Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Miyazaki, T.
Right arrow Articles by Seo, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Miyazaki, T.
Right arrow Articles by Seo, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 271, Number 24, Issue of June 14, 1996 pp. 14567-14571
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

Molecular Cloning of a Novel Thyroid Hormone-responsive Gene, ZAKI-4, in Human Skin Fibroblasts*

(Received for publication, August 22, 1995, and in revised form, March 19, 1996)

Takashi Miyazaki Dagger §, Yasuhiko Kanou , Yoshiharu Murata Dagger , Sachiko Ohmori Dagger , Toshimitsu Niwa §, Kenji Maeda §, Hideki Yamamura and Hisao Seo Dagger par

From the Dagger  Department of Endocrinology and Metabolism and the  Department of Teratology and Genetics, Division of Molecular and Cellular Adaptation, Research Institute of Environmental Medicine, Nagoya University, Nagoya 464-01, Japan and the § Department of Internal Medicine, Nagoya University Branch Hospital, Nagoya 461, Japan

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES


ABSTRACT

Utilizing a method called ``differential display of mRNAs by means of polymerase chain reaction'', the cDNA fragment of a thyroid hormone-responsive gene ZAKI-4 was cloned from cultured human skin fibroblasts. Northern blot analysis revealed that there were two ZAKI-4 mRNA species (3.4 and 1.4 kilobases (kb)), and they were up-regulated by a physiological concentration of triiodothyronine (T3). This T3 effect was abolished by the treatment with cycloheximide, indicating the possibility that gene ZAKI-4 is regulated by T3 in an indirect fashion, through an intermediate product of T3, rather directly by T3 itself. No effect of T3 on ZAKI-4 mRNA stability suggested that T3 induces the mRNA at the transcriptional level. Rapid amplification of cDNA ends confirmed the presence of two mRNA species. ZAKI-4 mRNA was detected in heart, brain, liver, and skeletal muscle but not in placenta, lung, kidney and pancreas. In skin fibroblasts and skeletal muscle, 3.4-kb mRNA was the major species, whereas 1.4-kb mRNA was dominant in heart, brain, and liver. The sequence analysis suggested that the two mRNA species arise from alternative polyadenylation and code a single protein of 192 amino acids. No homologous protein sequence was found in a data base. Elucidation of the function of ZAKI-4 gene product will provide new insights into an important role of T3 in various organs.


INTRODUCTION

Thyroid hormones (thyroxine and triiodothyronine (T3))1 play a vital role in fetal development and throughout life in humans. T3, an active form of the thyroid hormones, exerts its effect through binding to its nuclear receptor and regulating expression of target genes. Thus, identification of T3-responsive genes in various tissues is important to elucidate T3 action at molecular and cellular levels in humans. However, the search for T3-responsive genes in human tissues is hampered by the difficulty of obtaining tissues from subjects in various thyroid states. Clonal cell lines established from malignant tissues could be used to identify T3-responsive genes. However, they might aberrantly respond to hormones (1, 2). Identification of T3-responsive gene(s) from the tissues that maintain differentiated function is thus preferable. Human skin fibroblasts fulfill this requirement since they express T3-receptors (3, 4, 5, 6) and are responsive to T3. In cultured skin fibroblasts, we have shown that T3 inhibits the synthesis of glycosaminoglycan (7, 8) and fibronectin (9), and Chait et al. (10) demonstrated that it enhances low density lipoprotein degradation. These effects of T3 were used for the tissue diagnosis of generalized resistance to thyroid hormone (11).

Despite the fact that cultured human skin fibroblasts are responsive to T3, few T3-responsive genes have been cloned. Recently, Liang and Pardee (12, 13) developed a method called ``differential display of mRNA by means of the polymerase chain reaction (PCR)'' to identify and analyze altered gene expression at the mRNA level in any eukaryotic cells. A similar method was developed by Welsh et al. (14, 15). We have chosen the method to clone T3-responsive genes in cultured skin fibroblasts, since it has been successfully employed to identify transcripts specific for human tumors (13).

