a tendency to increase basal (unstimulated) promoter as
noted in Fig. 2. As the NIP repressor element maps to the upstream
region of the IL-3 promoter, it was possible that the inserted
nucleotides diminished its effect by increasing the distance between
NIP and other important downstream elements. To investigate this
possibility, the promoter fragment between nt 180 and nt 207 was
deleted and replaced with an AC unit. This region was chosen as it
contained no previously identified promoter elements. As shown in Fig.
5, constancy of the distance between NIP and other
downstream elements of the IL-3 promoter restores a low basal activity
of the IL-3 promoter in the presence of an additional AC unit.
Furthermore, mutation of the endogenous CBF is fully rescued in the
context of the upstream AC unit (data not shown). However, deletion of
the region between nt 180 and nt 207 causes a decrease in overall
promoter activity, suggesting that a previously unidentified positive
regulatory element is perturbed in this promoter construct.
Fig. 5.
Replacement of IL-3 promoter between nt 180
and nt 207 decreases promoter activity. Jurkat T cells were
transfected with the indicated promoter constructs and stimulated as
described in Fig. 1. The NAC constructs contain a second AC unit and
flanking nucleotides that replaces the endogenous IL-3 promoter between
nt 207 and nt 180. Data from two independent experiments are
presented as outlined in Fig. 1. The stimulated wild type 315-bp IL-3
promoter (second construct) is the reference construct in this
experiment and has a relative luciferase activity of 1.0.
To further analyze this region, the activity of a 180-bp IL-3
promoter was compared with the 207 and 315 IL-3 promoter constructs
in both Jurkat and NIH3T3 cells (Fig. 6). In all
experiments performed, regardless of cell type, inclusion of the 27 bp
between nt 180 and nt 207 induced a significant increase in
promoter activity.
Fig. 6.
Positive regulatory activity maps between nt
180 and nt 207. Jurkat T cells (A) and NIH3T3 cells
(B) were transfected with the indicated promoter constructs
and stimulated as described in Fig. 3. Data from four independent
experiments are presented as outlined in Fig. 1. The stimulated
207-bp IL-3 promoter is the reference construct in this experiment
and has a relative luciferase activity of 1.0.
Two Specific Complexes Are Bound by the CK3 Element
The
coding strand of DNA between nt 180 and nt 207 bears no homology to
known regulatory elements. However, the noncoding strand contains
sequences that are similar, but not identical, to known binding sites
for nuclear factor of activated T cells (NFAT), AP-1, and the 3
portion of Act-1 (Table III). To investigate protein
binding to the IL-3 promoter in this region (CK3), gel shift assays
were performed using as a probe both a restriction fragment of the IL-3
promoter containing these nucleotides
(MseI-Sau3a) and a synthetic oligonucleotide
containing the nucleotides of interest (Fig.
7A). Both probes bind a faster migrating
complex (CK3a) and a slower migrating doublet (CK3b).
Fig. 7.
The IL-3 promoter between nt 180 and nt
207 contains two protein binding regions. Nuclear extracts were
prepared from Jurkat T cells that were stimulated for 6 h with a
combination of TPA and ionomycin. A, the extracts were
incubated with the competitor oligonucleotide indicated above each lane
and one of three probes indicated below the lane. AP1,
tggggaacctgtgcTGAGTCActggag; MseI-Sau3a,
TTAAGTAATCTTTTTTCTTGTTTCACT; or CK3, agctTGAAACAAGAAAAAAGATTACTTAg.
B, nuclear extracts were incubated with the competitor
oligonucleotide indicated above each lane and with the CK3 probe.
Sequences of competitor oligonucleotide are as follows: IL3NFAT,
agctTGAAACAAGAAAAAAG; IL2NFAT, agcttGAAAGGAGGAAAAAg; ACT-CBF,
gatcctaatggATGAATAATTACGTCTGTGGTTTctagagct; Act,
catggATGAATAATTACGTCTGca; Act-5 , agcttgcATGAATTAgagccc; CBF,
gatcACGTCTGTGGTTTTCTATG. Uppercase letters are used to
designate nucleotides corresponding to portions of the IL-3 promoter.
Relevant binding sites within oligonucleotides derived from exogenous
promoters are also noted in uppercase letters.
