INTRODUCTION

Thioredoxins and glutaredoxins are small heat-stable proteins with thioltransferase activity. Both proteins were initially discovered as hydrogen donors for ribonucleotide reductase, an enzyme that provides the precursors for DNA synthesis by reducing ribonucleotides to their corresponding deoxyribonucleotides. These proteins supply ribonucleotide reduction with electrons from NADPH transferred via specific reduction mechanisms. Thus, the thioredoxin system includes NADPH, the flavoprotein thioredoxin reductase, and thioredoxin. The glutaredoxin system is composed of NADPH, the flavoprotein glutathione reductase, GSH, and glutaredoxin. Thioredoxin and glutaredoxin each contain two reversibly oxidizable cysteine residues in their active site. The active site regions of these proteins, which are located close to their N termini, are highly conserved among different species, with the consensus sequence of Cys-Gly-Pro-Cys for thioredoxin and Cys-Pro-Tyr-Cys for glutaredoxin (1).

Thioredoxins and glutaredoxins are ubiquitous proteins. They have been identified in such diverse organisms as Escherichia coli (2), mammals (3, 4), yeast (5), plants (6), and viruses (7). However, the biological roles of these redox proteins in a cell are not limited to their function as ribonucleotide reductase cofactors. Some glutaredoxins from mammalian sources are unable to act as an electron carrier in homologous ribonucleotide reductase systems (8). This observation indicates that glutaredoxins, as well as thioredoxins, may be involved in some other cellular processes. Studies of thioredoxins and glutaredoxins in many organisms have revealed a variety of different functions that these proteins may fulfill in a cell. For instance, thioredoxin with thioredoxin reductase serves as an efficient electron donor for human plasma peroxidase and for bacterial methionine sulfoxide reductase (9, 10). Thioredoxins and glutaredoxins have important roles in the life cycles of diverse viruses. Specifically, thioredoxin is essential for the assembly of the filamentous phages f1 and M13 (11). Phage T7 incorporates E. coli thioredoxin as a subunit of phage-encoded DNA polymerase (12). A cellular thioredoxin is the hydrogen donor for the herpes simplex virus type 1-encoded ribonucleotide reductase (13). Two groups of large DNA viruses encode their own redox proteins. Vaccinia virus encodes a functional glutaredoxin, which is expressed postreplicatively and is packaged in the virions (7) but which evidently does serve as a viral ribonucleotide reductase cofactor (14). Phage T4 encodes ribonucleotide reductase and a phage thioredoxin, the product of the gene nrdC. This thioredoxin is of particular interest, since it is active in both thioredoxin reductase and glutathione systems (15). Thus, the NrdC protein is now usually called T4 glutaredoxin.

It appears that all cellular life forms encode multiple redox proteins. A thioredoxin and three glutaredoxins have been experimentally identified in E. coli (16), and several other putative redox proteins have been predicted by sequence analysis (17). The 1.83-Mb genome of Haemophilus influenzae that has recently been completely sequenced (18) contains 13 genes for putative thioredoxins and glutaredoxins (19), whereas the ``minimal,'' 0.58-Mb genome of Mycoplasma genitalium (20) encompasses 2 genes for small redox proteins (21). There are at least 2 thioredoxin genes in the yeast genome. In the double mutant lacking these 2 genes, DNA replication is impaired due to the loss of redox activity (22).

In contrast, there is no indication thus far that any of the completely sequenced virus genomes may encode more than one functional thioredoxin or glutaredoxin. Here we report that phage T4 encodes a second active glutaredoxin, which is distantly related to the nrdC gene product.