We identified a T3-responsive gene expressed in cultured human skin fibroblasts. The expression of the gene termed ZAKI-4 is positively regulated by a physiological concentration of T3. Complete cDNA sequence obtained by rapid amplification of cDNA ends (16) revealed that the gene is transcribed into two mRNA species, both of which code a single peptide of 192 amino acids.


MATERIALS AND METHODS

Cell Culture and Treatment

Skin fibroblasts were obtained by punch biopsies from the deltoid region of four healthy subjects (two men and two women, ranging in age from 9 to 37 years old (males 9 and 29 years, females 25 and 37 years)). The fibroblasts were used between the fourth and the ninth passages after the initial plating and were grown to confluence in 60-mm-diameter plastic culture dishes (Becton Dickinson Labware, Lincoln Park, NJ) with 4 ml of Dulbecco's modified Eagle's medium (DMEM, Nissui Pharmaceutical Co., Ltd., Tokyo, Japan) containing 10% fetal bovine serum (Bioserum, Victoria, Australia) and 50 units/ml penicillin G (Life Technologies, Inc., Grand Island, NY) and 50 mg/ml streptomycin (Life Technologies, Inc.) at 37 °C in an atmosphere of air, 5% CO2 and 100% relative humidity. To study the effect of T3 on ZAKI-4 mRNA, the cells were exposed to 4 ml of the same medium in which fetal bovine serum was replaced with 10% bovine serum from a thyroidectomized calf (TxBS; Rockland Farms, Gilbertsville, PA) (7). After three days of culture, the medium was replaced with DMEM containing either 10% TxBS alone or TxBS plus T3 (10-10-10-8 M; Sigma). The cells were further incubated for the indicated periods of time. Total RNA was extracted from cells by the method of Chomczynski and Sacchi (17).

To examine whether the T3-mediated increase in ZAKI-4 mRNA requires de novo protein synthesis, the medium of confluent fibroblast cultures was replaced with DMEM supplemented with 10% TxBS and 25 µM cycloheximide (Wako Pure Chemical Industries, Osaka, Japan) was added 15 min before T3 (10-7 M) addition. The cells were further incubated for 24 h, and total RNA was extracted. The effect of T3 on the stability of ZAKI-4 mRNA was evaluated as follows. Fibroblast cultures in confluency were treated with 10-7 M T3 for 72 h. Then the cells were washed two times with 4 ml of serumless DMEM. They were incubated in DMEM supplemented with 10% TxBS containing actinomycin D (SERVA, Heidelberg, Germany) at a final concentration of 5 µg/ml with or without 10-7 M T3. After further incubation for 12, 24, and 48 h, the cells were harvested for RNA extraction.

Differential Display of mRNA by PCR

Total RNA was extracted from the two fibroblast cell lines, a) male 29 year and b) female 25 year, incubated with or without T3 for 24 h. Differential display was carried out using RNAmap Kit (GenHunter Corp., Brookline, MA). Briefly, 0.2 µg of the total RNA was reverse transcribed with T12MA (5'-TTTTTTTTTTTTMA-3', where M represents degenerate bases) and subsequently amplified by PCR using five different arbitrary primers AP-16 (5'-CGTCAGTGAC-3'), AP-17 (5'-GCAAGGAGTC-3'), AP-18 (5'-CTGAGCTAGG-3'), AP-19 (5'-GGCTAATGCC-3'), and AP-20 (5'-GTGATCGGAC-3') according to the supplier's protocol with minor modification. In the PCR [33P]dATP (specific activity 70 TBq/mmol; DuPont NEN) was used instead of [35S]dATP as recommended by Trentmann et al. (18).