The faster migrating protein complex (CK3a) is specifically competed by
unlabeled ``self'' oligonucleotide and nucleotides containing the
complete Act-1 site, but is not competed by an oligonucleotide
containing only the 5 portion of the Act-1 site (Fig. 7A).
Oct-1 is known to bind to the 3 portion of the Act-1 site, but
antiserum specific for Oct-1 does not supershift CK3a (data not shown)
(18). Also, despite similarity to an AP-1 site, the CK3a complex
migrates much more rapidly than the AP-1 complex (Fig. 7A)
and the same AP-1-specific oligonucleotide does not compete for CK3a
binding (Fig. 7B). Protein binding associated with the
slower migrating doublet (CK3b) is specifically inhibited by unlabeled
oligonucleotide containing either the 5 portion of the NFAT region of
the IL-2 promoter (IL2NFAT) or the NFAT-like sequence of the IL-3
promoter (IL3NFAT) (Fig. 7B). However, antiserum specific
for NFATp does not supershift the CK3b complex (data not shown). Thus,
the CK3 region of the IL-3 promoter identifies proteins that bind DNA
with specificities that are similar to, but distinct from, Oct-1 and
NFAT.
DISCUSSION
IL-3 is a lymphokine important for normal hematopoiesis (1). Its
expression is highly tissue-specific, being expressed primarily in T
and NK cells (2). Therefore, its promoter has been extensively studied
(3, 4, 5, 6). Most recently, in vivo footprinting of the IL-3
promoter identified a CBF binding site as one of the few regions
specifically protected upon stimulation of T cells (3). The initial
characterization of this site indicated that CBF binding to the IL-3
promoter is necessary, but not sufficient, for IL-3 promoter activity
(3).
The recent identification of mutant CBF proteins created by the
t(8;21), t(3;21), and inv(16) chromosomal rearrangements and the
association of these rearrangements with specific subtypes of AML or
MDS has encouraged intense study of the mutant CBF fusion proteins
(14, 15, 16, 26). However, the understanding of normal CBF function remains
incomplete. The presence of a functional CBF site within the IL-3
proximal promoter provided an ideal context in which to more closely
evaluate the activity of this important regulatory complex.
The present data demonstrate that the CBF complex cannot function
alone. This is supported by the observation that a second CBF binding
site (*CBF) that binds the CBF complex in a gel shift assay provides
neither positive promoter activity nor overcomes a mutation of the
endogenous CBF site (Fig. 1). In contrast, a CBF site in conjunction
with the adjacent Act-1 region of the IL-3 promoter both augments
promoter activity and overcomes a null mutation of the endogenous CBF
site. Both effects are abrogated by mutation of either the Act-1 or CBF
component of the unit (Fig. 2). The AC unit functions similarly in the
context of a minimal ( 61 bp) IL-3 promoter (Fig. 3). Thus, the
AC unit is an autologous functional unit that retains its activity
outside the context of a full-length IL-3 promoter and requires both
the Act-1 and CBF sites to be intact.
The AC unit functions in both human T cells (Jurkat) and murine
fibroblasts (NIH3T3), and nuclear extracts from both cell types contain
proteins that bind similarly to both the Act-1 and CBF sites of the AC
unit (Fig. 4). In the context of T cells, the AC unit augments both
basal (constitutive/unstimulated) and inducible (stimulated) promoter
activity. However, the augmentation of inducible promoter activity in T
cells is greater than the augmentation of basal activity as indicated
by an increase in the stimulation index of an IL-3 promoter containing
a second AC unit (Figs. 2 and 3). This effect is not observed in NIH3T3
cells (Fig. 3). Thus, the AC unit contributes to the tissue-specific
expression of IL-3 by its selective positive contribution to inducible
promoter activity in the context of T cells.
