INTRODUCTION

N-Acetylglucosamine (GlcNAc) is the monomer building block of chitin, which forms the organic matrix of the exoskeletons of arthropods (insects, spiders, crabs) and the cell walls of fungi and of zooplankton. Chitin is the second most abundant biopolymer after cellulose. Roseman and colleagues pointed out that the ocean waters would be rapidly depleted of carbon and nitrogen by sedimentation of the insoluble exoskeletons if the carbon and nitrogen could not be returned to the ecosystem by chitinovorous bacteria (Yu et al., 1991). They discern five steps for chitin degradation by bacteria: chemotaxis, adhesion, extracellular degradation, uptake, and catabolism (Bassler et al., 1991a, 1991b; Yu et al., 1991). GlcNAc is taken up and phosphorylated by an inner membrane transport protein of the bacterial phosphotransferase system (PTS).¹ GlcNAc-containing oligosaccharides, in contrast, are transported by a separate, possibly periplasmic binding protein-dependent permease. It has been shown that the phosphotransferase proteins of a wide variety of marine Vibrio immunologically cross-react with and functionally complement the PTS proteins of enteric bacteria (Meadow et al., 1988), e.g. the four subunits of the mannose- and glucose-specific permease of Vibrio furnissii have between 28 and 37% sequence identity with the mannose transporter of Escherichia coli.²

The purification and functional reconstitution of the GlcNAc-specific transporter (IICBA^GlcNAc) of E. coli are the subjects of this report. IICBA^GlcNAc belongs to the group of carbohydrate transporters known as Enzymes II of the phosphoenolpyruvate (PEP)-dependent phosphotransferase system (Kundig et al., 1964). These proteins act by a mechanism that couples vectorial translocation with phosphorylation of the transported solute. PEP is the phosphoryldonor, and phosphoryltransfer proceeds through phosphoprotein intermediates in the sequence PEP  enzyme I  HPr  IIA IIB  O-6 of hexose. Enzyme I and HPr are cytosolic proteins, IIA and IIB are subunits or domains of the sugar-specific transporters (for comprehensive reviews, see Meadow et al., 1990; Postma et al., 1993; Saier and Reizer, 1994; Lengeler et al., 1994). IICBA^GlcNAc has been identified as a 65-kDa membrane protein by Waygood et al. (1984), and the nagE gene was cloned and sequenced (Rogers et al., 1988; Peri and Waygood, 1988; Peri et al., 1991). The transcription control of the nag operon by a specific repressor and the catabolite activator protein (Cap) has been analyzed in E. coli and Klebsiella pneumoniae (Vogler and Lengeler, 1989; Plumbridge, 1990; Plumbridge and Kolb, 1991, 1993). IICBA^GlcNAc has 40% sequence identity and is colinear with the IICB^Glc and IIA^Glc subunits of the glucose transporter. Based on this strong structural similarity, IICBA^GlcNAc can be characterized as follows (Weigel et al., 1982a, 1982b; Dörschug et al., 1984; Peri and Waygood, 1988; Hummel et al., 1992; Buhr and Erni, 1993; Meins et al., 1993). The amino-terminal IIC domain of 370 residues spans the membrane eight times, contains the substrate specificity determinants, and provides the interface for dimerization. The IIB and the IIA domains are globular and exposed on the cytosolic face of the membrane. IIB (residues 370-480) mediates phosphoryltransfer between IIA and O-6 of GlcNAc. In this process IIB becomes transiently phosphorylated on Cys⁴¹². The carboxyl-terminal IIA domain (residues 480-648) mediates phosphoryltransfer between HPr and IIB through a phospho-His⁵⁶⁹ intermediate. The IIA and IIB domains of IICBA^GlcNAc are linked through an Ala-Pro-rich peptide segment, which is characteristic for structurally independent domains (Erni, 1989; Perham, 1991). The IIB and IIC domains are linked by the invariant sequence LKTPGRED.