MATERIALS AND METHODS

The entire coding sequence of the Y55.7 open reading frame was amplified by polymerase chain reaction using total T4 phage DNA as a template. Based on the published sequence, the following primers were designed for polymerase chain reaction amplification of the sequence: primer 5Y55.7 (ATGTGAAACAAAATAAGAT, site Ehe1 underlined) and primer 3Y55.7 (antisense) (GCTTAATCTTCTATGATATC, site BamHI underlined). Twenty-five cycles of amplification were used with annealing at 55 °C. The amplified DNA fragment of the expected size of ~300 base pairs was gel-purified, digested with Ehe1 and BamHI, and cloned into expression vector pProEX-1 (Life Technologies), resulting in the plasmid pGRX2. The identity of the insert was confirmed by nucleotide sequencing. The chosen expression vector has a sequence coding for six His codons, facilitating purification of the recombinant protein. A tobacco etch virus (TEV)¹ proteinase cleavage site located downstream from the His tag allows one to cleave off the His tag after protein expression and purification. The E. coli strain BL21(DE3), a  lysogen carrying the gene for the T7 RNA polymerase under the control of the inducible P_L promoter, was transformed with pGRX2, and expression of the Y55.7 protein was induced with 0.5 mM isopropyl -D-thiogalactopyranoside for 3 h. The protein was purified on a Ni²⁺-NTA agarose (Qiagen, Chatsworth, CA) column according to the manufacturer's manual. From 250 ml of induced culture, approximately 3 mg of purified recombinant protein were obtained. After purification, the His tag was cleaved off with TEV proteinase, and the protein was repurified on the column to remove the His tag and proteinase, which was also His-tagged.

The T4 nrdC gene encoding T4 glutaredoxin was amplified by polymerase chain reaction with total T4 DNA as a template. Primers used were as follows: 5NRDC, GGTTAAAGTATATGG (NcoI site underlined); and 3NRDC (antisense), GCTTTAAAGTATTTCC (BglII site underlined). The polymerase chain reaction product was ligated into pQE-60 vector (Qiagen), and the resulting construct harboring the full length nrdC gene was transformed into the JM109 E. coli strain. NrdC protein was purified on a Ni²⁺-NTA agarose column according to the manufacturer's manual (Qiagen).

An E. coli strain carrying cloned genes for both subunits of the T4 aerobic ribonucleoside diphosphate reductase was a gift from Dr. G. R. Greenberg's laboratory. Induction and purification of the protein were performed as described by Tseng et al. (23).

About 200 mg of the protein was emulsified with Titer Max adjuvant (Sigma) and injected into a New Zealand White rabbit both intramuscularly and subcutaneously. The serum was collected 5 weeks postinjection. Antiserum and preimmune serum were tested by immunoblotting.

Uninfected E. coli and T4-infected E. coli proteins were labeled in vivo by using the Express protein-labeling mixture (DuPont NEN) at the specific activity of 1175 Ci/mmol. A 100-ml culture of E. coli B was grown at 37 °C in M9 medium and infected at a density of 3 × 10⁸ cells/ml at 10 phages/cell. Phage proteins were labeled with a total of 250 µCi of [³⁵S]methionine/cysteine from 3 to 18 min postinfection. Cells were rapidly chilled and pelleted at 8000 rpm. Uninfected E. coli cells were labeled similarly, except that the labeling period was 30 min. The cell pellet was lysed by sonication in 1.0 ml of buffer, containing 50 mM Tris·HCl (pH 8.0), 150 mM NaCl, and 1% Nonidet P-40. Labeled cell extracts were used for immunoprecipitations.

Immunoprecipitations were performed as follows: 20-50 µl of labeled proteins were incubated with 5 µl of antiserum in 0.5-1.0 ml of sonication buffer. Incubation was performed at 4 °C for 1 h. After the incubation, 50 µl of 50% Protein A-Sepharose equilibrated in the same buffer was added, and incubation was continued for 1 h longer. Immune complexes were harvested by centrifugation at 10,000 rpm. The pellet was washed three times with the sonication buffer, and immunoprecipitated proteins were resolved by electrophoresis on 15% sodium dodecyl sulfate-polyacrylamide gel. Gels were fixed, dried, and exposed to x-ray film.

Proteins were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to Immobilon-P transfer membrane (Millipore). Bound antibody was exposed to the secondary antibody, labeled with alkaline phosphatase.

Glutathione reductase-coupled assays were performed at room temperature in 50 mM HEPES buffer at pH 8.0, 1 mM EDTA, 0.25 mM NADPH, 1 mM GSH, 2 units of yeast glutathione reductase, and appropriate dilutions of the Y55.7 protein. The reaction was initiated by addition of one of the following substrates: 0.5 mM -hydroxyethyl disulfide or 2.5 mM L-cystine for thioltranferase activity; or 1 mM dehydro-L-ascorbate for reductase activity. A decrease in the absorbance (A) of NADPH at 340 nm was monitored for 10-15 min. One unit of activity was defined as 1 µmol of NADPH consumed per min and was calculated from the expression

(Eq. 1)

where 6.2 is the millimolar extinction coefficient for NADPH and V is the reaction volume (15).