The mechanism underlying the interdependence of the Act-1 and CBF sites
is unknown. As shown for other DNA binding factors, it may involve
alteration in DNA configuration via bending (27). Alternatively, CBF
may function as a chaperon protein and augment/inhibit binding of other
proteins to the promoter. For example, several isoforms of CBF have
been identified and found to have variable activity in vitro
(24, 28). Thus, the capacity of CBF to modulate the association between
other proteins, such as the Act-1-binding proteins, and DNA may be
dependent on the relative amount of the various CBF isoforms under
various conditions. Previous in vivo footprinting of the
IL-3 promoter is consistent with this hypothesis. These data
demonstrate protection of the CBF site only upon stimulation, despite
similar amounts of CBF binding activity in nuclear extracts obtained
from either stimulated or unstimulated Jurkat cells (3). This
hypothesis is further supported by recent data that demonstrate a
similar functional interdependence between PEBP2 , the murine
homologue of CBF, and Ets-1, which binds an adjacent regulatory element
in the T cell receptor chain enhancer (29).
Although the AC unit contributes to the specific up-regulation of the
IL-3 promoter activity in T cells, as evidenced by its effect on a
minimal promoter, the full-length ( 315 bp) IL-3 promoter is not
active in fibroblasts. Therefore, additional elements between nt 61
and nt 315 of the IL-3 promoter contribute to tissue-specific
promoter activity by limiting activity in non-T cells. As suggested by
our results in Fig. 3B, there are at least two elements that
inhibit IL-3 promoter activity in NIH3T3 cells. One element resides
between nt 173 and nt 315 (Fig. 3B). The presence of
this upstream region of the IL-3 promoter is also associated with a low
basal activity of the promoter in Jurkat T cells (Fig. 3A).
The NIP site of the IL-3 promoter is located at nt 266, is a negative
regulator of transcription, and has been extensively studied in this
laboratory (5, 30). The relative proximity of the upstream NIP region
of the IL-3 promoter to the AP-1 (nucleotide 303) and Elf-1
(nucleotide 288) elements is intriguing. The latter two regions are
known positive regulators of promoter activity, and Elf-1 has been
implicated in the specific positive regulation of the IL-3 promoter in
T cells (4). Thus, the AP-1·Elf-1·NIP complex may represent a
second example within the IL-3 promoter of a functional interdependence
between adjacent regulatory regions. A second element is present
between nt 61 and nt 173. This element functionally negates the
positive contribution of the endogenous AC unit, which is evidenced by
a decrease in activity of the 173-bp promoter as compared with the
61-bp promoter containing an AC unit. A highly conserved CK1/CK2 DNA
sequence is present in this region and may be important in this
activity, since a concatamer of this sequence has been shown to inhibit
the basal transcription of a heterologous promoter and proteins from
the transcriptionally active Rel/NF B family bind to the CK1 element
(31). The combined effect of these two negative elements is abrogation
of IL-3 promoter activity in the context of NIH3T3 cells.
The second observation resulting from the study of the AC unit, and
immediately relevant to IL-3 promoter function, is the identification
of a previously unknown positive regulatory region between nt 180 and
nt 207 (Fig. 6). This region of the IL-3 promoter is 67-100%
conserved between human, new world monkey, sheep, rat, and mice (32).
Furthermore, the majority of differences within these 27 bp represent
conservative changes. Preliminary characterization of 180/ 207
region by gel shift analysis demonstrates that at least two protein
complexes bind independently to this region. Although there are
sequence similarities between the noncoding strand of this region and
the Act-1/Oct-1, AP-1, and NFATp sites, preliminary experiments suggest
that these factors are not involved in binding to these 27 nucleotides.
In addition to Oct-1, the E4BP4 protein, NFIL3, binds to the 3 portion
of the Act-1 site (6, 33). Although the 3 portion of the Act-1 site is
important for competition of CK3a binding, the sequence of the CK3a
site contains only 5 (5 -ATTAC-) of 10 nucleotides that define the
E4BP4 consensus site (25). Antiserum specific for the NFIL3 protein is
not available, so the relationship between E4BP4/NFIL3 and the observed
binding at the CK3a region is unknown at this time. Regardless, a more
complete mutational analysis of this region will be necessary to
confirm that the protein complexes identified by this gel shift
analysis are associated with the positive regulatory activity. These
studies are in progress.