IICB^Glc·IIA^Glc and IICBA^GlcNAc can functionally complement each other. IIA^Glc can complement a truncated GlcNAc transporter (IICB^Glc; Vogler and Lengeler, 1988), and IICBA^GlcNAc can suppress IIA^Glc defects (Vogler et al., 1988). A chimeric protein between the IIC domain of IICB^Glc and the IIA and IIB domains of IICBA^GlcNAc was active and glucose-specific (Hummel et al., 1992). Complementation is not restricted to the transport function, but it also includes some of the allosteric control functions exerted by the IIA^Glc subunit. Under appropriate physiological conditions the IIA^Glc-like IIA domain of IICBA^GlcNAc inhibits glycerol kinase and maltose uptake, but in contrast to IIA^Glc does not inhibit adenylcyclase (catabolite repression; van der Vlag and Postma, 1995).

This functional interaction between two homologous but not identical membrane transporters poses questions with respect to the mechanism of the underlying protein protein interactions. Does complementation occur between different domains on two homodimeric transporters (e.g., between IIB^GlcNAc and IIC^Glc in a transient tetrameric intermediate), or is there subunit exchange with concomitant formation of IICB^Glc·IICBA^GlcNAc heterodimers? The complexity of native membranes and interferences with other membrane constituents severely limit the elucidation of these aspects. Thus it is vital to reconstitute the purified membrane proteins in artificial phospholipid vesicles to study these functions. The transporters for mannitol and mannose have already been reconstituted into phospholipid vesicles (Elferink et al., 1990; Mao et al., 1995). However, they belong to structurally unrelated families of PTS transporters. In this paper, we describe the purification of IICBA^GlcNAc by Ni²⁺ chelate affinity chromatography and its functional reconstitution in phosphatidylethanolamine vesicles. As a prerequisite for further work and for comparison, IICB^Glc and the structurally unrelated mannose transporter were also reconstituted using the same procedure.

MATERIALS AND METHODS

In E. coli K12 LR2-168G the unstable ptsG allele was deleted from strain LR2-168 manI nagE ptsG lacY1 galT6 xyl-7 (Lengeler et al., 1981) by P1 transduction of a ptsG deletion linked to cat as described (Buhr et al., 1994).

Plasmid pJFEH6 (see Fig. 1A) for the controlled expression and purification by Ni²⁺ chelate affinity chromatography of IICBA^GlcNAc plasmid was constructed as follows. The 5-upstream region of nagE in plasmid pTSE21 (Hummel et al., 1992) was trimmed with Bal31, the truncated nagE cloned into the SmaI site of pJFEH119, and one plasmid (pJFNagE) containing only a 20-nucleotide upstream noncoding sequence was selected as described (Buhr et al., 1994). To append six histidines to the carboxyl terminus of IICBA^GlcNAc the polymerase chain reaction was used. A polymerase chain reaction fragment was amplified with primers GGTGCACTGCAGAAGACGAGATCGTTACT and CCCCCCAGACTTTTTGATTTCATACAGCGG. The polymerase chain reaction product was digested with NdeI and HindIII and the 270-base pair fragment ligated with the 7-kilobase vector fragment obtained by digestion of pJFNagE with HindIII and partial NdeI. Standard procedures were used for plasmid purification, restriction analysis, ligation, and transformation (Sambrook et al., 1989).

Expression and Purification of IICBA^GlcNAc-6HE. coli LR2-168G (pJFEH6) was grown in LB broth. When the cells had reached A₆₀₀ = 1.5, protein expression was induced with 0.1 mM isopropyl--D-thiogalactopyranoside and incubation continued for 3 h. Cells were harvested by centrifugation (16,000 × g; 4 °C; 15 min), and the cell pellet was resuspended in buffer A (50 mM Tris-HCl, pH 7.5, 500 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 2 ml/g, wet weight, of cells). Cells were broken by two passages through a French pressure cell, cell debris was removed by low speed centrifugation (12,000 × g; 4 °C; 10 min), and membranes were collected by high speed centrifugation (300,000 × g; 4 °C; 1 h), resuspended in buffer B (10 mM Tris glycine, pH 9.3, 10 mM -mercaptoethanol), shock frozen in liquid N₂, and stored at 80 °C. Membrane proteins were solubilized with 2% n-decyl--D-maltopyranoside (DM, Sigma). The mixture was sonicated in a bath-type sonicator (Tec 40, Tecsonic, Switzerland) for 1 min, stirred for 15 min at 4 °C, and freed of nonsolubilized membranes by centrifugation (300,000 × g; 4 °C; 1 h). Without delay, the pH of the extract was adjusted to 8.3 with 1 M acetic acid, mixed with Ni²⁺-nitrilotriacetic acid-agarose (Qiagen, GmbH, Germany; 3 ml of resin for the membrane extract from 1 g, wet weight, of cells; equilibrated with buffer C: 50 mM MOPS, pH 7.5, 300 mM NaCl, 10 mM -mercaptoethanol, 0.5% DM), and incubated for 1 h at 4 °C with gentle shaking. The slurry was transferred to a chromatography column, washed with 5 bed volumes of buffer C, and eluted stepwise with 10, 25, and 100 mM imidazole in buffer C. IICBA^GlcNAc eluted in the 100 mM imidazole step. The active fractions were pooled, supplemented with 10% glycerol (final concentration), shock frozen in liquid N₂, and stored at 80 °C. Protein concentrations were determined by a modified Lowry assay (Markwell et al., 1978) using bovine serum albumin as standard.