After an initial 2-min denaturation at 94 °C, PCR was carried out using AmpliTaq DNA polymerase (Perkin-Elmer) for 40 cycles with denaturation at 94 °C for 30 s, annealing at 40 °C for 2 min, and extension at 72 °C for 30 s. An aliquot of each PCR product (5 µl) was analyzed on a 5% DNA sequence gel, which was subsequently exposed to X-AR film (Eastman Kodak Co.) for autoradiography. The cDNA fragments of interest were recovered from the gel and subsequently reamplified with the same primer set and PCR conditions except that no isotopes were added. The reamplified cDNA fragments were cloned into pGEM-T vector from Promega (Madison, WI).

Northern Blot Analysis

Total RNA samples isolated from the four fibroblast cell lines cultured in the presence or absence of T3 were subjected to Northern blot analysis as described previously (19).

For the analysis of tissue distribution of ZAKI-4 mRNA expression, human multiple tissue Northern blot (Clontech, Palo Alto, CA), premade Northern blot of 2 µg of poly(A) RNA from human heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas, was used.

Rapid Amplification of cDNA Ends (RACE)

RACE (13), a procedure to amplify nucleic acid sequences from an mRNA template between a defined internal site and unknown sequences at either the 3' or 5' end of mRNA, was performed by utilizing a kit (Life Technologies Inc.) according to the supplier's protocol. To increase the fidelity of PCR, Ex Taq DNA polymerase (TaKaRa Biomedicals, Shiga, Japan) was used in RACE, since Ex Taq possesses 3'-5' exonuclease activity (3'-editing activity), resulting in the reduction of misincorporation per cycle as reported by Barnes (20).

Sequencing Analysis

DNA sequences from both strands were determined on an ABI 373A DNA sequencer at least four times. Sequence searches of GenBankTM was carried out using BLAST program (21).

In Vitro Translation

The complete cDNAs coding ZAKI-4 mRNAs (1.4 and 3.4 kb) were synthesized by reverse transcription-PCR and inserted into pGEM-T vector. In vitro transcription and translation were performed by using TNT coupled reticulocyte lysate systems (Promega) with EXPRE35S 35S protein labeling mix (DuPont NEN), according to the manufacturer's instruction. The synthesized proteins were analyzed by 17.5% SDS-polyacrylamide gel electrophoresis, followed by autoradiography.


RESULTS

Identification of T3-responsive Genes by Differential Display of mRNAs

Fig. 1A illustrates the differential display of mRNAs in human skin fibroblasts cultured in the presence or absence of T3. At a glance, the patterns of bands were similar between T3-treated and nontreated fibroblasts. The patterns between the two fibroblasts from different individuals were similar when the same set of primers was used. However, a closer look identified some bands whose densities were either increased or decreased in the fibroblasts cultured with or without T3 (Fig. 1B). When the changes in the densities by T3 were reproduced in the two fibroblasts from different individuals, the bands were selected as candidates of T3-responsive genes. Nine cDNA fragments were extracted from the gel, reamplified by PCR with the same set of primers, and subcloned into pGEM-T vector. The cloned cDNA fragments were used as the probes for Northern blot analysis to confirm that the expression of the putative T3-responsive genes was indeed regulated by T3. It was demonstrated that the expression of only one gene (ZAKI-4) was up-regulated by T3. The mRNA for the rest of the genes were either undetectable or unaltered by the addition of T3 (data not shown). As shown in Fig. 2, a significant increase was observed 24 h after the addition of 10-10 M T3, a physiological concentration in the presence of 10% TxBS (7). The mRNA was further increased by the addition of 10-8 M T3. Also shown in the figures was the existence of two species of ZAKI-4 mRNA. In addition to a dominant band of 3.4 kb, a faint band of 1.4 kb was observed. The two mRNA species were increased proportionately by T3. As illustrated in Fig. 3, ZAKI-4 mRNA levels increased 12 h after the addition of T3 (10-8 M). These results were reproduced with four different human skin fibroblasts obtained from different individuals (data not shown).


Fig. 1. The differential display of mRNA by PCR. A, two fibroblast lines (a and b) were incubated without or with 10-8 M T3 for 24 h. Total RNA was extracted and reverse transcribed using primer T12MA. PCR was carried out using T12MA and 5 different primers; AP-16-AP-20. B, magnified view of the boxed region in Fig. 1A.