In conclusion, we demonstrate that the Act-1 and CBF sites of the IL-3
promoter form a functional unit. We further demonstrate that the
tissue-specific activity of the proximal IL-3 promoter results from the
combined activity of this unit and other regulatory elements within the
promoter rather than from a single, tissue-specific protein. The
contribution of the Act-1/CBF unit to this activity is important as it
mediates inducible promoter activity in the context of T cells (but not
fibroblasts). It remains important to determine how, or whether, mutant
forms of the CBF protein, relevant to AML and MDS, alter this
tissue-specific activity. However, the recognized association of the
M4Eo subtype of AML with both a mutation in the -chain of CBF and
eosinophilia indirectly suggests that IL-3, a positive regulator of
eosinophil differentiation, is abnormally up-regulated in these
cells.
FOOTNOTES
*
This work was supported by National Institutes of Health
Grant RO1 DK41758 (to B. Mathey-Prevot). The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
``advertisement'' in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Graduate trainee in cancer research and supported by National
Institutes of Health Grant T32CAO9172-20. To whom correspondence should
be addressed: Dana Farber Cancer Institute, 44 Binney St., Boston, MA
02115. Tel.: 617-632-2074; Fax: 617-632-2085; E-mail:
douglas_taylor{at}macmailgw.dfci.harvard.edu.
§
Partially supported by funds from the Genetics Institute.
1
The abbreviations used are: IL-3, interleukin-3;
bp, base pair(s); CBF, core binding factor; GM-CSF,
granulocyte-macrophage-colony-stimulating factor; AML, acute
myelogenous leukemia; MDS, myelodyspastic syndrome; nt, nucleotide;
DMEM, Dulbecco's modified Eagle's medium; TPA,
12-O-tetradecanoylphorbol-13-acetate; AC unit, Act-1 and CBF
sites form a functional unit; RLU, relative light unit(s); NIP, nuclear
inhibitor protein; NFAT, nuclear factor of activated T cells.
2
D. S. Taylor, unpublished data.
Acknowledgments
We thank A. Rao and G. R. Crabtree for
generously providing antiserum and Svetlana Levin for technical
assistance.
REFERENCES
-
Metcalf, D.
(1992)
Trends Biochem. Sci.
17,
286-289
[CrossRef][Medline]
[Order article via Infotrieve]
-
Niemeyer, C. M.,
Sieff, C. A.,
Mathey-Prevot, B.,
Bierer, B. E.,
Clark, S. C.,
Nathan, D. G.
(1987)
Blood
73,
945-951
[Abstract/Free Full Text]
-
Cameron, S.,
Taylor, D. S.,
TePas, E. C.,
Speck, N. A.,
Mathey-Prevot, B.
(1994)
Blood
83,
2851-2859
[Abstract/Free Full Text]
-
Gottschalk, L. R.,
Giannola, D. M.,
Emerson, S. G.
(1993)
J. Exp. Med.
178,
1681-1692
[Abstract/Free Full Text]
-
Mathey-Prevot, B.,
Andrews, N. C.,
Murphy, H. S.,
Kreissman, S. G.,
Nathan, D. G.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
5046-5050
[Abstract/Free Full Text]
-
Shoemaker, S. G.,
Hromas, R.,
Kaushansky, K.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
9650-9654
[Abstract/Free Full Text]
-
Ullman, K. S.,
Flanagan, W. M.,
Edwards, C. A.,
Crabtree, G. R.
(1991)
Science
254,
558-562
[Abstract/Free Full Text]
-
Masuda, E. S.,
Tokumitsu, H.,
Tsuboi, A.,
Shlomai, J.,
Hung, P.,
Arai, K.,
Arai, N.
(1993)
Mol. Cell. Biol.
13,
7399-7407
[Abstract/Free Full Text]
-
Northrop, J. P.,
Ho, S. N.,
Chen, L.,
Thomas, D. J.,
Timmerman, L. A.,
Nolan, G. P.,
Admaon, A.,
Crabtree, G. R.
(1994)
Nature
369,
497-502
[CrossRef][Medline]
[Order article via Infotrieve]
-
Cockerill, P. N.,
Shannon, M. F.,
Bert, A. G.,
Ryan, G. R.,
Vadas, M. A.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
2466-2470
[Abstract/Free Full Text]
-
Redondo, J. M.,
Pfohl, J. L.,
Hernandez-Munain, C.,
Wang, S.,
Speck, N.
A.,
Krangel, M. S.
