![]()
|
|
||||||||
(Received for publication, November 9, 1995, and in revised form, April 17, 1996)
From the Institute of Parasitology, McGill University, Ste. Anne de
Bellevue, Québec, Canada H9X 3V9
Leishmania donovani is a protozoan
parasite that exists as a free-living promastigote in the sandfly
insect vector and as an amastigote inside the mammalian host macrophage
phagolysosome compartment. The L. donovani A2 genes have
been described previously as developmentally expressed in amastigotes
but can be induced experimentally in promastigotes by a combination of
pH and temperature shifts, conditions that mimic the phagolysosomal
compartment of the macrophage cell. Considering the importance of the
amastigote stage in human infections, we have examined the molecular
basis for amastigote stage-specific gene expression. Our results
provide evidence that A2 developmental expression during the
promastigote-to-amastigote cytodifferentiation is mediated through
differential RNA stability and involves the A2 mRNA 3 Leishmania is a dimorphic protozoan that is responsible
for a large spectrum of diseases in humans, ranging from self-curing
skin ulcers to the severe pathologies associated with visceral
leishmaniasis. This protozoan parasite exists as a flagellated
promastigote in the sandfly vector, then as an intracellular amastigote
in the mammalian host. The cytodifferentiation from the promastigote to
the amastigote form occurs in the phagolysosomal compartment of the
macrophage cell, and this transformation is a prerequisite for parasite
survival. Amastigotes multiply within the mammalian host macrophages,
and this stage of the life cycle is therefore responsible for the
pathologies associated with leishmaniasis (for review, see Molyneux and
Killick-Kendrick (1987) The Leishmania donovani A2 genes have been characterized
previously as amastigote-specific (Charest and Matlashewski, 1994 To define the molecular mechanisms involved in the developmental
expression of A2 transcripts in Leishmania during the
promastigote-to-amastigote cytodifferentiation, the arrangement of the
A2 genes within the L. donovani genome was determined. DNA
sequences flanking the A2 protein coding region were then tested for
their ability to modulate a developmental expression of reporter genes
in transfected L. donovani cells. Transfection assays
demonstrated that the 3 L. donovani
donovani Sudanese 1S2D and L. donovani infantum
Ethiopian LV9 promastigotes were cultured at 26 °C in RPMI 1640 medium (Life Technologies, Inc.) supplemented with 10% defined
heat-inactivated fetal bovine serum (HyClone Laboratories Inc., Logan,
UT) and 20 mM HEPES, pH 7.3. LV9 amastigotes were purified
from infected Gold Syrian hamsters and passaged as described previously
(Charest and Matlashewski, 1994 Total RNA was
extracted from promastigotes by the phenol-chloroform-guanidinium
isothiocyanate method using RNAzol (Cinna/Biotecx Laboratories
International, Inc., Friendswood, TX) or TRIzol (Life Technologies,
Inc.) reagents. Total DNA and chromosomal DNA samples were prepared
from promastigotes according to standard protocols (Sambrook et
al., 1989 To amplify 5 Agarose gel-purified PCR products were inserted into the pCR-script
SK(+) cloning vector (Stratagene) using the manufacturer's protocol
and reagents; recombinant plasmids were identified by colony
hybridization analyses (Sambrook et al., 1989 A plasmid containing the 3
Plasmid insert maps are depicted in Fig. 2B. In NEO T, NEO P, NEO P(
Methods for stable transfections and
selection of clones were derived from established
protocols2 (Beverley and Clayton, 1993 Assays were performed as described
previously for Leishmania cells (Brandau et al.,
1995 A2
gene expression was induced in wild type and transfected promastigotes
in the following manner. Promastigotes maintained in RPMI 1640, 10%
fetal bovine serum, pH 7.3 and 26 °C, were grown to late log phase
(107/ml), harvested by centrifugation (1,500 × g, 10 min), and resuspended in the above medium at 37 °C
containing 20 mM succinate (final pH at 4.5), conditions
that mimic the phagolysosomal compartment of the macrophage cell. As a
control for conditions that do not induce A2 expression, harvested
promastigotes were also transferred into fresh culture medium at pH 7.3 and at 26 °C.
For the mRNA stability assays, promastigotes maintained at pH 7.3, 26 °C, were transferred to medium at 37 °C and pH 4.5 or pH 7.3 and allowed to adapt for 30 min before the addition of 10 µg/ml
actinomycin D (Sigma). Under these conditions, A2 gene
expression is induced in promastigotes at pH 4.5, but not in
promastigotes at pH 7.3 (Charest and Matlashewski, 1994 Preliminary
characterization of the A2 multigene family organization in L. donovani infantum LV9 suggested an arrangement in tandem arrays
and polymorphism among gene copies (Charest and Matlashewski, 1994 Southern blot analyses with a XbaI/XhoI double
digest (X/O, Fig. 1B; refer to Fig. 1A
for probes) clearly showed that the repeated region within the A2 gene
was responsible for most of the restriction fragment length
polymorphism observed with other restriction digests. Analysis of the
XbaI/XhoI double digest with probe E, which
delineated the A2 coding regions, revealed a ladder of hybridization
bands ranging from 1.6 to 3.0 kb. Similarly, other restriction
fragments that contained this portion also produced a ladder of several
hybridization bands. However, hybridization with fragment A as a probe
revealed only a doublet band at around 3.4 kb, suggesting that A2
copies were indeed arranged similarly within the genome. Thus, the
polymorphism was confined to the A2 coding regions. Restriction
patterns and karyotypes were compared for two L. donovani
strains used in this study: the infective L. donovani
infantum Ethiopian LV9 strain, from which the A2 cDNAs and
genomic clones were derived, and L. donovani donovani
Sudanese 1S2D, the noninfective strain used for subsequent transfection
assays. The A2 gene loci showed a high degree of conservation between
L. donovani LV9 and 1S2D strains. All of the A2 copies in
both strains were contained on a 850-kb chromosome (Fig.
1C).
Northern blot analyses using the fragment B as a probe revealed another
RNA encoding region (termed A2rel, 2.3 kb) lying between A2 sequences
on genomic clone Geco 90. We compared the expression pattern of A2 and
A2rel transcripts in promastigotes induced for an A2 developmental
expression. We showed previously that a combination of temperature and
pH shifts (26 °C, pH 7.3, to 37 °C, pH 4.5), conditions mimicking
the transfer from the insect vector to the phagolysosomal compartment
of the mammalian host macrophage cell, induces in cultured
promastigotes full expression of A2 mRNAs within 10 h (Charest
and Matlashewski, 1994 To define the sequences
involved in A2 developmental expression, it was first necessary to map
precisely the 5 The 5 The genomic
organization of A2 genes in L. donovani is outlined in Fig.