Fig. 2. Dose-dependent increase in ZAKI-4 mRNA by T3. Total RNA was extracted from the cultured fibroblasts from ``subject a'' 24 h after the addition of T3. Ten micrograms per lane was electrophoresed and hybridized with ZAKI-4 cDNA probe. To prepare the probe, a cDNA fragment corresponding to the ZAKI-4 band in Fig. 1B was excised from the gel and reamplified using T12MA and AP-16 and subsequently cloned into pGEM-T vector. The upper panel shows the autoradiograph, and the lower panel shows 28 and 18 S ribosomal RNAs.


Fig. 3. Time course of ZAKI-4 mRNA induction by T3. Total RNA was extracted from cultured fibroblasts from ``subject b.'' Ten micrograms per lane was fractionated. The same cDNA probe in Fig. 2 was used. The upper panel shows the autoradiograph, and the lower panel shows 28 and 18 S ribosomal RNAs.

Mechanism Involved in the Induction of ZAKI-4 mRNA by T3

As shown in Fig. 4, the increase in ZAKI-4 mRNA was completely blocked by the treatment with cycloheximide. By using actinomycin D the half-life of ZAKI-4 mRNA was studied (Fig. 5). It was demonstrated that T3 did not affect the stability (t 22 h in the absence and 20 h in the presence of T3). These results indicate that T3 induces ZAKI-4 mRNA at the transcriptional level, but de novo protein synthesis is required for the induction.


Fig. 4. Requirement of de novo protein synthesis for the induction of ZAKI-4 mRNA by T3. Treatment of the fibroblasts with cycloheximide (CHX) is detailed under ``Materials and Methods.'' An autoradiograph of Northern blot analysis for ZAKI-4 mRNA is shown. The T3-induced increase in ZAKI-4 mRNA was abolished by the treatment with cycloheximide.


Fig. 5. Effect of T3 on the stability of ZAKI-4 mRNA. ZAKI-4 mRNA level before actinomycin D treatment was referred to as time 0, and the changes in ZAKI-4 mRNA level in the presence or absence of T3 were plotted. No effect of T3 on the stability of ZAKI-4 mRNA was observed.

Tissue Distribution of ZAKI-4 mRNA

The expression of ZAKI-4 mRNA was evident in the poly(A) RNAs from heart, brain, liver, and skeletal muscle (Fig. 6). However, no mRNA band was detected in the poly(A) RNAs from placenta, lung, kidney, and pancreas. Thus, ZAKI-4 mRNA is not only expressed in the fibroblasts but also in various T3-responsive organs.


Fig. 6. Tissue distribution of ZAKI-4 mRNA. Human multiple tissue Northern blot (Clontech), premade Northern blot of 2 µg of ploy(A) RNA from human heart (lane 1), brain (lane 2), placenta (lane 3), lung (lane 4), liver (lane 5), skeletal muscle (lane 6), kidney (lane 7), and pancreas (lane 8) were hybridized with the same cDNA probe in Fig. 2.

Note that dominant ZAKI-4 mRNA in skeletal muscle as well as in fibroblasts is 3.4 kb in size, whereas it is 1.4 kb in the other organs.