(1992)
Mol. Cell. Biol.
12,
4817-4823
[Abstract/Free Full Text]
-
Wang, C.-Y.,
Bassuk, A. G.,
Boise, L. H.,
Thompson, C. B.,
Bravo, R.,
Leiden, J. M.
(1994)
Mol. Cell. Biol.
14,
1153-1159
[Abstract/Free Full Text]
-
Kozu, T.,
Miyoshi, H.,
Shimizu, K.,
Maseki, N.,
Kaneko, Y.,
Asou, H.,
Kamada, N.
(1993)
Blood
82,
1270-1276
[Abstract/Free Full Text]
-
Miyoshi, H.,
Shimizu, K.,
Kozu, T.,
Maseki, N.,
Kaneko, Y.,
Ohki, M.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
10431-10434
[Abstract/Free Full Text]
-
Nucifora, G.,
Begy, C. R.,
Erickson, P.,
Drabkin, H. A.,
Rowley, J.
D.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
7784-7788
[Abstract/Free Full Text]
-
Nucifora, G.,
Rowley, J. D.
(1995)
Blood
86,
1-14
[Free Full Text]
-
Liu, P.,
Tarlé, S. A.,
Hajra, A.,
Claxton, D. F.,
Marlton, P.,
Freedman, M.,
Siciliano, M. J.,
Collins, F. S.
(1993)
Science
261,
1041-1044
[Abstract/Free Full Text]
-
Davies, K.,
TePas, E. C.,
Nathan, D. G.,
Mathey-Prevot, B.
(1993)
Blood
81,
928-934
[Abstract/Free Full Text]
-
deWet, J. R.,
Wood, K. V.,
DeLuca, M.,
Helinski, D. R.,
Subramani, S.
(1987)
Mol. Cell. Biol.
7,
725-737
[Abstract/Free Full Text]
-
Murphey, J. M.,
Chrysogelos, S. A.
(1995)
BioTechniques
18,
967-969
[Medline]
[Order article via Infotrieve]
-
Farr, A.,
Roman, A.
(1992)
Nucleic Acids Res.
20,
920
[Free Full Text]
-
Andrews, N. C.,
Faller, D. V.
(1991)
Nucleic Acids Res.
19,
2499
[Free Full Text]
-
Meyers, S.,
Lenny, N.,
Hiebert, S. W.
(1995)
Mol. Cell. Biol.
15,
1974-1982
[Abstract]
-
Takahashi, A.,
Satake, M.,
Yamaguchi-Iwai, Y.,
Bae, S.-C.,
Lu, J.,
Maruyama, M.,
Zhang, Y. W.,
Oka, N.,
Aria, K.-,
Ito, Y.
(1995)
Blood
86,
607-616
[Abstract/Free Full Text]
-
Zhang, W.,
Zhang, J.,
Kornuc, M.,
Kwan, K.,
Frank, R.,
Nimer, S. D.
(1995)
Mol. Cell. Biol.
15,
6055-6063
[Abstract]
-
Liu, B. P.,
Claxton, D. F.,
Marlton, P.,
Hajra, A.,
Siciliano, J.,
Freedman, M.,
Chandrasekharappa, S. C.,
Yanagisawa, K.,
Stallings, R.
L.,
Collins, F. S.,
Siciliano, M. J.
(1993)
Blood
82,
716-721
[Abstract/Free Full Text]
-
Parvin, J. D.,
McCormick, R. J.,
Sharp, P. A.,
Fisher, D. E.
(1995)
Nature
373,
724-727
[CrossRef][Medline]
[Order article via Infotrieve]
-
Levanon, D.,
Negreanu, V.,
Bernstein, Y.,
Bar-Am, I.,
Avivi, L.,
Groner, Y.
(1994)
Genomics
23,
425-432
[CrossRef][Medline]
[Order article via Infotrieve]
-
Giese, K.,
King, C.,
Kirshner, J. R.,
Grosschedl, R.
(1995)
Genes Dev.
9,
995-1008
[Abstract/Free Full Text]
-
Engeland, K.,
Andrews, N. C.,
Mathey-Prevot, B.
