|
Volume 271, Number 24,
Issue of June 14, 1996
pp. 14567-14571
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
Molecular Cloning of a Novel Thyroid Hormone-responsive Gene,
ZAKI-4, in Human Skin Fibroblasts*
(Received for publication, August 22, 1995, and in revised form, March 19, 1996)
Takashi
Miyazaki
§,
Yasuhiko
Kanou
¶,
Yoshiharu
Murata
,
Sachiko
Ohmori
,
Toshimitsu
Niwa
§,
Kenji
Maeda
§,
Hideki
Yamamura
¶ and
Hisao
Seo

From the Department of Endocrinology and Metabolism
and the ¶ Department of Teratology and Genetics, Division of
Molecular and Cellular Adaptation, Research Institute of Environmental
Medicine, Nagoya University, Nagoya 464-01, Japan and the
§ Department of Internal Medicine, Nagoya University Branch
Hospital, Nagoya 461, Japan
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES
ABSTRACT
Utilizing a method called ``differential display
of mRNAs by means of polymerase chain reaction'', the cDNA
fragment of a thyroid hormone-responsive gene ZAKI-4 was
cloned from cultured human skin fibroblasts. Northern blot analysis
revealed that there were two ZAKI-4 mRNA species (3.4 and 1.4 kilobases (kb)), and they were up-regulated by a physiological
concentration of triiodothyronine (T3). This T3
effect was abolished by the treatment with cycloheximide, indicating
the possibility that gene ZAKI-4 is regulated by
T3 in an indirect fashion, through an intermediate product
of T3, rather directly by T3 itself. No effect
of T3 on ZAKI-4 mRNA stability suggested that
T3 induces the mRNA at the transcriptional level. Rapid
amplification of cDNA ends confirmed the presence of two mRNA
species. ZAKI-4 mRNA was detected in heart, brain,
liver, and skeletal muscle but not in placenta, lung, kidney and
pancreas. In skin fibroblasts and skeletal muscle, 3.4-kb mRNA was
the major species, whereas 1.4-kb mRNA was dominant in heart,
brain, and liver. The sequence analysis suggested that the two mRNA
species arise from alternative polyadenylation and code a single
protein of 192 amino acids. No homologous protein sequence was found in
a data base. Elucidation of the function of ZAKI-4 gene
product will provide new insights into an important role of
T3 in various organs.
INTRODUCTION
Thyroid hormones (thyroxine and triiodothyronine
(T3))1 play a vital role in
fetal development and throughout life in humans. T3, an
active form of the thyroid hormones, exerts its effect through binding
to its nuclear receptor and regulating expression of target genes.
Thus, identification of T3-responsive genes in various
tissues is important to elucidate T3 action at molecular
and cellular levels in humans. However, the search for
T3-responsive genes in human tissues is hampered by the
difficulty of obtaining tissues from subjects in various thyroid
states. Clonal cell lines established from malignant tissues could be
used to identify T3-responsive genes. However, they might
aberrantly respond to hormones (1, 2). Identification of
T3-responsive gene(s) from the tissues that maintain
differentiated function is thus preferable. Human skin fibroblasts
fulfill this requirement since they express T3-receptors
(3, 4, 5, 6) and are responsive to T3. In cultured skin
fibroblasts, we have shown that T3 inhibits the synthesis
of glycosaminoglycan (7, 8) and fibronectin (9), and Chait et
al. (10) demonstrated that it enhances low density lipoprotein
degradation. These effects of T3 were used for the tissue
diagnosis of generalized resistance to thyroid hormone (11).
Despite the fact that cultured human skin fibroblasts are responsive to
T3, few T3-responsive genes have been cloned.
Recently, Liang and Pardee (12, 13) developed a method called
``differential display of mRNA by means of the polymerase chain
reaction (PCR)'' to identify and analyze altered gene expression at
the mRNA level in any eukaryotic cells. A similar method was
developed by Welsh et al. (14, 15). We have chosen the
method to clone T3-responsive genes in cultured skin
fibroblasts, since it has been successfully employed to identify
transcripts specific for human tumors (13).