Phosphorylation of GlcNAc was assayed by the ion exchange method of Kundig and Roseman (1971) modified as described (Erni et al., 1982). The reaction mixture contained per 100 µl: 50 mM KPi, pH 7.5, 2.5 mM dithiothreitol, 2.5 mM NaF, 5 mM MgCl₂, 1 mM PEP (Sigma), 0.5 mM [¹⁴C]GlcNAc (New England Nuclear, 56.3 mCi/mmol, diluted to 1,000 dpm/nmol), 2 µl (20 µg) of a cytoplasmic extract as a source of soluble phosphoryl carrier proteins (enzyme I, HPr), and either the indicated amount of IICBA^GlcNAc plus 1 µg of phosphatidylglycerol (Sigma), or IICBA^GlcNAc in proteoliposomes prepared as described below. Incubation was for 30 min at 37 °C.

Purified IICBA^GlcNAc (75 µg in 0.5 ml) was dialyzed for 6 h against 2 × 500 ml of buffer D (50 mM KPi, pH 7.5, 2.5 mM dithiothreitol, 2.5 mM NaF) containing 0.75% octyl -D-glucopyranoside. 30 mg/ml E. coli L--phosphatidylethanolamine (type IX, Sigma) was suspended in buffer D containing 0.75% octyl -D-glucopyranoside and briefly sonicated in a bath-type sonicator. 0.5 ml of IICBA^GlcNAc was mixed with 0.5 ml of phosphatidylethanolamine/detergent solution (lipid/protein molar ratio 37,870:1), vortexed for 30 s at room temperature, and briefly sonicated. Octyl glucoside was removed by dialysis against 500 ml of buffer D without detergent-containing SM-2 Bio-Beads (Bio-Rad) (3 mg/ml). Dialysis was for 24 h with four buffer changes. 0.25-ml aliquots of proteoliposomes were shock frozen in liquid N₂ and stored at 80 °C.

Proteoliposomes were loaded with PEP, cytosolic PTS proteins, and with 0.5 mM L-[³H]Glc (45,000 dpm/nmol) as aqueous phase marker. A 250-µl aliquot of proteoliposomes was thawed at room temperature, and MgCl₂, Mg²⁺-PEP, enzyme I, and HPr were added to a final concentration of 1 mM, 10 mM, 0.1 µM, and 0.1 µM, respectively. The mixture was sonicated for 45 s in a bath-type sonicator. The sonicated proteoliposomes were freeze-thawed six times (liquid N₂/room temperature water bath) and sonicated for 20 s in a bath-type sonicator. The proteoliposomes were separated from free components by gel filtration on Sephacryl S-300 (Pharmacia; 12-ml bed volume, buffer D). The peak liposome-containing fractions were pooled. To measure GlcNAc uptake, the proteoliposomes were diluted 10-fold in buffer D and incubated at 30 °C for 15 min with ADP (2 mM, Serva) and pyruvate kinase (25 µg, Fluka) to destroy residual external PEP. The import reaction was started by adding [¹⁴C]GlcNAc (New England Nuclear, 5.0 mCi/mmol) to the desired concentration. 50-µl aliquots were withdrawn at the indicated time points, diluted into 1 ml of ice-cold buffer D, and immediately filtered through nitrocellulose membrane filters (ME24, Schleicher & Schuell, 0.2-µm pore size). The filters were washed with 2 × 1 ml of buffer D, and the radioactivity retained on the filters was determined by liquid scintillation counting. To measure the concomitant formation of GlcNAc-6P, 50-µl aliquots were diluted into buffer D containing 0.2% Triton X-100, and GlcNAc-6P was separated from free GlcNAc by anion exchange chromatography (Erni et al., 1982).