(1995)
J. Biol. Chem.
270,
24572-24579
[Abstract/Free Full Text]
-
Lai, J.-H.,
Horvath, G.,
Subleski, J.,
Bruder, J.,
Ghosh, P.,
Tan, T.-H.
(1995)
Mol. Cell. Biol.
15,
4260-4271
[Abstract]
-
Burger, H.,
Wagemaker, G.,
Leunissen, J. A. M.,
Dorssers, L. C. J.
(1994)
J. Mol. Evol.
39,
255-267
[CrossRef][Medline]
[Order article via Infotrieve]
-
Cowell, I. G.,
Skinner, A.,
Hurst, H. C.
(1992)
Mol. Cell. Biol.
12,
3070-3077
[Abstract/Free Full Text]
-
Speck, N. A.,
Renjifo, B.,
Hopkins, N.
(1990)
J. Virol.
64,
543-550
[Abstract/Free Full Text]
-
Speck, N. A.,
Renjifo, B.,
Golemis, E.,
Fredrickson, T. N.,
Hartley, J.
W.,
Hopkins, N.
(1990)
Genes Dev.
4,
233-242
[Abstract/Free Full Text]
-
Prosser, H. M.,
Wotton, D.,
Gegonne, A.,
Ghysdael, J.,
Wang, S.,
Speck, N. A.,
Owen, O. J.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
9934-9938
[Abstract/Free Full Text]
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
C. A. P. Bristow and P. Shore
Transcriptional regulation of the human MIP-1{alpha} promoter by RUNX1 and MOZ
Nucleic Acids Res.,
June 1, 2003;
31(11):
2735 - 2744.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Hawwari, J. Burrows, M. A. Vadas, and P. N. Cockerill
The Human IL-3 Locus Is Regulated Cooperatively by Two NFAT-Dependent Enhancers That Have Distinct Tissue-Specific Activities
J. Immunol.,
August 15, 2002;
169(4):
1876 - 1886.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. G. Bert, J. Burrows, A. Hawwari, M. A. Vadas, and P. N. Cockerill
Reconstitution of T Cell-Specific Transcription Directed by Composite NFAT/Oct Elements
J. Immunol.,
November 15, 2000;
165(10):
5646 - 5655.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Stoecklin, X.-F. Ming, R. Looser, and C. Moroni
Somatic mRNA Turnover Mutants Implicate Tristetraprolin in the Interleukin-3 mRNA Degradation Pathway
Mol. Cell. Biol.,
June 1, 2000;
20(11):
3753 - 3763.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
L. S. Coles, P. Diamond, F. Occhiodoro, M. A. Vadas, and M. F. Shannon
An Ordered Array of Cold Shock Domain Repressor Elements across Tumor Necrosis Factor-responsive Elements of the Granulocyte-Macrophage Colony-stimulating Factor Promoter
J. Biol. Chem.,
May 5, 2000;
275(19):
14482 - 14493.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. N. Cockerill, A. G. Bert, D. Roberts, and M. A. Vadas
The human granulocyte-macrophage colony- stimulating factor gene is autonomously regulated in vivo by an inducible tissue-specific enhancer
PNAS,
December 21, 1999;
96(26):
15097 - 15102.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Selvamurugan, W.-Y. Chou, A. T. Pearman, M. R. Pulumati, and N. C. Partridge
Parathyroid Hormone Regulates the Rat Collagenase-3 Promoter in Osteoblastic Cells through the Cooperative Interaction of the Activator Protein-1 Site and the runt Domain Binding Sequence
J. Biol. Chem.,
April 24, 1998;
273(17):
10647 - 10657.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. K. Babichuk and R. C. Bleackley
Mutational Analysis of the Murine Granzyme B Gene Promoter in Primary T Cells and a T Cell Clone
J. Biol. Chem.,
July 25, 1997;
272(30):
18564 - 18571.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. G. Tenen, R. Hromas, J. D. Licht, and D.-E. Zhang
Transcription Factors, Normal Myeloid Development, and Leukemia
Blood,
July 15, 1997;
90(2):
489 - 519.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. A. Callus and B. Mathey-Prevot
Hydrophobic Residues Phe751 and Leu753 Are Essential for STAT5 Transcriptional Activity
J. Biol. Chem.,
May 26, 2000;
275(22):
16954 - 16962.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1996 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|