Determination of Full-length Nucleotide Sequence of ZAKI-4 cDNA

The entire nucleotide sequence of ZAKI-4 cDNA is shown in Fig. 7. As illustrated at the top of the figure, the original cDNA isolated from the differential display was approximately 180 base pairs long. To isolate the full-length cDNA, RACE was employed (primer design was indicated in the figure). 5'-RACE produced a product extending 680 base pairs from the 5'-end of the original clone. On the other hand, 3'-RACE produced two products, one extending approximately 200 base pairs from the 3'-end of the original clone and the other extending 2,300 base pairs. Two products produced by 3'-RACE suggested the presence of two mRNA species with different 3'-ends. Alignment of the sequences enabled us to delineate the entire cDNA sequence. Putative polyadenylation signals could be assigned at nucleotide positions 1023ATTAAA1028 and 3168AATATA3173, giving rise to two mRNA species. The search for an open reading frame revealed that both short and long species of ZAKI-4 mRNAs code a single polypeptide. In frame termination codon 160TAA162 was followed by two initiation codons. The presence of two ATG codons for methionine at N-terminal ends suggested that ZAKI-4 mRNAs may code a protein of either 192 or 197 amino acids. Since Kozak's sequence (22) is present 5'-upstream of the second ATG codon, translation initiation likely occurs at the second ATG, giving rise to a protein of 192 amino acids. Proline and valine residues were abundant in the molecule.


Fig. 7. Nucleotide sequence of ZAKI-4 cDNA. The strategy for 5'- and 3'-RACE is depicted at the top. For 5'-RACE, first cDNA strand was synthesized from total RNA from human skin fibroblasts treated with T3 using primer AS1. After tailing with poly(dC), the cDNA was amplified with a nested primer AS2 and a poly(dG) adapter primer. For 3'-RACE, cDNAs were prepared by reverse transcriptase using the same RNA used in 5'-RACE as a template and oligo(dT) adapter primer. ZAKI-4-specific cDNAs were amplified with primer S1 and an adapter primer. Primer sequences are as follows; AS1, 5'-819AGAGGGACGGCTATTATCG800-3'; AS2, 5'-797AAGGAGCAGGCAGCTCAGTT778-3'; S1, 5'-704AAGAGGACCCAAAGACTTCC723-3'. In the nucleotide sequence, initiation and stop codons are indicated with boldface letters. The boxed sequence is the fragment obtained by the differential display. In the box, italic sequences with underlines correspond to the annealing sites for the primers used in the differential display. Putative polyadenylation signals and corresponding adenylation sites were also indicated.

From the cDNA sequence, it was also deduced that the original clone isolated from the differential display was amplified from the sequence 5'-684CGACAGTGAC693-3' to 5'-848TCAAAAAAAA857-3' with the corresponding primer AP-16 (5'-CGCAGTGAC-3') and T12MA (3'-AMTTTTTTTTTTTT-5'). Thus, there is only one mismatch between 5'-end sequence of the arbitrary primer, while 3'-primer T12MA did not hybridize with the actual cDNA ends but recognized eight adenylate sequences present in the nucleotide from 848 to 857.

Homology search of the ZAKI-4 sequence revealed that there are at least two related sequences. Both of them are short sequences reported as expressed sequence tag (EST). The 5'-end (277-614) of ZAKI-4 cDNA is identical to the EST () from 73 days postnatal female human brain (24). Another EST () from 3-month human infant brain is identical to the 3'-end (2939-3187). Since the present study revealed that ZAKI-4 gene is also expressed in human brain, these two ESTs are likely to be a part of ZAKI-4 cDNA.

In Vitro Translation of ZAKI-4 mRNA

Both short and long species of mRNAs for ZAKI-4 contained an open reading frame as described above. To confirm that both mRNAs code a single peptide, each cDNA was synthesized by reverse transcription-PCR using RNA obtained from the fibroblasts cultured in the presence of T3 and cloned into pGEM-T vector. The corresponding mRNAs were transcribed by T7 RNA polymerase and translated in rabbit reticulocyte lysate. As shown in Fig. 8, both mRNAs programmed the synthesis of a peptide with a molecular mass of 26 kDa, which roughly corresponds to the molecular weight estimated from the amino acid sequence.


Fig. 8. In vitro translation of ZAKI-4 cDNAs. ZAKI-4 cDNAs corresponding to short (1.4-kb) and long (3.4-kb) mRNAs were synthesized by reverse transcription-PCR. Double-stranded cDNAs prepared by PCR were cloned into pGEM-T vector and used for translation. Lane 1, molecular weight marker; lane 2, translation product from the short ZAKI-4 cDNA; lane 3, translation product from the long cDNA; lane 4, no vector.