2A. As demonstrated in previous sections, the polymorphism
observed among A2 gene copies is restricted to the A2 protein coding
regions, whereas untranslated regions were well conserved among gene
copies. Based on RNA mapping results, the A2 open reading frame (ORF
II) on the A2 mRNA is preceded by a 214-bp 5 A series of plasmids in which the neo gene was combined with
5 For each plasmid construct, polyclonal populations of stably
transfected cells were established and analyzed for the differential
expression of neo/A2 chimeric transcripts by Northern blot
analyses. Polyclonal populations were used, rather than cloned cell
lines, to average out variations that may have been displayed by
selected clones. The relative abundance of neo mRNAs was
compared in recombinant promastigotes cultured at 26 °C, pH 7.4, or
transferred into phagolysosomal conditions at 37 °C and pH 4.5 for
10 h to induce full expression of A2 in cells. Results from the
Northern blot analysis with the neo gene as a probe are
presented in Fig. 3A. Duplicate membranes
hybridized with A2 gene-specific probes confirmed that the reporter
neo transcripts carried relevant sequences from the A2 5
Initially, these experiments were carried out with the plasmid
constructs that lacked the pyt element at the end of the 3 The expression patterns of the A2 genes arising from chromosomal copies
in transfected cells were masked by the high abundance of
episome-derived neo/A2 chimeric transcripts (Fig.
3B). This clearly demonstrated that plasmid-derived A2
chimeric transcripts were much more abundant than were
chromosome-derived A2 transcripts. To determine whether the high levels
of plasmid-derived transcripts carrying A2 sequences could influence
the developmental expression of A2 chromosomal genes, a Northern blot
analysis was performed with an A2/ORF II probe to reveal only
chromosome-derived A2 transcripts. As shown in Fig. 3C, A2
gene developmental expression was still observed in induced NEO T The
size of the neo transcripts derived from plasmids NEO T
We have also mapped the 5 The preceding data demonstrate that A2 3 We have begun to examine the molecular mechanism
involved in A2 developmental expression under phagolysosomal
conditions. Using nuclear run-on analysis, we assessed the RNA
synthesis rates on the A2 and A2rel genomic loci. For this experiment,
A2rel served as a control for constitutive gene expression. Nuclei were
isolated from promastigotes cultured at 26 °C, pH 7.4, and from
promastigotes incubated at 37 C, pH 4.5, and incubated in the presence
of [32P]UTP to allow elongation of transcripts. The
radiolabeled nascent RNAs were extracted and used to probe the A2 and
A2rel gene sequence. As shown in Fig. 5, there was no
change in A2 or A2rel RNA synthesis in promastigotes incubated at
37 °C, pH 4.5, compared with promastigotes incubated at 26 °C, pH
7.4. These results demonstrate that neither the A2 nor the A2rel gene
is under transcriptional control.
We next tested the possibility that the A2 3 The stability of the neo/A2 mRNAs was compared in
recombinant promastigotes incubated under promastigote conditions
(neutral pH) or under phagolysosomal conditions (acidic pH). In these
assays, promastigotes carrying plasmids NEO T
In the
previous sections it was demonstrated that the developmental expression
of neo/A2 chimeric mRNAs relied on processing of the A2
3
Northern blot analyses were performed to determine whether the
integrated neo gene could be expressed developmentally. As
shown in Fig. 7D, the neo/A2 chimeric transcripts
were expressed developmentally following induction by pH and
temperature shifts for both the R1 and R2 cell lines. The sizes of
transcripts corresponded to a processing similar to transcripts from
the A2 locus. The neo transcripts in R2 cells were slightly
larger than in R1 cells, a result consistent with the presence of the
pyt element in the mRNA. As for plasmid-derived transcripts, this
artificial trans-splicing acceptor site added between the
Pro fragment and the neo gene was not used for RNA
processing. These data demonstrate that the A2-A2rel intergenic region
could mediate the developmental expression of the neo gene
when targeted into the A2 locus.
We have previously isolated and characterized the A2 gene by
virtue of its developmental expression in the amastigote stage of the
L. donovani parasite, the causative agent of visceral
leishmaniasis. A2 transcripts are expressed in infected macrophages,
and expression can be induced experimentally in promastigotes by pH and
temperature shifts, conditions mimicking the passage from the insect
vector to the phagolysosome environment (Charest and Matlashewski,
1994 The A2 gene system represents an excellent model to study regulation of
amastigote stage-specific gene expression in Leishmania
cells. The key advantage for this system is that the A2 gene can be
induced experimentally in promastigotes by culturing them under
phagolysosomal conditions. Several major observations have been made in
this study. Of particular significance, it was demonstrated that both
the A2 mRNA 3 During this study, we have examined wild type A2 expression as well as
expression of neo/A2 chimeric transcripts derived from
plasmid constructs and from gene replacement constructs. It was of
interest to compare the level of induction of the wild type A2
transcripts with the neo/A2 chimeric transcripts under
phagolysosomal conditions. The level of endogenous wild type A2
transcript induction in phagolysosomal conditions was variable between
experiments but was at least 10-fold. In comparison, the
neo/A2 chimeric transcript derived from the gene-targeted
construct had a 10-fold induction, and from the plasmid constructs NEO
T This is the first study carried out in Leishmania which
directly compared the involvement of noncoding 5 Gene expression in trypanosomatid cells involves the maturation of
polycistronic precursor RNAs into monomeric units by
trans-splicing, a molecular process restricted to lower
eukaryotes (for review, see Bonen, 1993 We have also characterized the A2 locus and shown that the A2 genes
were arranged in tandem repeats, alternating with copies of the A2rel
gene. Although A2 transcripts could be induced by temperature and pH
shifts, the A2rel transcript level remained constant. Since genes
repeated in tandem are often part of the same transcriptional unit in
Leishmania (Bock and Langer, 1993 It is noteworthy that in the RNA stability experiments, the increased
stability of the neo/A2 chimeric transcripts at pH 4.5 was
transient. One hour after the addition of actinomycin D, the
neo/A2 chimeric transcripts were degraded at similar rates
in cells cultured at pH 4.5 or 7.3. This argues that the factors
involved in the increased stability interacted rapidly in response to
the pH shift but were relatively short lived. A rapid turnover of these
factors when transcription was blocked with actinomycin D may have been
responsible for this effect. Future experiments must be carried out to
define the mechanism in which the 3 It was also demonstrated that in two strains of L. donovani
examined the A2 genes were located on a single chromosome of 850 kb.
Polymorphism within the A2 cluster was related to the protein coding
sequence, which is composed of repetitive units. We have now confirmed
that there is a family of A2-related proteins ranging from 45 to 100 Kd which are only present in the amastigote stage
(Zhang et al., 1996 We thank Drs. Ouellette and Papadopoulou for
the pSPY21 and pSPYneo plasmids and for the helpful discussions
concerning experimental approaches, as well as Dr. P. Ribeiro for
useful comments on the manuscript and S. Mongeau for secretarial
assistance.