The oxidation of NADPH at 340 nm in the reaction mixture containing GSH, yeast glutathione reductase, and either recombinant T4 thioredoxin or Y55.7 protein as ultimate hydrogen donors for ribonucleotide reductase was followed spectrophotometrically (15). Typically, 250 µl of the reaction mixture contained 1 mM GSH, 1 unit of glutathione reductase, 0.3 mM NADPH, 50 mM HEPES, 1 mM CDP, 1 mM ATP, and 2 mM MgCl₂. Ribonucleotide reductase (25.5 µg) and appropriate dilutions of either Y55.7 protein or T4 glutaredoxin were added to the reaction. Protein concentration was determined as described by Bradford (24).

Protein Sequence AnalysisData base searches for protein sequence similarity were performed with the BLASTP program (25). Pairwise sequence alignments were constructed with the ALIGN program (26). Protein secondary structure was predicted with the PHD program (27, 28).

RESULTS AND DISCUSSION

In an attempt to detect putative additional redox proteins encoded in the bacteriophage T4 genome, we compared the amino acid sequence of the NrdC protein with those of all other T4 gene products. The highest similarity was observed with the product of open reading frame Y55.7, which consists of 102 codons and is located between genes 25 and sunY on the T4 phage genomic map (29). The two protein sequences contain 21% identical amino acid residues and 40% conservative substitutions; the 2 cysteines comprising the redox active site in NrdC are conserved in Y55.7 (Fig. 1). The similarity between T4 glutaredoxin and Y55.7 was not statistically significant when the complete nonredundant protein sequence data base was searched, and no similarity between Y55.7 and any other thioredoxins or glutaredoxins was detected (data not shown). Nevertheless, the conservation of the redox cysteines, the similar size of the two proteins, and the obvious similarity between the predicted secondary structure of Y55.7 and the secondary structure of NrdC known from its x-ray structure (Fig. 1) suggest that Y55.7 may be a second T4 thioredoxin (glutaredoxin). Similar observations have been made previously based on modeling the putative three-dimensional structure of Y55.7 on the NrdC structure, but attempts to demonstrate the redox activity of Y55.7 have been unsuccessful (30).

Open reading frame Y55.7 has an upstream promoter sequence and a ribosome-binding (Shine-Dalgarno) site, indicating that it is likely to be expressed during infection (29). To examine the functional significance of the sequence similarity between Y55.7 product and thioredoxin, the recombinant protein was overexpressed and purified from E. coli cells. Induction of the transformed strain with isopropyl -D-thiogalactopyranoside resulted in the appearance of a prominent new band at the position expected for the recombinant protein (14 kDa). Purification of histidine-tagged Y55.7 protein was achieved by one-step chromatography on Ni²⁺-NTA resin and yielded several fractions of the protein with different ranges of purity (Fig. 2). The size of the recombinant polypeptide is higher than the size of the expected Y55.7 protein (about 12 kDa) due to the attached sequence of six histidines, a spacer arm, and the TEV proteinase cleavage site.

The cleanest fractions of the purified protein were treated with the TEV proteinase to cleave off the His tag and reapplied to the Ni²⁺-NTA column to remove the 6-His sequence and the proteinase. The resulting polypeptide, close to 100% purity (Fig. 2), migrated on sodium dodecyl sulfate-polyacrylamide gel at a position expected for the Y55.7 protein (about 12 kDa).

Since there was an indication that Y55.7 protein has no activity in enzyme assays with E. coli thioredoxin reductase (30), we tested the purified protein in a GSH-dependent system. Thioltransferase activity of Y55.7 was tested by adding increasing amounts of the protein to reaction mixtures containing L-cystine, GSH, glutathione reductase, and NADPH. As seen in Fig. 3, addition of increasing amounts of Y55.7 protein resulted in proportional increase in activity. Several different batches of the purified protein were active in this test. These results clearly demonstrate that purified Y55.7 protein has thioltransferase activity in a GSH-dependent system and thus should be considered as a glutaredoxin.

We also performed dehydroascorbate reductase activity assays involving NADPH, GSH, and yeast glutathione reductase, since several glutaredoxins have shown this activity as well (7). Purified recombinant T4 glutaredoxin (NrdC), which is also active in the NADPH/GSH-dependent system (15), was used in the same assays to compare the activities of both proteins. As seen from Table I, Y55.7 protein was active with -hydroxyethyl disulfide as well as with dehydro-L-ascorbate, thus demonstrating both thioltransferase and dehydroascorbate reductase activities. The levels of these activities were comparable to those of T4 glutaredoxin (NrdC) in the same assays.

Table I. Thioltransferase and dehydroascorbate reductase activities of Y55.7 protein and T4 NrdC in the coupled assay with NADPH, GSH, and glutathione reductase Activity Thioltransferase Dehydroascorbate reductase nmol NADPH oxidized/min/mg protein Y55.7 88 121 NrdC 124 176

T4 glutaredoxin (NrdC) is a hydrogen donor for T4 ribonucleotide reductase in the presence of NADPH, GSH, and glutathione reductase. This assay was developed by Holmgren (15), who has experimentally confirmed that the amount of oxidized NADPH in this reaction stoichoimetrically corresponds to the amount of newly formed [³H]dCDP. Therefore, the reaction may be followed spectrophotometrically at 340 nm by monitoring NADPH oxidation. On the basis of the above method, we tested purified Y55.7 protein for its ability to serve as a hydrogen donor for phage ribonucleotide reductase. Several different batches of glutaredoxin and ribonucleotide reductase preparations were used in these studies.

Purified T4 thioredoxin (NrdC) was used in these assays along with Y55.7 protein. As shown in Fig. 4, which represents averaged results from five experiments, Y55.7 protein can serve as hydrogen donor for phage ribonucleotide reductase.

To examine the expression of the Y55.7 protein during phage infection, phage-infected E. coli proteins were labeled with ³⁵S. Labeled cell extracts were used in immunoprecipitation experiments with Y55.7 protein-specific antiserum. The results presented in Fig. 5 indicate that the labeled 12 kDa band representing Y55.7 protein appears 3 min after infection and the labeled protein can be detected until 18 min after infection. The second prominent band in Lane 2 may represent an unidentified phage protein that interacts with Y55.7 during infection and thus coimmunoprecipitates with it. Labeled E. coli proteins from uninfected cells did not react with Y55.7 antiserum (data not shown).

This study, based on sequence similarity and biochemical experiments, indicates that in addition to the well characterized glutaredoxin, the T4 genome encodes a second functional redox protein. This protein, designated as Y55.7, is active in the NADPH/GSH system, demonstrating both thioltransferase and dehydro-L-ascorbate reductase activities. In the in vitro experiments, it was shown that Y55.7 protein can be a hydrogen donor for the purified phage ribonucleotide reductase. Immunoprecipitation experiments with labeled proteins from phage-infected bacteria indicated that the y55.7 gene is constitutively expressed in the phage life cycle. Thus, the T4 genome, similarly to cellular genomes, has more than one gene for a functional redox protein. Since the T4 genome encodes an additional ribonucleotide reductase (NrdD, previously referred to as SunY), which is active under anaerobic conditions (32), it is possible that the second glutaredoxin is required as a cofactor for this ribonucleotide reductase. However, this newly described phage glutaredoxin may have functions in the phage life cycle other than being a hydrogen donor for ribonucleotide reductase. An additional redox protein may be required for maintaining proper redox status of the infected cell during phage replication and assembly. On the other hand, it cannot be ruled out that, analogously to the role of thioredoxin in T7 replication (11), Y55.7 may have a function independent of its glutaredoxin activity.

We suggest the name Grx-2 for this newly described protein and Grx-1 for the nrdC gene product.

We recently found that vaccinia virus also also encodes a second redox protein, in addition to the previously characterized glutaredoxin encoded by the O2L gene.² Thus, the presence of 2 genes for thioredoxins (glutaredoxins) is a shared feature of two diverse virus systems. Elucidation of the actual roles of these redox proteins may shed light on important aspects of viral reproduction.