DISCUSSION

The cloning of a T3-responsive gene ZAKI-4 in human fibroblasts was described. It was demonstrated that the increase of ZAKI-4 mRNA by T3 is regulated at the transcriptional level, since the stability of the mRNA was not affected by T3. However, the T3 effect requires de novo protein synthesis, suggesting the possibility that regulation of ZAKI-4 gene expression by T3 is indirect. To date, very few T3-responsive genes have been cloned in human skin fibroblasts. Expression of fibronectin mRNA was suppressed by T3 (23). The decrease in glycosaminoglycan (7, 8) synthesis by T3 suggested that expression of some genes involved in the synthesis could be repressed by the hormone. To our knowledge, ZAKI-4 gene is the only gene that is up-regulated by T3 in human skin fibroblasts.

Northern blot analysis revealed the presence of two mRNA transcripts (3.4 and 1.4 kb) for ZAKI-4 gene. Since both mRNA species were proportionately increased by T3, it was suggested that both mRNAs were transcribed from the same gene. The data from 3'-RACE also suggested the presence of two mRNA species with different 3'-ends. From the sequence of the entire cDNA it is suggested that the two mRNA species originate from alternative polyadenylation, since putative polyadenylation signals could be localized at two sites with a distance of 2 kb, accounting for the size difference.

No homologous protein sequence to ZAKI-4 was found in the SWISSPROT data base. It is thus impossible to speculate about the function of ZAKI-4 gene product based on the sequence data. However, ZAKI-4 mRNA is expressed not only in fibroblasts but also in brain, heart, liver, and skeletal muscle, suggesting that thyroid hormone exerts its effect by up-regulating its expression in these organs.

There was a size difference in the predominant ZAKI-4 mRNA species in different organs. In skin fibroblasts and skeletal muscles, the mRNA of 3.4 kb in size was the major species, whereas 1.4 kb mRNA was dominant in brain, heart, and liver. Specific distribution of ZAKI-4 mRNA species with differing 3'-ends raises a possibility that there is a mechanism for tissue-specific regulation of alternative polyadenylation.


FOOTNOTES

*   This work was supported in part by Grant-in-Aid for Scientific Research 07671125 from the Ministry of Education, Science and Culture of Japan (to Y. M.) and a research grant from Daiko Foundation (to H. S.). The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) D83407[GenBank] (for ZAKI-4 cDNA sequence).


par    To whom correspondence should be addressed: Dept. of Endocrinology and Metabolism, Division of Molecular and Cellular Adaptation, Research Institute of Environmental Medicine, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-01, Japan. Tel.: 81-52-789-3867; Fax: 81-52-789-3887.
1   The abbreviations used are: T3, triiodothyronine; PCR, polymerase chain reaction; RACE, rapid amplification of cDNA ends; DMEM, Dulbecco's modified Eagle's medium; kb, kilobase(s); EST, expressed sequence tag.

Acknowledgments

We thank Yoshie Ito for excellent technical assistance. We are indebted to Dr. Samuel Refetoff for the provision of human skin fibroblasts.