Volume 271, Number 29,
Issue of July 19, 1996
pp. 17081-17090
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
-Untranslated Region*
,
-untranslated
region. The site of processing in the 3
-untranslated region was a
major factor for the accumulation of A2 mRNAs in cells incubated
under phagolysosomal conditions. The stability of reporter gene
transcripts bearing the A2 3
-untranslated region was increased in
cells incubated at low pH, further confirming the importance of pH
shift as an inducer for A2 expression. These observations contribute to
defining the mechanism of amastigote-specific gene regulation in
L. donovani. We also demonstrate the feasibility of using
the A2 locus to express heterologous genes differentially in the
amastigote form of the L. donovani parasite.
). Leishmaniasis is considered by the World
Health Organization to be one of the six major tropical diseases of
developing countries (World Health Organization, 1993
).
). The
corresponding A2 protein is comprised predominantly of a highly
conserved repetitive element and shares some characteristics with major
antigens expressed developmentally by pathological forms of several
other unrelated human parasites. Of particular relevance for this
study, we have shown that the expression of the A2 transcripts could be
induced experimentally in cultured promastigotes by a combination of
temperature and pH shifts, conditions that mimic the passage from the
insect vector to the phagolysosomal compartment of the macrophage cell
(Charest and Matlashewski, 1994
). The ability to induce A2 expression
in vitro, together with the ability to transform and express
exogenous DNA in Leishmania cells (Cruz and Beverley, 1990
;
Laban et al., 1990
; Coburn et al., 1991
; Curotto
de Lafaille and Wirth, 1992; Beverley and Clayton, 1993
) thus provides
a suitable experimental framework to examine the mechanism of life
cycle stage-specific gene expression in this protozoan.
-untranslated region
(3
-UTR1) of the A2 mRNA could mediate
a differential accumulation of reporter gene transcripts in L. donovani following induction of A2 expression by a combination of
temperature and pH shifts. Moreover, reporter genes integrated into the
A2 chromosomal locus by homologous recombinations showed the same
pattern of developmental expression as the A2 gene. Since stable DNA
transfection has only been reported thus far with the promastigote
stage in Leishmania, controlling gene expression using A2
untranslated sequences provides a unique system to allow amastigote
stage-specific expression of transfected heterologous genes.
Leishmania Strains and Culture Media
).
). Leishmania chromosomes were separated at
200 volts on a 1% agarose gel in 0.5 × TBE (1 × TBE is 45 mM Tris, 45 mM boric acid, 2 mM
EDTA) using a contour-clamped homogeneous electric field (CHEF)
apparatus (Bio-Rad); running conditions were an initial pulsed time of
40 s ramping to 120 s over a period of 35 h at 8 °C.
Southern and Northern blot analyses were carried out as described
previously (Charest and Matlashewski, 1994
; Descoteaux and
Matlashewski, 1989
). Hybridizations were performed in 50% formamide,
6 × SSC (1 × SSC consists in 0.15 M NaCl, 0.015 M sodium citrate), 5 × Denhardt's solution (1 × Denhardt's is 0.02% polyvinylpyrrolidone, 0.02% Ficoll, 0.02%
bovine serum albumin), 0.1% SDS, 200 µg/ml denatured salmon sperm
DNA for 18 h at 42 °C; or in 1 M NaCl, 1% SDS,
10% dextran sulfate for 18 h at 65 °C. The cDNA library
screening and in vivo excision of pBluescript plasmid
derivatives from recombinant
ZAP II phages were performed as
described previously (Charest and Matlashewski, 1994
). DNA probes were
prepared from agarose gel-purified fragments labeled with
[
-32P]dCTP (ICN; 3,000 Ci/mmol) by nick
translation.
and 3
Ends Using RT-PCR
ends
of both A2 and A2rel transcripts, LV9 amastigote RNA was used as a
template for RT-PCR. Reverse transcription steps were performed with
SuperScript RNase H
reverse transcriptase (Life
Technologies, Inc.) following the manufacturer's protocol (10 µg of
total RNA/reaction). The PCRs were carried out using Tth polymerase
(Pharmacia Biotech Inc.) and a GeneAmp 9600 Thermocycler apparatus
(Perkin-Elmer Corp.); a quarter of the RT reaction was used as a
template in PCRs. Annealing steps were carried out at 40 °C (2 min)
for the first 20 cycles, and then the temperature was raised to
50 °C for 20 subsequent cycles. Elongation and denaturation steps
were carried out at 70 °C for 3 min and at 95 °C for 30 s,
respectively. Primers used for the RT and PCR were: SPR,
gacgcacaccagcaacaccac (antisense, for the A2 gene); 28 MFX,
ccgtgtaaggcagagac (antisense, for the A2rel gene); SL,
caacgctatataagtatcagtttctgtactttattg (sense, splice leader sequence).
To amplify the 5
ends of the plasmid-derived transcripts, the
following primers were used: SL, the splice leader sequence shown
above; atagccgaatagcctctcca (antisense, neo-specific
primer); cgaggcttcgtagcggtg (antisense, 3
end of the Pro sequence). To
amplify the 3
end of the plasmid-derived transcripts, the following
primers were used: ggggatccttttttttttttttttttt (antisense, poly(A)
site); tgctttggcttcctgac (sense, A2 3
-UTR).
). DNA
sequencing of recombinant plasmid inserts and corresponding genomic
regions on Geco 90 was performed as described previously (Charest and
Matlashewski, 1994
).
-UTR of the
A2 transcript (SKTail) was constructed by combining
XbaI/EcoRI (0.7 kb) and
EcoRI/PstI (0.45 kb) fragments from the genomic
clone Geco 90 into the SK
A9 cDNA recombinant plasmid
(XbaI/PstI; refer to Figs. 1A and
2A). The A9 cDNA contains extra bases at the 3
end
compared with other cDNAs of the A2 series and was thought to carry
a polyadenylation acceptor site (Charest and Matlashewski, 1994
). The
SKTail plasmid was then used to purify a
XbaI/XhoI 1.7-kb A2 Tail element representing the
3
-UTR (refer to Figs. 1A and 2). The Pro element consisted
of a 1.6-kb XhoI fragment from the Geco 90 plasmid. On the
pSPYneo plasmid, used as backbone for our constructs, the
neo gene was preceded by a 92-bp synthetic element (pyt),
which consists of a polypyrimidine tract and an AG
trans-splicing acceptor site (Papadopoulou et
al., 1994
). To construct NEO P(
), NEO T
, and NEO PT
, this
synthetic element circumscribed by SstI restriction sites
was removed from pSPYneo to create NEO(
). A plasmid construct
carrying only the artificial trans-splicing acceptor element
(pSPY21) was used to construct NEO T
and NEO PT
. Plasmids pSPY21 and
pSPYneo are gifts from Dr. Papadopoulou and Dr. Ouellette (Laval
University, Québec).
Fig. 1.
Genomic organization of A2 gene copies in two
L. donovani strains. Panel A, restriction
map of the L. donovani Ethiopian LV9-derived Geco 90 EcoRI genomic clone and corresponding cDNAs. The Geco 90 insert contains parts of two A2 gene copies arranged head to tail. The
A8 cDNA sequences overlap the EcoRI restriction site;
the 5
end of A8 mapped on the 3
end of the genomic clone Geco 90 (Charest and Matlashewski, 1994
). The open box represents
the repeated section of the A2/ORF II protein coding region. Probe A
(0.38-kb PstI fragment) was purified from the A2 cDNA
plasmid (cDNA-inserted EcoRI/XhoI in
pBluescript SK
; Charest and Matlashewski (1994)
); probes
B (0.5 kb), C (0.5 kb), and D (0.5 kb) were derived from Geco 90 subclones; probe E consisted of a 1.1-kb BamHI fragment from
the recombinant plasmid pET16b/ORF II (Charest and Matlashewski, 1994
).
E, EcoRI; M, SmaI;
O, XhoI; P, PstI;
S, SalI; X, XbaI. sl, spr,
and 28mfx refer to synthetic oligonucleotides used as primers for
RT-PCR RNA mapping (5
RACE); sl corresponds to the
Leishmania spliced-leader; spr maps to the signal peptide
coding sequence of the A2 protein product (Charest and Matlashewski,
1994
); 28mfx was designed based on partial sequencing data from Geco 90 and was specific for A2rel. Further details concerning the RNA mapping
are provided under ``Materials and Methods.'' Panel B,
Southern blot analyses. Genomic DNA restriction fragments were
subjected to electrophoresis on a 0.7% agarose gel, transferred onto
nylon membranes, and hybridized sequentially with probes A and E. L lanes are for L. donovani infantum
LV9, and D lanes are for L. donovani
donovani 1S2D. Panel C, karyotype analyses. Chromosomes
of both L. donovani strains (LV9 and 1S2D) were hybridized
with probe A. Pulsed field gel electrophoresis separated chromosomes
stained with ethidium bromide in agarose gel prior to Southern blot are
shown in the panel on the right. Y,
Saccharomyces cerevisiae chromosomes used as molecular
weight markers. Panel D, Northern blot analyses: effects of
pH and temperature shifts on the expression of A2 and A2rel transcripts
in L. donovani promastigotes. Total RNA was extracted from
L. donovani donovani 1S2D promastigotes at several time
points following their transfer from medium at pH 7.3 and 27 °C into
medium representing phagolysosomal conditions at pH 4.5 and 37 °C
(0, 3, 6, and 10 h). Ten-µg RNA samples were hybridized with
probes prepared with fragment A (A2) or B (A2rel). Equal loading was
verified by staining the denatured RNA with ethidium bromide in the
agarose gel prior to Northern blot (shown on the bottom
panel).
)
and NEO PT(-), the Tail element eluted from an agarose gel was
blunt-ended with Klenow fragment of E. coli polymerase I and
inserted into the unique EcoRV site of the pSPYneo or NEO
(-) vectors; the Pro element was inserted into unique SalI
restriction sites. To construct NEO T
and NEO PT
, inserts from NEO T
and NEO PT(-) were excised with XhoI and BglII,
and agarose gel purified restriction fragments were inserted into
pSPY21 (XhoI/BamHI), upstream of the pyt element.
Fig. 2.
Panel A, schematic outlines of the
A2/A2rel genomic organization and probes used for subsequent Northern
blot analyses. The open box represents the repeated section
of the A2/ORF II protein coding region. Arrows delineate the
A2 and A2rel mature mRNA encoding regions, as determined by 5
and
3
mapping. The arrow pointing in the genomic DNA sequence
shows the precise trans-splicing acceptor site for the wild
type A2 transcripts as determined by sequencing of the RT-PCR product
as described under ``Materials and Methods.'' The Pro and Tail
sequences were used in subsequent plasmid constructs as shown in
panel B. E, EcoRI; M,
SmaI; O, XhoI; P,
PstI; S, SalI; X,
XbaI. Panel B, schematic representation of the
various DNA inserts present in the NEO plasmid series. The inserts
represented the upstream (Pro) and/or downstream (Tail) untranslated
sequences from the A2 gene. Refer to panel A for sizes and
locations of the Pro and Tail elements. PYT refers to a
synthetic trans-splicing acceptor site (92 bp). The
outlined sequences were inserted into a plasmid vector in
the orientation shown (5
to 3
) as described under ``Materials and
Methods.'' See Fig. 3A for transcripts derived from these
plasmid constructs.
).
Briefly, late log phase promastigotes of the L. donovani
1S2D strain were harvested by centrifugation (1,500 × g, 10 min) and resuspended at a concentration of
108/ml in ice-cold transfection buffer (21 mM
HEPES, pH 7.5, 137 mM NaCl, 5 mM KCl, 0.7 mM Na2HPO4, and 6 mM
glucose). Cells (0.4 ml) were mixed with 10-20 µg of CsCl-purified
plasmid DNA or agarose gel-purified DNA fragments and were
electroporated with a single pulse of 250 microfarads and 0.45 KV. When
the concentration of drug-resistant cells reached about 105
cells/ml (2-4 weeks), the concentration of G418 in the culture medium
was increased gradually from 10 to 50 µg/ml. Polyclonal populations
of recombinant promastigotes were used for experiments with stably
transfected cells carrying episomal copies of neo.
Recombinant promastigotes carrying neo targeted into the
chromosomal A2 gene cluster were cloned by multiple dilutions.
). Cells were washed once in cold phosphate-buffered saline and
suspended at 4 °C in lysis buffer (10 mM Tris/HCl, pH
8.0, 10 mM NaCl, 1.5 mM MgCl2, 1 mM spermidine, 0.1 mM EDTA, 1 mM
EGTA, 5 mM dithiothreitol, 0.1 mM
phenylmethanesulfonyl fluoride, and 0.5% Triton X-100) and kept on ice
for 10 min. The crude nuclei were then pelleted at 6,000 rpm for 10 min
in a Beckman J2-MC centrifuge (JA 17 rotor) at 4 °C. The nuclei were
washed once in lysis buffer without detergent and resuspended in an
equal volume of 2 × nuclei storage buffer (100 mM
Tris/HCl, pH 8.3, 80% glycerol, 10 mM MgCl2,
and 0.2 mM EDTA). A 100-µl sample of nuclei
(109) containing buffer was mixed with an equal volume of
nuclear run-on buffer (8 mM MgCl2, 80 mM Tris/HCl, pH 7.5, 50 mM NaCl, 50 mM KCl, 0.15 mM spermine, 0.5 mM
spermidine, 4 mM ATP, 2 mM CTP, 2 mM GTP, 10 µM UTP, 10 mM
phosphocreatine, 20 units/ml creatine kinase, 40 units of RNasin
(Promega), 2 mM dithiothreitol) and 0.1 mCi of
[
-32P]UTP (400 Ci/mmol; ICN, Canada) and incubated for
10 min at 37 °C. The radiolabeled nascent RNA was isolated using
RNAzol as described previously (Charest and Matlashewski, 1994
). A
5-µg sample of each DNA probe to be tested was denatured in 0.4 M NaOH and applied onto a nylon membrane using a vacuum
slot-blot apparatus. Membrane strips were then subjected to
hybridization with the radiolabeled RNA in a solution consisting of
5 × SSC, 5 × Denhardt's solution, 0.05% SDS, 0.5 mM EDTA, and 100 µg of denatured fish sperm DNA for
48 h at 65 °C. Subsequently, filters were washed at room
temperature for 10 min in 6 × SSC, 1% SDS and a final wash at 65 C in 1 × SSC.
). Cells were
harvested at 1, 3, and 5 h after the addition of actinomycin D and
subjected to Northern blot analysis to detect neo/A2
chimeric transcripts.
Polymorphism among A2 Gene Copies
).
The EcoRI genomic clone Geco 90 (Fig.
1A), previously identified with the A2
cDNA as a probe, was shown to carry parts of two A2 gene copies:
the 3
end of one copy, where the A2 cDNA mapped, followed by the
5
end of a second copy, in which the A2 protein coding region (A2/ORF
II) was identified. To characterize the expression of the A2 gene, it
was necessary to define further the genomic organization of the A2
genes by Southern and Northern blot analyses using fragments of the
Geco 90 clone as probes (Fig. 1).
). As shown in Fig. 1D, A2-specific
mRNAs accumulated slowly in cells following transfer to the
phagolysosomal conditions of 37 °C and pH 4.5. In contrast,
expression of the A2rel transcripts remained constant throughout the
10-h period. The two higher molecular weight transcripts recognized by
the A2rel probe could represent mRNAs derived from copies bordering
A2/A2rel clusters or from alternate trans-splicing and
polyadenylation. Results of Southern blot analyses with XhoI
fragments (Fig. 1B), which contained sequences of both A2
and A2rel, strongly suggest that copies of the two genes are always
associated together on the genome, copies of A2 alternating head to
tail with copies of A2rel. For the purpose of this study, the A2rel
mRNA (2.3 kb) represented an excellent control for constitutive
gene expression in L. donovani.
and 3
ends of the A2 transcripts on the genomic
sequences. The mapping of the 5
end was achieved using RT-PCR and DNA
sequencing, and the results are included in Figs. 1A and
2A. The A2-specific antisense oligonucleotide
(termed SPR) was used for cDNA synthesis and was subsequently
combined for PCR with an oligonucleotide representing the
spliced-leader sequence of L. donovani (SL), designed
according to Wilson et al. (1991)
. The spliced-leader
sequence is added by trans-splicing at the 5
end of all
protein-encoding mRNAs in trypanosomatid cells (for review, see
Clayton, 1992
; Pays, 1993
). Southern blot analyses of the PCR samples
with an internal probe (probe D, Fig. 1A) revealed a single
PCR product that was cloned and characterized. Eight clones containing
the PCR product were isolated, and all displayed identical restriction
enzyme patterns. The spliced-leader acceptor site was then located
precisely by DNA sequencing of the cloned PCR product and the
corresponding sequences on the genomic clone Geco 90. In this manner,
the A2 trans-splicing acceptor site was located 214 nucleotides upstream from the beginning of the A2 open reading frame as
shown in Fig. 2A. The 3
end of the A2 transcript has been
described previously (Charest and Matlashewski, 1994
) and is also
represented in Fig. 2A.
and 3
ends of the A2rel transcripts were also mapped by RT-PCR,
cDNA cloning, restriction endonuclease, and partial
sequencing.3 The locations of these ends on
Geco 90 are also shown in Figs. 1A and 2A.
-UTR
-UTR and is followed
by a 2.0-kb 3
-UTR. With this information, it was possible to examine
the involvement of the 5
and the 3
regions flanking the A2 coding
region (A2/ORF II) for their individual roles in controlling A2 gene
expression in cells incubated under phagolysosomal conditions
(37 °C, pH 4.5).
- and/or 3
-flanking regions of the A2/ORF II were constructed; maps
of plasmid inserts are schematized in Fig. 2B. The A2rel-A2
intergenic region (and the A2rel 3
region) were included as the A2
5
-flanking element (Pro element; 1.6 kb). Only 70 bp separated the
XhoI restriction site from the translational initiating
codon of the Geco 90/A2/ORF II. The 1.7-kb Tail element was constructed
with sequences from the genomic clone Geco 90 and from the A9 cDNA.
About 300 bp separated the translational termination codon of the
A2/ORF II downstream from the XbaI restriction site. In
these assays, neo was used as both the selectable marker and
as a reporter gene. It has been demonstrated recently that the pSPneo
plasmid that was used as the backbone for our constructs forms large
oligomers that replicate autonomously in transfected
Leishmania cells (Papadopoulou et al., 1994
).
end and/or the 3
-UTR, when these were included in the plasmid
constructs (Fig. 3B).
Fig. 3.
Differential expression of A2 and
neo/A2 reporter transcripts in recombinant promastigotes
carrying the different neo gene expressing constructs.
For panels A, B, and C, total RNA was
extracted from recombinant cells cultured at 26 °C, pH 7.4 (lanes 1), or transferred for 10 h into phagolysosomal
conditions, 37 °C, pH 4.5 (lanes 2). RNA samples (10 µg) were subjected to Northern blot analyses with the following
probes. Panel A upper panel, neo probe.
Panel A lower panel, A2rel probe. Panel B, probes
specific to the 5
- or 3
-UTR sequences from A2. Panel C,
probes specific to the A2 protein coding region, A2/ORF II. Equal
loading was verified by reprobing with A2rel-specific sequences
(panel A) or by staining RNA samples on agarose gels with
ethidium bromide before transfer onto nylon membranes (panels
B and C). The neo probe consisted of a
0.9-kb EcoRI/EcoRV fragment containing the entire
gene sequence (purified from the pSPYneo plasmid). Refer to Fig. 2,
A and B, for localization of specific probes (A2
5
, A2 3
, A2/ORF II, and A2rel) and plasmid maps. The names of the
recombinant plasmids were abbreviated as follows. T, NEO T;
P, NEO P; P(
), NEO P(
). PT(
),
NEO PT(
); T
, NEO T
; PT
, NEO PT
.
-UTR (Fig.
2B, plasmids NEO T, NEO P, NEO P(
), NEO PT(-)). As shown in Fig.
3A, none of these plasmids could mediate a developmental
expression of chimeric neo/A2 transcripts in the transfected
cells. The sizes of these transcripts were consistent with
polyadenylation occurring within the plasmid backbone sequence
approximately 400 bp upstream from the pyt element (in the case of
plasmid NEO T) or the Pro sequence (in the case of plasmids NEO P, NEO
P(
), NEO PT(
)). Because of these initial negative results, the pyt
element was added onto the 3
-UTR of plasmids NEO T and NEO PT(
),
resulting in plasmids NEO T
and NEO PT
. The rationale was based on
the previous observation (Lebowitz et al., 1993
) that
trans-splicing was linked to polyadenylation, and therefore
the pyt element was included to allow trans-splicing to take
place within the A2 3
-UTR of transcripts derived from plasmids NEO T
and NEO PT
. As shown in Fig. 3A, plasmids NEO T
and NEO
PT
did mediate developmental expression of chimeric neo/A2
transcripts under phagolysosomal conditions, and the sizes of these
transcripts (around 2.3 kb) were consistent with 3
RNA processing
involving the artificial trans-splicing acceptor site (pyt),
which was added to the Tail element in these plasmid constructs.
Densitometric analyses using the A2rel hybridization for normalization
estimated the differential expression, for both NEO T
and NEO PT
, to
be about five times (NIH Image, version 1.57). Results with other
plasmid constructs varied between 0.75 and 1.3. These results
demonstrate that the 3
-UTR together with the pyt element present in
plasmids NEO T
and NEO PT
is required for differential gene
expression induced under phagolysosomal conditions.
- and
NEO PT
-transfected promastigotes, suggesting that cellular factors
involved in the developmental expression were relatively abundant in
Leishmania cells and were not titrated out by chimeric
neo/A2 reporter gene transcripts.
and 3
Ends of Plasmid-derived Transcripts
and
NEO PT
was consistent with RNA processing taking place at the
artificial trans-splicing acceptor site (pyt) located at the
3
end of the Tail element. In this case, the artificial pyt element
would have been removed from the mature transcript during the coupled
trans-splicing/polyadenylation step (Lebowitz et
al., 1993
). To examine this possibility directly, the 3
end-containing region of the transcript arising from NEO T
and NEO PT
was cloned by RT-PCR, and the product was sequenced. The RT-PCR
products and the sequence data for the NEO PT
-derived transcript are
shown in Fig. 4. As expected, the pyt element was
removed from these transcripts, and polyadenylation occurred about 400 bp upstream from the pyt element. This was also the site of
polyadenylation in the NEO T
-derived neo/A2 chimeric
transcript. This site of polyadenylation has never been detected in A2
cDNAs derived from wild type A2 mRNA (out of seven A2 cDNAs
analyzed; Charest and Matlashewski (1994)
). These results are
consistent with the trans-splicing/polyadenylation model
involving a cryptic polyadenylation site, as defined previously
(Lebowitz et al., 1993
). These data confirmed that the pyt
element at the 3
end of the Tail sequence in NEO T
and NEO PT
was
used for processing the 3
end of the transcripts arising from these
plasmids.
Fig. 4.
Mapping of the transcripts arising from
plasmid constructs. Panel A, products derived from the
RT-PCR to map the 5
end of transcripts derived from plasmids NEO P and
NEO PT
. RNA was isolated from transfected cells, subjected to RT-PCR
with primers specific to the neo gene and to the 5
splice
leader sequence (lanes 2 and 4). The PCR products
as shown in lanes 2 and 4 were then used as
templates for a PCR using primers specific to the spliced-leader
sequence and to a sequence derived from the A2 5
-untranslated Pro
region (lanes 3 and 5). The sizes for the RT-PCR
products are consistent with the trans-splice site as shown
in panel C, and both plasmids NEO P and NEO PT
used the
same trans-splicing site within the Pro region. Panel
B, products derived from RT-PCR to map the 3
end of transcripts
derived from plasmids NEO T
and NEO PT
. RNA was isolated from wild
type and transfected cells and subjected to RT-PCR with primers
specific to the poly(A) tail and an internal primer corresponding to a
sequence 600 bp upstream from the native poly(A) site. The 200-bp PCR
products specific to the NEO T
and NEO PT
-derived transcripts are
indicated by an arrow. Note also the presence of the 600-bp
PCR product corresponding to the 3
end of the native A2 transcripts as
seen in both wild type and transfected cells. The nature of the other
bands is not known. Panel C, diagram showing the location of
the 5
trans-splice site and the poly(A) addition site for
transcripts derived from the NEO PT
plasmid. The precise 5
trans-splice site and the poly(A) addition site were mapped
by cloning and sequencing of the RT-PCR products shown in panels
A and B. Note that the poly(A) addition site occurred
approximately 400 bp upstream from the artificial pyt element.
end of the transcripts derived from the
plasmids containing the Pro sequence as shown in Fig. 2, A
and B, to determine which trans-splicing acceptor
site was used. Mapping the 5
ends of these chimeric transcripts was
performed by RT-PCR using an antisense oligonucleotide specific for the
neo gene or the A2 Pro sequence and a sense oligonucleotide
corresponding to the splice leader. The RT-PCR products were cloned and
sequenced. The products of the RT-PCR and the sequence information are
also shown in Fig. 4. These results demonstrate that the A2
trans-splicing acceptor site corresponding to nucleotide
214 (as shown in Fig. 2A) was used for processing the
neo-containing transcripts derived from plasmids NEO P and
NEO PT
, which contained the A2 Pro sequence. The pyt element inserted
between the Pro and the neo gene in the NEO P plasmid was
not used for processing at the 5
end.
-UTR sequences and not the 5
upstream sequences were essential for the differential expression of
the chimeric neo transcripts observed in promastigotes
containing plasmids NEO T
and NEO PT
when subjected to phagolysosomal
conditions. However, the 3
-UTR sequence was also included in NEO T-
and NEO PT(
)-derived neo transcripts, but these were not
expressed differentially when compared with the control A2rel
transcript at 2.3 kb (Fig. 3A). The only difference between
the NEO T/NEO PT(
) and NEO T
/NEO PT
constructs was the presence of
the pyt element at the end of the A2 3
-UTR in plasmids NEO T
/NEO PT
.
As shown in Fig. 4, this pyt element was involved in the processing of
the 3
end of transcripts derived from plasmids NEO T
and NEO PT
.
These data demonstrate that processing in the 3
-UTR was essential for
the neo/A2 chimeric mRNA accumulation under
phagolysosomal conditions. It is possible that a particular motif in
the 3
-UTR could not form in the A2 3
-UTR when linked to plasmid
backbone-derived sequences, as in the case of transcripts derived from
NEO T and NEO PT(
). In conclusion, these experiments demonstrate the
following. First, the A2 3
-UTR is involved in the developmental
expression of A2 transcripts under phagolysosomal conditions. Second,
the 3
-UTR must be processed by trans-splicing for the
differential accumulation of A2 transcripts to occur in cells incubated
under phagolysosomal conditions.
Fig. 5.
Rate of A2 and A2rel transcription as
determined by nuclear run-on analysis. Nuclei were prepared from
cells grown at 26 °C, pH 7.4, or at 37 °C, pH 4.5, as indicated
and then incubated in the presence of [32P]UTP to allow
elongation of nascent RNAs. The radiolabeled RNA was used to probe A2
DNA, A2rel DNA, and L. donovani genomic DNA. As a negative
control, pBluescript plasmid DNA was used. In this case, the A2rel DNA
was used as a control for a gene that is not expressed developmentally
in phagolysosomal conditions. The signal intensities as seen on the
autoradiogram reflect the transcription rates from the specific genes
before the isolation of the nuclei and demonstrate that the rate of
transcription of the A2 and A2rel sequences did not increase under
phagolysosomal conditions (37 °C, pH 4.5).
-UTR mediates an increased
stability of transcripts in cells incubated under phagolysosomal
conditions. It has been established previously that promastigotes
maintained at pH 4.5 and 37 °C will induce maximum A2 transcript
accumulation, whereas promastigotes maintained at pH 7.3 and 37 °C
will not accumulate A2 transcripts (Charest and Matlashewski, 1994
).
Therefore, under these conditions, it is the reduced pH that mediates
the accumulation of A2 transcripts, and these are the conditions under
which we examined RNA stability. It is also noteworthy that because
plasmid-derived transcripts are much more abundant that
chromosome-derived transcripts, it is possible to detect readily the
plasmid-derived neo/A2 chimeric sequences in promastigotes
incubated at 26 °C and neutral pH; this therefore represented the
base line for these RNA stability experiments.
or NEO PT
cultured at
26 °C and pH 7.3 were transferred to 37 °C in culture medium at
pH 7.3 or pH 4.5, which was supplemented with actinomycin D (10 µg
ml
1) to inhibit transcription. Cells stably transfected
with pSPneo plasmid were used as a control in this experiment. The
pSPneo plasmid (which served as the backbone for the construction of
the plasmids shown in Fig. 2B) contains the same pyt element
located just 5
to the neo gene (Papadopoulou et
al., 1994
) and expresses a neo transcript of about 3.0 kb. RNA samples were extracted at four different time points following
the addition of actinomycin D, and aliquots were analyzed by Northern
blot using neo-specific probes (Fig. 6). The
relative amount of the reporter gene transcripts present in cells at
each time point was compared with the initial amount at time 0 for
cells incubated under the same pH conditions. Densitometric analyses of
the Northern blot confirmed that chimeric neo transcripts
carrying the A2 3
-UTR derived from plasmids NEO T
and NEO PT
was
more stable at pH 4.5 than at pH 7.3. This was evident at the 1-h time
point where there was two to three times more NEO T
- and NEO
PT
-derived chimeric neo transcript at pH 4.5 than at pH
7.3. In comparison, at the 1-h time point, the level of the
neo transcripts was the same at pH 4.5 and 7.3 in the cells
transfected with the control plasmid pSPneo, which lacked the A2
3
-UTR. These data demonstrate that the A2 3
-UTR was capable of
stabilizing a heterologous transcript when cells were incubated in
acidic conditions. Interestingly, from the 1-h time point on, the decay
of the neo-containing transcripts in cells transfected with
NEO T
and NEO PT
was similar at pH 4.5 and 7.3. This demonstrates
that the stabilization of the neo/A2 chimeric transcript
under acidic conditions occurred early and transiently within the 1st
h. Although this is difficult to interpret, it is possible that
actinomycin inhibited the accumulation of factors required for the
stabilization of A2 transcripts. Nevertheless, these data do argue that
the A2 3
-UTR does mediate an increase in RNA stability under acidic
conditions compared with neutral conditions. However, under the
experimental conditions used, the mRNA stabilization was relatively
short lived, and future experiments will be required to define the
mechanism of mRNA stabilization.
Fig. 6.
Relative stability of neo/A2
chimeric transcripts as determined by Northern blot analysis in
recombinant promastigotes. Plasmid NEO, NEO T
, or NEO PT
containing promastigotes cultured at 26 °C and pH 7.3 were placed in
actinomycin D (10 µg/ml)-containing medium at 37 °C, and pH 4.5 (lanes A) or pH 7.3 (lanes N). Total RNA was
extracted from cells after 0, 1, 3, and 5 h following the addition
of actinomycin, and 10-µg samples were hybridized with a
neo-specific probe. Equal loading was verified by staining
the RNA samples on agarose gels before transfer onto nylon membranes.
Densitometric analyses were carried out using NIH Image version 1.57 software. For each pH condition, values are expressed as percentages of
the amount at time 0. These results have been reproducible in two
separate experiments.
-UTR. With our series of plasmid constructs, this processing of the
3
-UTR was mediated by an artificial trans-splice acceptor
site (pyt) inserted downstream of the A2 3
-UTR sequences (in plasmids
NEO T
and NEO PT
). To address directly the question of whether the
A2-A2rel intergenic region would mediate developmental expression of a
heterologous gene, we analyzed the pattern of expression of the
neo reporter gene when targeted into the A2 locus. The
strategy used to insert the neo gene into the A2 locus by
homologous recombinations is outlined in Fig.
7A. Linear SalI/StuI
fragments containing the neo gene flanked by 1.0 kb of the
Pro and 0.8 kb of the Tail sequences were excised from NEO PT and NEO
PT(
) plasmids, and 20 µg of agarose gel-purified DNA was
electroporated into promastigotes. Compared with NEO PT(
) (Fig. 2),
the NEO PT plasmid contained a pyt element between the Pro sequences
and the neo gene. Recombinant cells were selected with
minimal doses of G418 (8 µg/ml), and monoclonal populations (R1 and
R2 cell lines) were established by limiting dilutions. Insertions of
neo into the A2 locus were confirmed by Southern blot and
karyotypic analyses (Fig. 7, B and C). The
PstI site within the neo sequence created new
PstI restriction fragments recognized by the A2 5
-specific
probes (Fig. 7B). These PstI fragments differed
in lengths by the pyt element (92 bp) present only in the NEO PT
construct. In both R1 and R2, the neo3 probe revealed a
1.7-kb PstI fragment, as expected of a chimera of
neo and A2 3
sequences. As expected, karyotype analysis
shows that the neo gene was present on the 850-kb
chromosome, which is where the A2 locus is located (Fig.
7C). These results are consistent with gene replacement
events.
Fig. 7.
Targeting of the neo gene into
the A2 gene locus. Panel A, schematic outline of
targeting strategy and probes used in Southern and Northern blot
analyses. R1 and R2 stand for L. donovani recombinant clones transfected and selected with linear
2.9-kb NEO PT(
) or 3.0-kb NEO PT SalI/StuI
linear DNA fragments, respectively. E, EcoRI;
M, SmaI; O, XhoI;
P, PstI; S, SalI;
X, XbaI; U, StuI.
Panel B, Southern blot analyses of PstI-digested
genomic DNA with A2-specific or neo-specific probes as
indicated for the R1 and R2 clones. Panel C, karyotypic
analysis of R1 and R2 clones and wild type L. donovani 1S2D
(D) to reveal A2 genes or the integrated neo
gene. Panel D, expression of the chimeric neo/A2
transcript in R1 and R2 clones. RNA was extracted from promastigotes
incubated at 26 °C, pH 7.4 (lanes 1), or transferred for
10 h at 37 °C, pH 4.5 (lanes 2). RNA samples were
hybridized with the neo-, A2-, or A2rel-specific probes as
indicated on the figure.
). Genes such as A2 which are developmentally expressed in the
amastigote stage may encode products necessary for the establishment
and progression of the infection in the mammalian host. Defining the
mechanism in which amastigote-specific genes are regulated will
contribute to understanding the molecular basis for infection with this
important human parasite.
-UTR and its processing by the
trans-splicing machinery were required for developmental
expression under phagolysosomal conditions. It was also demonstrated
that the developmental accumulation of A2 transcripts was regulated at
the post-transcription level and that the 3
-UTR could mediate an
increase in transcript stability in phagolysosomal conditions. These
observations define mechanisms involved in amastigote-specific gene
expression in Leishmania. Finally, the feasibility of
targeting genes into the A2 locus to obtain a differential expression
of heterologous genes in the amastigote stage was also demonstrated.
The A2 locus would therefore be particularly suitable to control the
expression of negative selection genes and may therefore establish the
basis of a live attenuated vaccine.
and NEO PT
there was a 5-10-fold induction depending on the
experiment. Although there is clearly variability between experiments,
the plasmid-derived neo/A2 chimeric transcript did not
appear to be as tightly controlled as the wild type A2 transcript or
the gene replacement-derived neo/A2 chimeric transcript. We
believe this is because of the higher background level of transcript
derived from the plasmid episome compared with the chromosome-derived
transcript. Alternatively, this may be due to the use of the cryptic
polyadenylation site used in the NEO T
- and NEO PT
-derived
neo/A2 chimeric transcripts. Nevertheless, the plasmid
constructs did define the 3
-UTR as being essential for developmental
expression. Future studies will define the relevant regulatory sequence
within the 3
-UTR and the method in which this sequence mediates an
increase in RNA stability in phagolysosomal conditions.
- and 3
-flanking
sequences for their contribution in regulating the accumulation of
transcripts in amastigotes. The results provide unique insight into the
involvement of the 3
-UTR in determining the relative levels of
transcripts in amastigotes. A previous study examining the
up-regulation of hsp 83 transcripts in Leishmania mexicana
amastigotes likewise revealed a post-transcriptional regulation, but
the individual contributions of the 5
- and 3
-flanking noncoding
sequences were not defined (Argaman et al., 1994
). More
recently however, data have been presented showing that mRNAs
encoding hsp 70 and hsp 83 in Leishmania major and L. donovani do not increase significantly following heat shock
(Brandau et al., 1995
). In a separate study (Flinn and
Smith, 1992
), a gene family that was up-regulated in metacyclic
L. major promastigotes was shown to have conserved 3
sequence elements, suggesting that these elements may be involved in
the regulation of this gene family. Consistent with the data presented
in this study, it has been demonstrated that the intergenic regions
play a major role in the processing of polycistronic transcripts into
polyadenylated mature mRNAs in Leishmania cells
(Lebowitz et al., 1993
). The data presented in this study
now demonstrate that the 3
intergenic region also plays an essential
role in the increased accumulation of transcripts in the amastigote
stage.
; Muhich and Boothroyd, 1988
;
Walton, 1987
). Previous work on trypanosomes (Trypanosoma
brucei) reported that transcript accumulation in the bloodstream
form can be regulated at both the transcriptional and the
post-transcriptional levels (for review, see Clayton, 1992
; Pays,
1993
). It has been demonstrated that the nature of the 3
-UTR was
crucial for the accumulation of reporter transcripts in the bloodstream
form (Jefferies et al., 1991
; Hug et al., 1993
).
More recently, it has been reported that the 3
-UTR was involved in the
regulation of amastigote-specific transcripts in Trypanosoma
cruzi (Teixeira et al., 1995
). Thus, processing of
mRNAs within the 3
-UTRs may be an important factor in modulating
the relative amounts of transcripts in trypanosomatids.
; Flinn and Smith, 1992
;
Huang et al., 1984
; Landfear et al., 1983
; Lee
et al., 1988
; Ramamoorthy et al., 1992
; Shapira
and Pinelli, 1989
), then the relative stability of the transcripts
could be responsible for regulating the relative levels of A2 and A2rel
transcripts in promastigotes and amastigotes. The data presented in
this study showing the increased stability of reporter transcripts
containing the A2 3
-UTR in cell cultures at 37 °C and pH 4.5 are
consistent with this model.
-UTR mediates an increase in
transcript stability and the sequences within the 3
-UTR involved in
the stabilization.
). Methods involving gene
targeting will be important in future studies to define the biological
function of the A2 protein in the infection process and to determine
the role it plays in the virulence of L. donovani. The
present work describing the structure and regulation of the A2 genes
will help in developing these future studies.
*
This work was supported in part by the Medical Research
Council of Canada and UNDP/World Bank/World Health Organization Special
Program for Research and Training in Tropical Diseases. Research at the
Institute of Parasitology is partially funded by the Natural Sciences
and Engineering Research Council of Canada and Fonds pour la formation
de chercheurs et l'aide à la recherche. The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
``advertisement'' in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Holder of a Ph.D. studentship from Fonds pour la formation de
chercheurs et l'aide à la recherche du Québec. Present
address: NIAID, National Institutes of Health, Bethesda, MD 20892.
§
Holder of an MRC Scientist Award. To whom correspondence should be
addressed: Institute of Parasitology, McGill University, Macdonald
Campus, 21,111 Lakeshore Rd., Ste-Anne de Bellevue, Québec,
Canada H9X 3V9.
1
The abbreviations used are: UTR, untranslated
region; RT, reverse transcription; PCR, polymerase chain reaction; kb,
kilobase(s); bp, base pair(s); ORF, open reading frame.
2
M. Ouellette, personal communication.
3
H. Charest, W.-W. Zhang, and G. Matlashewski,
manuscript in preparation.
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
D. R. A. Martins, S. M. B. Jeronimo, J. E. Donelson, and M. E. Wilson Leishmania chagasi T-Cell Antigens Identified through a Double Library Screen Infect. Immun., December 1, 2006; 74(12): 6940 - 6948. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Dumas, C. Chow, M. Muller, and B. Papadopoulou A Novel Class of Developmentally Regulated Noncoding RNAs in Leishmania Eukaryot. Cell, December 1, 2006; 5(12): 2033 - 2046. [Abstract] [Full Text] [PDF] |
||||
![]() |
|