250-µl aliquots of proteoliposomes were loaded with 1 mM [¹⁴C]GlcNAc and L-[³H]Glc as marker for nonspecific leakage and purified as described above. To 1:10 diluted proteoliposomes from the peak fractions, MgCl₂, enzyme I, and HPr were added to final concentrations of 10 mM, 0.1 µM, and 0.1 µM, respectively. The export reaction was started by adding PEP to a final concentration of 5 mM. 50-µl aliquots were withdrawn at different time points, and the radioactivity retained in the vesicles as well as the formation of GlcNAc-6P were measured as described above. To measure competition between vectorial export and non-vectorial phosphorylation, 5 and 10 mM [¹²C]GlcNAc was added to the external compartment together with enzyme I and HPr. The reaction was started by the addition of PEP (10 mM) at 37 °C, and 50-µl aliquots were analyzed as indicated above.

20 µl of incubation mixture in buffer E (50 mM NaPi, pH 7.5, 10 mM MgCl₂, 2.5 mM dithiothreitol, 2.5 mM NaF) contained 18 pmol of purified IICBA^GlcNAc reconstituted in phosphatidylethanolamine vesicles, 10 pmol of purified HPr, and 4 pmol of enzyme I. The reaction was started by adding 400 pmol of [³²P]PEP (39 cpm/pmol, 80 pmol/µl) at 37 °C. After a 5-min incubation, the reaction was stopped with 1 ml of ice-cold buffer E, proteins were adsorbed to cellulose nitrate filters (Sartorius) under suction, the filters were washed twice with 1 ml of buffer E, and the filter-bound radioactivity determined by liquid scintillation counting (Buhr et al., 1994). Where indicated, proteoliposomes were treated prior to phosphorylation with trypsin with and without 2% Triton X-100 (25 µg/ml trypsin, room temperature, 15 min; proteolysis was stopped by adding phenylmethanylsulfonyl fluoride to 3 mM final concentration). [³²P]PEP was prepared as described by Roossien et al. (1983).

IICB^Glc was solubilized and purified by Ni²⁺ chelate affinity chromatography in the presence of 0.2% DM and IIC^Man·IID^Man in the presence of 0.02% dodecyl maltopyranoside (Waeber et al., 1993; Huber, 1996). Reconstitution and all subsequent procedures were done exactly as described above for IICBA^GlcNAc.

RESULTS AND DISCUSSION

Exploratory experiments indicated that IICBA^GlcNAc, like the transporters for mannose and glucose, could be purified by isoelectric focusing. However, the yield and purification were not satisfactory. To facilitate purification nagE was cloned under the control of the inducible Ptac promoter, and the carboxyl terminus of the protein was extended with a hexahistidine tag for purification by metal chelate affinity chromatography (Fig. 1A). 95% of the membrane-bound GlcNAc phosphotransferase activity could be solubilized in 2% DM at pH 9.3. Besides DM, octyl glucoside was also satisfactory, whereas Triton X-100 and pentaethylene glycol octyl ether incompletely solubilized the activity. IICBA^GlcNAc could be eluted with 100 mM imidazole in 50 mM MOPS, 300 mM NaCl, pH 7.5. 80% of the phosphotransferase activity present in the membranes was recovered, and the protein was more than 95% pure as judged by polyacrylamide gel electrophoresis (Fig. 1B). Approximately 4 mg of purified IICBA^GlcNAc was obtained from 10 g, wet weight, of cells.

Purified IICBA^GlcNAc was reconstituted with E. coli phospholipids by the -octyl glucoside detergent dialysis method based on the dilution procedure of Racker et al. (1979). The IICB^Glc subunit of the glucose transporter and the IIC^Man·IID^Man complex of the mannose transporter could be reconstituted by the same method. SM-2 Bio-Beads were added in the dialysis buffer to facilitate the removal of detergent and reduce the dialysis time and number of buffer changes (Philippot et al., 1988). The preformed, concentrated proteoliposomes were loaded by freeze/thaw sonication with either [¹⁴C]GlcNAc, or PEP, enzyme I, and HPr. [³H]LGlucose was added as a marker to measure the included aqueous space and to control the impermeability of the proteoliposomes. The loaded proteoliposomes were separated from nonincluded components by gel filtration chromatography. The uranyl acetate-stained vesicles obtained after gel filtration had diameters between 150 and 450 nm (electron micrographs not shown). The internal volume of the vesicles is approximately 0.8 µl/mg phospholipid as calculated from the amount of L-[³H]Glc coeluting with the proteoliposomes from the gel filtration column.

The orientation of membrane proteins in the bilayer depends on the method by which proteoliposome are formed (Levy et al., 1990, 1992). The orientation of IICBA^GlcNAc was determined by phosphorylation, exploiting the fact that the IIA and IIB domains are surface-exposed but covalently linked to the transmembrane IIC domain and can specifically be phosphorylated by HPr and enzyme I.

IICBA^GlcNAc was phosphorylated before and after detergent solubilization. Twice as much IICBA^GlcNAc is phosphorylated in the presence of Triton X-100, indicating that only 50% is accessible in intact proteoliposomes (Table I). When the intact proteoliposomes were first treated with trypsin, phosphorylation was strongly reduced. When the trypsin-treated proteoliposomes were solubilized, about 50% of the total protein could again be phosphorylated (Table I). Phosphorylation after proteolytic digestion of IICBA^GlcNAc confirmed that only half of the IICBA^GlcNAc molecules in intact liposomes were accessible to trypsin, consistent with an approximately equal number of IICBA^GlcNAc molecules facing each direction.

Table I. Random orientation of IICBAGlcNAc in proteoliposomes IICBAGlcNAc in proteoliposomes was phosphorylated with [32P]PEP in the presence of enzyme I and HPr. The reaction was carried out with intact proteoliposomes and after detergent solubilization. Prior to phosphorylation, from each preparation one aliquot was treated with trypsin to destroy accessible IIA and IIB domains. [32P]IICBAGlcNAc was analyzed by quantitative binding to nitrocellulose filters. For details see ``Materials and Methods.'' I II III IV Triton X-100 (first)   +     Trypsin     + + Triton X-100 (second)       + Phosphorylation (with [32P]PEP) + + + + [32P]IICBAGlcNAc (pmol on filter) 34.8 ± 1.6 60.6 ± 14 10.9 ± 0.4 36.5 ± 2

A unique direction of transport was imposed on randomly incorporated IICBA^GlcNAc by the addition of PEP and the cytosolic phosphoryl carrier proteins enzyme I and HPr to the inside and the substrate [¹⁴C]GlcNAc to the outside of the vesicles. Vectorial transport and phosphorylation take place in a 1:1 stoichiometry (Fig. 2A). The K_m is 66.6 ± 8.2 µM and the turnover number 6.2 ± 0.7 s¹, as calculated from the concentration dependence of GlcNAc transport and taking into account that only 50% of IICBA^GlcNAc is correctly oriented (Fig. 2, B-D). From the amount of imported [¹⁴C]GlcNAc (Fig. 2A) and the aqueous space in the liposomes an internal GlcNAc-6P concentration of 2 mM can be calculated. This is the minimum estimate on the assumption that the total aqueous space is accessible to GlcNAc. GlcNAc-6P is concentrated 40 × more than the external concentration of 50 µM.

When GlcNAc and the cytosolic components are both added to the outside, non-vectorial phosphorylation but no transport is observed. Non-vectorial phosphorylation is concentration-dependent with a K_m of 750 ± 19.6 µM and k_cat of 15.8 ± 0.9 s¹ (Fig. 3, A-C). The K_m for non-vectorial phosphorylation is 10 times higher than for vectorial transport. This result will be further discussed below.

If proteoliposomes are loaded with [¹⁴C]GlcNAc and the cytosolic proteins are added to the outside, inside-out transport can be measured. The imposed orientation allows to manipulate the system from the ``cytosolic face.'' However, only qualitative changes can be monitored. The system is of limited value for the quantitative determination of kinetic parameters because intravesicular GlcNAc is depleted quickly. The rapid extrusion of GlcNAc is strictly coupled to phosphorylation, and there is no diffusion of GlcNAc through the phospholipid layer and no facilitated diffusion via the unphosphorylated carrier (Fig. 4).

As demonstrated above, IICBA^GlcNAc catalyzes two reactions: vectorial transport with concomitant phosphorylation, and non-vectorial phosphorylation. The k_cat/K_m values of the two reactions are 0.09 and 0.025 s¹ µM¹, respectively. This raises the question of whether the two reactions compete. Therefore the export of encapsulated [¹⁴C]GlcNAc was measured in the presence of increasing concentrations of external GlcNAc. GlcNAc inhibits transport of [¹⁴C]GlcNAc in a concentration-dependent manner (Fig. 5A). Concentrations of 5 and 10 mM inhibit the export by 40 and 55%, respectively. Because no competition was observed in previous experiments with the mannose transporter of the bacterial phosphotransferase system (Mao et al., 1995), these experiments were repeated. For comparison they were also done with the glucose transporter IICB^Glc·IIA^Glc. The two transporters were purified by metal chelate affinity chromatography (Waeber et al., 1993; Huber, 1996), reconstituted by octyl glucoside dialysis, and loaded with [¹⁴C]Glc exactly as IICBA^GlcNAc. Consistent with the observation of Mao et al. (1995) and in striking contrast to IICBA^GlcNAc, the transport activity of IIAB^Man·IIC^Man·IID^Man is not inhibited by external glucose (Fig. 5B). Glucose transport by the IICB^Glc·IIA^Glc complex, on the other hand is inhibited exactly as IICBA^GlcNAc (Fig. 5C).

The transporter for GlcNAc is the fourth membrane transporter of the bacterial phosphotransferase system that has been purified to homogeneity (Jacobson et al., 1979; Erni et al., 1982; Erni and Zanolari, 1985). IICBA^GlcNAc could be purified in a single step by metal chelate affinity chromatography. This method appears generally suitable for the purification of phosphotransferase transporters (Waeber et al., 1993; Huber, 1996), possibly because these proteins have large hydrophilic domains to attach to the histidine tag. This can be visualized with the x-ray structure of the IIA domain of the Bacillus subtilis glucose transporter (Liao et al., 1991), to which IIA^GlcNAc is homologous. The carboxyl terminus is exposed on the protein surface, at 21 Å from the amino terminus and 23 Å from the active site His⁸³ (equivalent to His⁵⁶⁹). Over these distances, the His tag is unlikely to interfere with docking between the IIA active site and either HPr or the IIB domain. Indeed, the carboxyl-terminal His tag does not affect the phosphotransferase activity of IICBA^GlcNAc. Phosphorylation of substrates without transport was first observed in vivo (Thompson and Chassy, 1985; Thompson et al., 1985; Nuoffer et al., 1988) and was also found after reconstitution of the transporters for mannitol and mannose (Elferink et al., 1990; Mao et al., 1995). In all cases the K_m for transport is lower than for non-vectorial phosphorylation. This difference (66 µM versus 750 µM for IICBA^GlcNAc) suggests that phosphotransferase transporters have different affinities depending on what side of the membrane the binding site is oriented to (assuming that the transporter has only one substrate binding site that can isomerize between inward and outward orientations).

Of particular interest is the difference between IICBA^GlcNAc and IICB^Glc·IIA^Glc on the one hand and IIAB^Man·IIC^Man·IID^Man on the other hand with respect to competition between transport and non-vectorial phosphorylation. To our knowledge this is the first experiment that indicates that the two families of PTS transporters have not only different structures but that they also function differently. The homologous IICBA^GlcNAc and IICB^Glc·IIA^Glc are homodimeric complexes of narrow specificity. The transphosphorylation reaction proceeds through a phosphohistidine and a phosphocysteine intermediate. The IIAB^Man·IIC^Man·IID^Man complex has a broad substrate specificity (including Glc, Man, GlcNAc), and transphosphorylation proceeds through two phosphohistidine intermediates. It is a heterooligomer composed of two membrane-spanning subunits (stoichiometry 1:2) and a hydrophilic complex of two structurally interwined polypeptide chains (Nunn et al., 1996). The mechanistic basis of this differences remains to be discovered.