REFERENCES

  1. Seo, H., Refetoff, S., Fang, V. S. (1977) Endocrinology 100, 216-226 [Abstract/Free Full Text]
  2. Dannies, P. S., Yen, P. M., Tashjian, A. H., Jr. (1977) Endocrinology 101, 1151-1156 [Abstract/Free Full Text]
  3. Ichikawa, K., DeGroot, L. J., Refetoff, S., Horwitz, A. L., Pollak, E. R. (1986) Metabolism 35, 861-868 [CrossRef][Medline] [Order article via Infotrieve]
  4. Klann, R. C., Torres, B., Menke, J. B., Holbrook, C. T., Bercu, B. B., Usala, S. J. (1993) J. Clin. Endocrinol. Metab. 77, 969-975 [Abstract]
  5. Hayashi, Y., Janssen, O. E., Weiss, R. E., Murata, Y., Seo, H., Refetoff, S. (1993) J. Clin. Endocrinol. & Metab. 76, 64-69 [Abstract]
  6. Sakurai, A., Miyamoto, T., Hughes, I. A., DeGroot, L. (1993) J. Clin. Endocrinol. 38, 29-38
  7. Smith, T. J., Murata, Y., Horwitz, A. L., Philpson, L., Refetoff, S. (1982) J. Clin. Invest. 70, 1066-1073
  8. Murata, Y., Refetoff, S., Horwitz, A. L., Smith, T. J. (1983) J. Clin. Endocrinol. & Metab. 57, 1233-1239 [Abstract/Free Full Text]
  9. Murata, Y., Ceccarelli, P., Refetoff, S., Horwitz, A. L., Matsui, N. (1987) J. Clin. Endocrinol. & Metab. 64, 334-339 [Abstract/Free Full Text]
  10. Chait, A., Kanter, R., Green, W., Kenny, M. (1982) J. Clin. Endocrinol. & Metab. 54, 767-772 [Abstract/Free Full Text]
  11. Refetoff, S., Weiss, R. E., Usala, S. J. (1993) Endocr. Rev. 14, 348-399 [Abstract/Free Full Text]
  12. Liang, P., Pardee, A. B. (1992) Science 257, 967-971 [Abstract/Free Full Text]
  13. Liang, P., Averboukh, L., Keyomarsi, K., Sager, R., Pardee, A. B. (1992) Cancer Res. 52, 6966-6968 [Abstract/Free Full Text]
  14. Welsh, J., Chada, K., Dalal, S., Ralph, D., Chang, R., McClelland, M. (1992) Nucleic Acids Res. 20, 4965-4970 [Abstract/Free Full Text]
  15. Ralph, D., McClelland, M., Welsh, J. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 10710-10714 [Abstract/Free Full Text]
  16. Frohman, M. A. (1990) PCR Protocols (Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J., eds) , p. 28, Academic Press, Inc., San Diego
  17. Chomczynski, P., Sacchi, N. (1987) Anal. Biochem. 162, 156-159 [Medline] [Order article via Infotrieve]
  18. Trentmann, S. M., van der Knaap, E., Kende, H. (1995) Science 267, 1186 [Free Full Text]
  19. Miyazaki, T., Sato, M., Murata, Y., Maeda, K., Seo, H. (1995) Am. J. Nephrol. 15, 48-56 [Medline] [Order article via Infotrieve]
  20. Barnes, W. M. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 2216-2220 [Abstract/Free Full Text] ,
  21. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. (1990) J. Mol. Biol. 215, 403-410 [CrossRef][Medline] [Order article via Infotrieve]
  22. Kozak, M. (1989) J. Cell Biol. 108, 229-241 [Abstract/Free Full Text]
  23. Sobiezczyk, S., and Refetoff, S. (1988) Endocrinology 122, (suppl.) T-24
  24. Adams, M. D., Soares, M. B., Kerlavage, A. R., Fields, C., Venter, J. C. (1993) Nat. Genet. 4, 373-380 [CrossRef][Medline] [Order article via Infotrieve]