We identified a T3-responsive gene expressed in cultured
human skin fibroblasts. The expression of the gene termed
ZAKI-4 is positively regulated by a physiological
concentration of T3. Complete cDNA sequence obtained by
rapid amplification of cDNA ends (16) revealed that the gene is
transcribed into two mRNA species, both of which code a single
peptide of 192 amino acids.
MATERIALS AND METHODS
Cell Culture and Treatment
Skin fibroblasts were obtained
by punch biopsies from the deltoid region of four healthy subjects (two
men and two women, ranging in age from 9 to 37 years old (males 9 and
29 years, females 25 and 37 years)). The fibroblasts were used between
the fourth and the ninth passages after the initial plating and were
grown to confluence in 60-mm-diameter plastic culture dishes (Becton
Dickinson Labware, Lincoln Park, NJ) with 4 ml of Dulbecco's modified
Eagle's medium (DMEM, Nissui Pharmaceutical Co., Ltd., Tokyo, Japan)
containing 10% fetal bovine serum (Bioserum, Victoria, Australia) and
50 units/ml penicillin G (Life Technologies, Inc., Grand Island, NY)
and 50 mg/ml streptomycin (Life Technologies, Inc.) at 37 °C in an
atmosphere of air, 5% CO2 and 100% relative humidity. To
study the effect of T3 on ZAKI-4 mRNA, the
cells were exposed to 4 ml of the same medium in which fetal bovine
serum was replaced with 10% bovine serum from a thyroidectomized calf
(TxBS; Rockland Farms, Gilbertsville, PA) (7). After three days of
culture, the medium was replaced with DMEM containing either 10% TxBS
alone or TxBS plus T3
(10 10-10 8 M;
Sigma). The cells were further incubated for the
indicated periods of time. Total RNA was extracted from cells by the
method of Chomczynski and Sacchi (17).
To examine whether the T3-mediated increase in
ZAKI-4 mRNA requires de novo protein
synthesis, the medium of confluent fibroblast cultures was replaced
with DMEM supplemented with 10% TxBS and 25 µM
cycloheximide (Wako Pure Chemical Industries, Osaka, Japan) was added
15 min before T3 (10 7 M)
addition. The cells were further incubated for 24 h, and total RNA
was extracted. The effect of T3 on the stability of
ZAKI-4 mRNA was evaluated as follows. Fibroblast
cultures in confluency were treated with 10 7
M T3 for 72 h. Then the cells were washed
two times with 4 ml of serumless DMEM. They were incubated in DMEM
supplemented with 10% TxBS containing actinomycin D (SERVA,
Heidelberg, Germany) at a final concentration of 5 µg/ml with or
without 10 7 M T3. After further
incubation for 12, 24, and 48 h, the cells were harvested for RNA
extraction.
Differential Display of mRNA by PCR
Total RNA was
extracted from the two fibroblast cell lines, a) male 29 year and b) female 25 year, incubated with or without
T3 for 24 h. Differential display was carried out
using RNAmap Kit (GenHunter Corp., Brookline, MA). Briefly, 0.2 µg of
the total RNA was reverse transcribed with T12MA (5 -TTTTTTTTTTTTMA-3 ,
where M represents degenerate bases) and subsequently amplified by PCR
using five different arbitrary primers AP-16 (5 -CGTCAGTGAC-3 ), AP-17
(5 -GCAAGGAGTC-3 ), AP-18 (5 -CTGAGCTAGG-3 ), AP-19 (5 -GGCTAATGCC-3 ),
and AP-20 (5 -GTGATCGGAC-3 ) according to the supplier's protocol with
minor modification. In the PCR [33P]dATP (specific
activity 70 TBq/mmol; DuPont NEN) was used instead of
[35S]dATP as recommended by Trentmann et al.
(18).
After an initial 2-min denaturation at 94 °C, PCR was carried out
using AmpliTaq DNA polymerase (Perkin-Elmer) for 40 cycles with
denaturation at 94 °C for 30 s, annealing at 40 °C for 2 min, and extension at 72 °C for 30 s. An aliquot of each PCR
product (5 µl) was analyzed on a 5% DNA sequence gel, which was
subsequently exposed to X-AR film (Eastman Kodak Co.) for
autoradiography. The cDNA fragments of interest were recovered from
the gel and subsequently reamplified with the same primer set and PCR
conditions except that no isotopes were added. The reamplified cDNA
fragments were cloned into pGEM-T vector from Promega (Madison,
WI).
Northern Blot Analysis
Total RNA samples isolated from the
four fibroblast cell lines cultured in the presence or absence of
T3 were subjected to Northern blot analysis as described
previously (19).
For the analysis of tissue distribution of ZAKI-4 mRNA
expression, human multiple tissue Northern blot (Clontech, Palo Alto,
CA), premade Northern blot of 2 µg of poly(A) RNA from human heart,
brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas,
was used.
Rapid Amplification of cDNA Ends (RACE)
RACE (13), a
procedure to amplify nucleic acid sequences from an mRNA template
between a defined internal site and unknown sequences at either the 3
or 5 end of mRNA, was performed by utilizing a kit (Life
Technologies Inc.) according to the supplier's protocol. To increase
the fidelity of PCR, Ex Taq DNA polymerase (TaKaRa Biomedicals, Shiga,
Japan) was used in RACE, since Ex Taq possesses 3 -5 exonuclease
activity (3 -editing activity), resulting in the reduction of
misincorporation per cycle as reported by Barnes (20).
Sequencing Analysis
DNA sequences from both strands were
determined on an ABI 373A DNA sequencer at least four times. Sequence
searches of GenBankTM was carried out using BLAST program
(21).
In Vitro Translation
The complete cDNAs coding
ZAKI-4 mRNAs (1.4 and 3.4 kb) were synthesized by
reverse transcription-PCR and inserted into pGEM-T vector. In
vitro transcription and translation were performed by using TNT
coupled reticulocyte lysate systems (Promega) with EXPRE35S
35S protein labeling mix (DuPont NEN), according to the
manufacturer's instruction. The synthesized proteins were analyzed by
17.5% SDS-polyacrylamide gel electrophoresis, followed by
autoradiography.
RESULTS
Identification of T3-responsive Genes by Differential
Display of mRNAs
Fig. 1A
illustrates the differential display of mRNAs in human skin
fibroblasts cultured in the presence or absence of T3. At a
glance, the patterns of bands were similar between
T3-treated and nontreated fibroblasts. The patterns between
the two fibroblasts from different individuals were similar when the
same set of primers was used. However, a closer look identified some
bands whose densities were either increased or decreased in the
fibroblasts cultured with or without T3 (Fig.
1B). When the changes in the densities by T3
were reproduced in the two fibroblasts from different individuals, the
bands were selected as candidates of T3-responsive genes.
Nine cDNA fragments were extracted from the gel, reamplified by PCR
with the same set of primers, and subcloned into pGEM-T vector. The
cloned cDNA fragments were used as the probes for Northern blot
analysis to confirm that the expression of the putative
T3-responsive genes was indeed regulated by T3.
It was demonstrated that the expression of only one gene
(ZAKI-4) was up-regulated by T3. The mRNA
for the rest of the genes were either undetectable or unaltered by the
addition of T3 (data not shown). As shown in Fig.
2, a significant increase was observed 24 h after
the addition of 10 10 M T3, a
physiological concentration in the presence of 10% TxBS (7). The
mRNA was further increased by the addition of 10 8
M T3. Also shown in the figures was the
existence of two species of ZAKI-4 mRNA. In addition to
a dominant band of 3.4 kb, a faint band of 1.4 kb was observed. The two
mRNA species were increased proportionately by T3. As
illustrated in Fig. 3, ZAKI-4 mRNA levels
increased 12 h after the addition of T3
(10 8 M). These results were reproduced with
four different human skin fibroblasts obtained from different
individuals (data not shown).
Fig. 1.
The differential display of mRNA by PCR.
A, two fibroblast lines (a and b) were
incubated without or with 10 8 M
T3 for 24 h. Total RNA was extracted and reverse
transcribed using primer T12MA. PCR was carried out using T12MA and 5 different primers; AP-16-AP-20. B, magnified view of the
boxed region in Fig. 1A.
Fig. 2.
Dose-dependent increase in
ZAKI-4 mRNA by T3. Total RNA was
extracted from the cultured fibroblasts from ``subject a'' 24 h
after the addition of T3. Ten micrograms per lane was
electrophoresed and hybridized with ZAKI-4 cDNA probe.
To prepare the probe, a cDNA fragment corresponding to the
ZAKI-4 band in Fig. 1B was excised from the gel
and reamplified using T12MA and AP-16 and subsequently cloned into
pGEM-T vector. The upper panel shows the autoradiograph, and
the lower panel shows 28 and 18 S ribosomal RNAs.
Fig. 3.
Time course of ZAKI-4 mRNA
induction by T3. Total RNA was extracted from cultured
fibroblasts from ``subject b.'' Ten micrograms per lane was
fractionated. The same cDNA probe in Fig. 2 was used. The
upper panel shows the autoradiograph, and the lower
panel shows 28 and 18 S ribosomal RNAs.
Mechanism Involved in the Induction of ZAKI-4 mRNA by
T3
As shown in Fig. 4, the increase in
ZAKI-4 mRNA was completely blocked by the treatment with
cycloheximide. By using actinomycin D the half-life of
ZAKI-4 mRNA was studied (Fig. 5). It was
demonstrated that T3 did not affect the stability
(t 22 h in the absence and 20 h in the
presence of T3). These results indicate that T3
induces ZAKI-4 mRNA at the transcriptional level, but
de novo protein synthesis is required for the induction.
Fig. 4.
Requirement of de novo protein
synthesis for the induction of ZAKI-4 mRNA by
T3. Treatment of the fibroblasts with cycloheximide
(CHX) is detailed under ``Materials and Methods.'' An
autoradiograph of Northern blot analysis for ZAKI-4 mRNA
is shown. The T3-induced increase in ZAKI-4
mRNA was abolished by the treatment with cycloheximide.
Fig. 5.
Effect of T3 on the stability of
ZAKI-4 mRNA. ZAKI-4 mRNA level before
actinomycin D treatment was referred to as time 0, and the changes in
ZAKI-4 mRNA level in the presence or absence of
T3 were plotted. No effect of T3 on the
stability of ZAKI-4 mRNA was observed.
Tissue Distribution of ZAKI-4 mRNA
The expression of
ZAKI-4 mRNA was evident in the poly(A) RNAs from heart,
brain, liver, and skeletal muscle (Fig. 6). However, no
mRNA band was detected in the poly(A) RNAs from placenta, lung,
kidney, and pancreas. Thus, ZAKI-4 mRNA is not only
expressed in the fibroblasts but also in various
T3-responsive organs.
Fig. 6.
Tissue distribution of ZAKI-4
mRNA. Human multiple tissue Northern blot (Clontech), premade
Northern blot of 2 µg of ploy(A) RNA from human heart (lane
1), brain (lane 2), placenta (lane 3), lung
(lane 4), liver (lane 5), skeletal muscle
(lane 6), kidney (lane 7), and pancreas
(lane 8) were hybridized with the same cDNA probe in
Fig. 2.
Note that dominant ZAKI-4 mRNA in skeletal muscle as
well as in fibroblasts is 3.4 kb in size, whereas it is 1.4 kb in the
other organs.
Determination of Full-length Nucleotide Sequence of ZAKI-4
cDNA
The entire nucleotide sequence of ZAKI-4
cDNA is shown in Fig. 7. As illustrated at the
top of the figure, the original cDNA isolated from the
differential display was approximately 180 base pairs long. To isolate
the full-length cDNA, RACE was employed (primer design was
indicated in the figure). 5 -RACE produced a product extending 680 base
pairs from the 5 -end of the original clone. On the other hand, 3 -RACE
produced two products, one extending approximately 200 base pairs from
the 3 -end of the original clone and the other extending 2,300 base
pairs. Two products produced by 3 -RACE suggested the presence of two
mRNA species with different 3 -ends. Alignment of the sequences
enabled us to delineate the entire cDNA sequence. Putative
polyadenylation signals could be assigned at nucleotide positions
1023ATTAAA1028 and
3168AATATA3173, giving rise to two mRNA
species. The search for an open reading frame revealed that both short
and long species of ZAKI-4 mRNAs code a single
polypeptide. In frame termination codon
160TAA162 was followed by two initiation
codons. The presence of two ATG codons for methionine at N-terminal
ends suggested that ZAKI-4 mRNAs may code a protein of
either 192 or 197 amino acids. Since Kozak's sequence (22) is present
5 -upstream of the second ATG codon, translation initiation likely
occurs at the second ATG, giving rise to a protein of 192 amino acids.
Proline and valine residues were abundant in the molecule.
Fig. 7.
Nucleotide sequence of ZAKI-4
cDNA. The strategy for 5 - and 3 -RACE is depicted at the
top. For 5 -RACE, first cDNA strand was synthesized from
total RNA from human skin fibroblasts treated with T3 using
primer AS1. After tailing with poly(dC), the cDNA was amplified
with a nested primer AS2 and a poly(dG) adapter primer. For 3 -RACE,
cDNAs were prepared by reverse transcriptase using the same RNA
used in 5 -RACE as a template and oligo(dT) adapter primer.
ZAKI-4-specific cDNAs were amplified with primer S1 and
an adapter primer. Primer sequences are as follows; AS1,
5 -819AGAGGGACGGCTATTATCG800-3 ; AS2,
5 -797AAGGAGCAGGCAGCTCAGTT778-3 ; S1,
5 -704AAGAGGACCCAAAGACTTCC723-3 . In
the nucleotide sequence, initiation and stop codons are indicated
with boldface letters. The boxed sequence is the
fragment obtained by the differential display. In the box,
italic sequences with underlines correspond to
the annealing sites for the primers used in the differential display.
Putative polyadenylation signals and corresponding adenylation sites
were also indicated.
From the cDNA sequence, it was also deduced that the original clone
isolated from the differential display was amplified from the sequence
5 -684CGACAGTGAC693-3 to
5 -848TCAAAAAAAA857-3 with the
corresponding primer AP-16 (5 -CG CAGTGAC-3 ) and T12MA
(3 -AMTTTTTTTTTTTT-5 ). Thus, there is only one mismatch between 5 -end
sequence of the arbitrary primer, while 3 -primer T12MA did not
hybridize with the actual cDNA ends but recognized eight adenylate
sequences present in the nucleotide from 848 to 857.
Homology search of the ZAKI-4 sequence revealed that there
are at least two related sequences. Both of them are short sequences
reported as expressed sequence tag (EST). The 5 -end (277-614) of
ZAKI-4 cDNA is identical to the EST () from 73 days postnatal female human brain (24). Another
EST () from 3-month human infant brain is
identical to the 3 -end (2939-3187). Since the present study revealed
that ZAKI-4 gene is also expressed in human brain, these two
ESTs are likely to be a part of ZAKI-4 cDNA.
In Vitro Translation of ZAKI-4 mRNA
Both short and long
species of mRNAs for ZAKI-4 contained an open reading
frame as described above. To confirm that both mRNAs code a single
peptide, each cDNA was synthesized by reverse transcription-PCR
using RNA obtained from the fibroblasts cultured in the presence of
T3 and cloned into pGEM-T vector. The corresponding
mRNAs were transcribed by T7 RNA polymerase and translated in
rabbit reticulocyte lysate. As shown in Fig. 8, both
mRNAs programmed the synthesis of a peptide with a molecular mass
of 26 kDa, which roughly corresponds to the molecular weight estimated
from the amino acid sequence.
Fig. 8.
In vitro translation of
ZAKI-4 cDNAs. ZAKI-4 cDNAs corresponding
to short (1.4-kb) and long (3.4-kb) mRNAs were synthesized by
reverse transcription-PCR. Double-stranded cDNAs prepared by PCR
were cloned into pGEM-T vector and used for translation. Lane
1, molecular weight marker; lane 2, translation product
from the short ZAKI-4 cDNA; lane 3,
translation product from the long cDNA; lane 4, no
vector.
DISCUSSION
The cloning of a T3-responsive gene ZAKI-4
in human fibroblasts was described. It was demonstrated that the
increase of ZAKI-4 mRNA by T3 is regulated
at the transcriptional level, since the stability of the mRNA was
not affected by T3. However, the T3 effect
requires de novo protein synthesis, suggesting the
possibility that regulation of ZAKI-4 gene expression by
T3 is indirect. To date, very few T3-responsive
genes have been cloned in human skin fibroblasts. Expression of
fibronectin mRNA was suppressed by T3 (23). The
decrease in glycosaminoglycan (7, 8) synthesis by T3
suggested that expression of some genes involved in the synthesis could
be repressed by the hormone. To our knowledge, ZAKI-4 gene
is the only gene that is up-regulated by T3 in human skin
fibroblasts.
Northern blot analysis revealed the presence of two mRNA
transcripts (3.4 and 1.4 kb) for ZAKI-4 gene. Since both
mRNA species were proportionately increased by T3, it
was suggested that both mRNAs were transcribed from the same gene.
The data from 3 -RACE also suggested the presence of two mRNA
species with different 3 -ends. From the sequence of the entire
cDNA it is suggested that the two mRNA species originate from
alternative polyadenylation, since putative polyadenylation signals
could be localized at two sites with a distance of 2 kb, accounting for
the size difference.
No homologous protein sequence to ZAKI-4 was found in the
SWISSPROT data base. It is thus impossible to speculate about the
function of ZAKI-4 gene product based on the sequence data.
However, ZAKI-4 mRNA is expressed not only in
fibroblasts but also in brain, heart, liver, and skeletal muscle,
suggesting that thyroid hormone exerts its effect by up-regulating its
expression in these organs.
There was a size difference in the predominant ZAKI-4
mRNA species in different organs. In skin fibroblasts and skeletal
muscles, the mRNA of 3.4 kb in size was the major species, whereas
1.4 kb mRNA was dominant in brain, heart, and liver. Specific
distribution of ZAKI-4 mRNA species with differing
3 -ends raises a possibility that there is a mechanism for
tissue-specific regulation of alternative polyadenylation.
FOOTNOTES
*
This work was supported in part by Grant-in-Aid for
Scientific Research 07671125 from the Ministry of Education, Science
and Culture of Japan (to Y. M.) and a research grant from Daiko
Foundation (to H. S.). The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
``advertisement'' in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) D83407[GenBank] (for ZAKI-4 cDNA sequence).
To whom correspondence should be addressed: Dept. of
Endocrinology and Metabolism, Division of Molecular and Cellular
Adaptation, Research Institute of Environmental Medicine, Nagoya
University, Furo-cho, Chikusa-ku, Nagoya 464-01, Japan. Tel.:
81-52-789-3867; Fax: 81-52-789-3887.
1
The abbreviations used are: T3,
triiodothyronine; PCR, polymerase chain reaction; RACE, rapid
amplification of cDNA ends; DMEM, Dulbecco's modified Eagle's
medium; kb, kilobase(s); EST, expressed sequence tag.
Acknowledgments
We thank Yoshie Ito for excellent technical
assistance. We are indebted to Dr. Samuel Refetoff for the provision of
human skin fibroblasts.
REFERENCES
-
Seo, H.,
Refetoff, S.,
Fang, V. S.
(1977)
Endocrinology
100,
216-226
[Abstract/Free Full Text]
-
Dannies, P. S.,
Yen, P. M.,
Tashjian, A. H., Jr.
(1977)
Endocrinology
101,
1151-1156
[Abstract/Free Full Text]
-
Ichikawa, K.,
DeGroot, L. J.,
Refetoff, S.,
Horwitz, A. L.,
Pollak, E. R.
(1986)
Metabolism
35,
861-868
[CrossRef][Medline]
[Order article via Infotrieve]
-
Klann, R. C.,
Torres, B.,
Menke, J. B.,
Holbrook, C. T.,
Bercu, B. B.,
Usala, S. J.
(1993)
J. Clin. Endocrinol. Metab.
77,
969-975
[Abstract]
-
Hayashi, Y.,
Janssen, O. E.,
Weiss, R. E.,
Murata, Y.,
Seo, H.,
Refetoff, S.
(1993)
J. Clin. Endocrinol. & Metab.
76,
64-69
[Abstract]
-
Sakurai, A.,
Miyamoto, T.,
Hughes, I. A.,
DeGroot, L.
(1993)
J. Clin. Endocrinol.
38,
29-38
-
Smith, T. J.,
Murata, Y.,
Horwitz, A. L.,
Philpson, L.,
Refetoff, S.
(1982)
J. Clin. Invest.
70,
1066-1073
-
Murata, Y.,
Refetoff, S.,
Horwitz, A. L.,
Smith, T. J.
(1983)
J. Clin. Endocrinol. & Metab.
57,
1233-1239
[Abstract/Free Full Text]
-
Murata, Y.,
Ceccarelli, P.,
Refetoff, S.,
Horwitz, A. L.,
Matsui, N.
(1987)
J. Clin. Endocrinol. & Metab.
64,
334-339
[Abstract/Free Full Text]
-
Chait, A.,
Kanter, R.,
Green, W.,
Kenny, M.
(1982)
J. Clin. Endocrinol. & Metab.
54,
767-772
[Abstract/Free Full Text]
-
Refetoff, S.,
Weiss, R. E.,
Usala, S. J.
(1993)
Endocr. Rev.
14,
348-399
[Abstract/Free Full Text]
-
Liang, P.,
Pardee, A. B.
(1992)
Science
257,
967-971
[Abstract/Free Full Text]
-
Liang, P.,
Averboukh, L.,
Keyomarsi, K.,
Sager, R.,
Pardee, A. B.
(1992)
Cancer Res.
52,
6966-6968
[Abstract/Free Full Text]
-
Welsh, J.,
Chada, K.,
Dalal, S.,
Ralph, D.,
Chang, R.,
McClelland, M.
(1992)
Nucleic Acids Res.
20,
4965-4970
[Abstract/Free Full Text]
-
Ralph, D.,
McClelland, M.,
Welsh, J.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
10710-10714
[Abstract/Free Full Text]
-
Frohman, M. A.
(1990)
PCR Protocols
(Innis, M. A.,
Gelfand, D. H.,
Sninsky, J. J.,
White, T. J.,
eds)
, p. 28, Academic Press, Inc., San Diego
-
Chomczynski, P.,
Sacchi, N.
(1987)
Anal. Biochem.
162,
156-159
[Medline]
[Order article via Infotrieve]
-
Trentmann, S. M.,
van der Knaap, E.,
Kende, H.
(1995)
Science
267,
1186
[Free Full Text]
-
Miyazaki, T.,
Sato, M.,
Murata, Y.,
Maeda, K.,
Seo, H.
(1995)
Am. J. Nephrol.
15,
48-56
[Medline]
[Order article via Infotrieve]
-
Barnes, W. M.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
2216-2220
[Abstract/Free Full Text]
,
-
Altschul, S. F.,
Gish, W.,
Miller, W.,
Myers, E. W.,
Lipman, D. J.
(1990)
J. Mol. Biol.
215,
403-410
[CrossRef][Medline]
[Order article via Infotrieve]
-
Kozak, M.
(1989)
J. Cell Biol.
108,
229-241
[Abstract/Free Full Text]
-
Sobiezczyk, S., and Refetoff, S. (1988) Endocrinology 122, (suppl.) T-24
-
Adams, M. D.,
Soares, M. B.,
Kerlavage, A. R.,
Fields, C.,
Venter, J. C.
(1993)
Nat. Genet.
4,
373-380
[CrossRef][Medline]
[Order article via Infotrieve]
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K. J. A. Davies, G. Ermak, B. A. Rothermel, M. Pritchard, J. Heitman, J. Ahnn, F. Henrique-Silva, D. Crawford, S. Canaider, P. Strippoli, et al.
Renaming the DSCR1/Adapt78 gene family as RCAN: regulators of calcineurin
FASEB J,
October 1, 2007;
21(12):
3023 - 3028.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Cano, A. Canellada, T. Minami, T. Iglesias, and J. M. Redondo
Depolarization of Neural Cells Induces Transcription of the Down Syndrome Critical Region 1 Isoform 4 via a Calcineurin/Nuclear Factor of Activated T Cells-dependent Pathway
J. Biol. Chem.,
August 19, 2005;
280(33):
29435 - 29443.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. C. Moeller, A. M. Dumitrescu, R. L. Walker, P. S. Meltzer, and S. Refetoff
Thyroid Hormone Responsive Genes in Cultured Human Fibroblasts
J. Clin. Endocrinol. Metab.,
February 1, 2005;
90(2):
936 - 943.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Cao, F. Kambe, L. C. Moeller, S. Refetoff, and H. Seo
Thyroid Hormone Induces Rapid Activation of Akt/Protein Kinase B-Mammalian Target of Rapamycin-p70S6K Cascade through Phosphatidylinositol 3-Kinase in Human Fibroblasts
Mol. Endocrinol.,
January 1, 2005;
19(1):
102 - 112.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Ejima, M. Tsuda, S. Takeo, K. Ishii, T. Matsuo, and T. Aigaki
Expression Level of sarah, a Homolog of DSCR1, Is Critical for Ovulation and Female Courtship Behavior in Drosophila melanogaster
Genetics,
December 1, 2004;
168(4):
2077 - 2087.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. B. Vega, B. A. Rothermel, C. J. Weinheimer, A. Kovacs, R. H. Naseem, R. Bassel-Duby, R. S. Williams, and E. N. Olson
Dual roles of modulatory calcineurin-interacting protein 1 in cardiac hypertrophy
PNAS,
January 21, 2003;
100(2):
669 - 674.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Ermak, T. E. Morgan, and K. J. A. Davies
Chronic Overexpression of the Calcineurin Inhibitory Gene DSCR1 (Adapt78) Is Associated with Alzheimer's Disease
J. Biol. Chem.,
October 12, 2001;
276(42):
38787 - 38794.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Siddiq, T. Miyazaki, Y. Takagishi, Y. Kanou, S. Hayasaka, M. Inouye, H. Seo, and Y. Murata
Expression of ZAKI-4 Messenger Ribonucleic Acid in the Brain during Rat Development and the Effect of Hypothyroidism
Endocrinology,
May 1, 2001;
142(5):
1752 - 1759.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. Yang, B. Rothermel, R. B. Vega, N. Frey, T. A. McKinsey, E. N. Olson, R. Bassel-Duby, and R. S. Williams
Independent Signals Control Expression of the Calcineurin Inhibitory Proteins MCIP1 and MCIP2 in Striated Muscles
Circ. Res.,
December 8, 2000;
87
(12):
e61 - e68.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Fuentes, L. Genesca, T. J. Kingsbury, K. W. Cunningham, M. Perez-Riba, X. Estivill, and S. d. l. Luna
DSCR1, overexpressed in Down syndrome, is an inhibitor of calcineurin-mediated signaling pathways
Hum. Mol. Genet.,
July 1, 2000;
9(11):
1681 - 1690.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Kingsbury and K. W. Cunningham
A conserved family of calcineurin regulators
Genes & Dev.,
July 1, 2000;
14(13):
1595 - 1604.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
B. Rothermel, R. B. Vega, J. Yang, H. Wu, R. Bassel-Duby, and R. S. Williams
A Protein Encoded within the Down Syndrome Critical Region Is Enriched in Striated Muscles and Inhibits Calcineurin Signaling
J. Biol. Chem.,
March 17, 2000;
275(12):
8719 - 8725.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Hosoda, K. Monzen, Y. Hiroi, T. Oka, E. Takimoto, Y. Yazaki, R. Nagai, and I. Komuro
A Novel Myocyte-specific Gene Midori Promotes the Differentiation of P19CL6 Cells into Cardiomyocytes
J. Biol. Chem.,
September 14, 2001;
276(38):
35978 - 35989.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. R. Crabtree
Calcium, Calcineurin, and the Control of Transcription
J. Biol. Chem.,
January 19, 2001;
276(4):
2313 - 2316.
[Full Text]
[PDF]
|
 |
|
Copyright © 1996 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|