©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
FASEB J.Home page
K. J. A. Davies, G. Ermak, B. A. Rothermel, M. Pritchard, J. Heitman, J. Ahnn, F. Henrique-Silva, D. Crawford, S. Canaider, P. Strippoli, et al.
Renaming the DSCR1/Adapt78 gene family as RCAN: regulators of calcineurin
FASEB J, October 1, 2007; 21(12): 3023 - 3028.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Cano, A. Canellada, T. Minami, T. Iglesias, and J. M. Redondo
Depolarization of Neural Cells Induces Transcription of the Down Syndrome Critical Region 1 Isoform 4 via a Calcineurin/Nuclear Factor of Activated T Cells-dependent Pathway
J. Biol. Chem., August 19, 2005; 280(33): 29435 - 29443.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L. C. Moeller, A. M. Dumitrescu, R. L. Walker, P. S. Meltzer, and S. Refetoff
Thyroid Hormone Responsive Genes in Cultured Human Fibroblasts
J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 936 - 943.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
X. Cao, F. Kambe, L. C. Moeller, S. Refetoff, and H. Seo
Thyroid Hormone Induces Rapid Activation of Akt/Protein Kinase B-Mammalian Target of Rapamycin-p70S6K Cascade through Phosphatidylinositol 3-Kinase in Human Fibroblasts
Mol. Endocrinol., January 1, 2005; 19(1): 102 - 112.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A. Ejima, M. Tsuda, S. Takeo, K. Ishii, T. Matsuo, and T. Aigaki
Expression Level of sarah, a Homolog of DSCR1, Is Critical for Ovulation and Female Courtship Behavior in Drosophila melanogaster
Genetics, December 1, 2004; 168(4): 2077 - 2087.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. B. Vega, B. A. Rothermel, C. J. Weinheimer, A. Kovacs, R. H. Naseem, R. Bassel-Duby, R. S. Williams, and E. N. Olson
Dual roles of modulatory calcineurin-interacting protein 1 in cardiac hypertrophy
PNAS, January 21, 2003; 100(2): 669 - 674.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Ermak, T. E. Morgan, and K. J. A. Davies
Chronic Overexpression of the Calcineurin Inhibitory Gene DSCR1 (Adapt78) Is Associated with Alzheimer's Disease
J. Biol. Chem., October 12, 2001; 276(42): 38787 - 38794.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Siddiq, T. Miyazaki, Y. Takagishi, Y. Kanou, S. Hayasaka, M. Inouye, H. Seo, and Y. Murata
Expression of ZAKI-4 Messenger Ribonucleic Acid in the Brain during Rat Development and the Effect of Hypothyroidism
Endocrinology, May 1, 2001; 142(5): 1752 - 1759.
[Abstract] [Full Text]


Home page
Circ. Res.Home page
J. Yang, B. Rothermel, R. B. Vega, N. Frey, T. A. McKinsey, E. N. Olson, R. Bassel-Duby, and R. S. Williams
Independent Signals Control Expression of the Calcineurin Inhibitory Proteins MCIP1 and MCIP2 in Striated Muscles
Circ. Res., December 8, 2000; 87 (12): e61 - e68.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. J. Fuentes, L. Genesca, T. J. Kingsbury, K. W. Cunningham, M. Perez-Riba, X. Estivill, and S. d. l. Luna
DSCR1, overexpressed in Down syndrome, is an inhibitor of calcineurin-mediated signaling pathways
Hum. Mol. Genet., July 1, 2000; 9(11): 1681 - 1690.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
T. J. Kingsbury and K. W. Cunningham
A conserved family of calcineurin regulators
Genes & Dev., July 1, 2000; 14(13): 1595 - 1604.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
B. Rothermel, R. B. Vega, J. Yang, H. Wu, R. Bassel-Duby, and R. S. Williams
A Protein Encoded within the Down Syndrome Critical Region Is Enriched in Striated Muscles and Inhibits Calcineurin Signaling
J. Biol. Chem., March 17, 2000; 275(12): 8719 - 8725.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Hosoda, K. Monzen, Y. Hiroi, T. Oka, E. Takimoto, Y. Yazaki, R. Nagai, and I. Komuro
A Novel Myocyte-specific Gene Midori Promotes the Differentiation of P19CL6 Cells into Cardiomyocytes
J. Biol. Chem., September 14, 2001; 276(38): 35978 - 35989.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. R. Crabtree
Calcium, Calcineurin, and the Control of Transcription
J. Biol. Chem., January 19, 2001; 276(4): 2313 - 2316.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Miyazaki, T.
Right arrow Articles by Seo, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Miyazaki, T.
Right arrow Articles by Seo, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1996 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement