INTRODUCTION

The mouse high affinity receptor for IgG, FcRI (CD64), consists of three Ig-like extracellular domains and is the only Fc receptor that binds monomeric IgG (1, 2). Expressed on monocytes and macrophages and induced by interferon- (IFN-)¹ on neutrophils (3, 4, 5), FcRI functions by linking the humoral and cellular responses. Although functions mediated by mouse FcRI are less well characterized, cross-linking of human FcRI on myeloid cells leads to events such as tyrosine phosphorylation (6), Ca²⁺ flux (7), superoxide generation (8), inflammatory mediator release (9), antibody-dependent cellular cytotoxicity (10), and internalization of small immune complexes (11). Many of these sequelae may also be true in the mouse. While human FcRI is associated with a homodimer of the -subunit from FcRI (12, 13, 14), receptor co-association has not been shown in the mouse, and indeed, there are some differences between the function of human and mouse FcRI (e.g. mouse FcRI is constitutively phosphorylated, while human FcRI is not) (15, 16).

Mouse FcRI is structurally homologous to human FcRI and exhibits high affinity binding of monomeric IgG (2). Genetic mapping studies revealed that the single gene encoding mouse FcRI (Fcg1) is situated on chromosome 3, and studies in the non-obese diabetic mouse (NOD) revealed a linkage with the Idd-3 diabetes susceptibility genetic marker on chromosome 3 (17, 18, 19). The Fcg1 allele found in NOD mice has 24 single base differences (compared with the BALB/c allele), 17 of which encode changes in the predicted amino acid sequence, including a four-amino acid insertion between domains 2 and 3 and a four-nucleotide deletion leading to a frameshift and premature translation termination codon that essentially eliminates the cytoplasmic domain (truncated by 73 amino acids) (19). Studies on NOD peripheral blood MAC-1⁺ cells demonstrated a lower surface expression of FcRI compared with cells from C57BL/10SnJ mice. Binding and turnover studies revealed that FcRI from NOD cells demonstrated a 73% reduction in the turnover of bound mIgG2a compared with C57BL/10SnJ mice (19).

This study characterizes FcRI from NOD mice (FcRI-NOD) and investigates the influence the mutations have on the cell-surface expression of FcRI-NOD, association with the FcRI -subunit, and interaction with ligand.

EXPERIMENTAL PROCEDURES

FcRI cDNA Constructs and Generation of Chimeric Receptors

The FcRI-NOD cDNA was generated by reverse transcription-PCR from RNA isolated from NOD/Lt spleen cells. Briefly, total RNA was isolated from 10⁷ spleen cells using guanidinium thiocyanate (20), and first-strand cDNA was synthesized using reverse transcription (Pharmacia Biotech Inc.). PCR was used to generate FcRI-NOD and FcRI-BALB cDNA clones as described (21) using 500 ng of oligonucleotide primers MDH3 and TISM6 and 2 units of Taq polymerase (Amplitaq, Perkin-Elmer) for 30 amplification cycles. The PCR products were subcloned into the expression vector pKC4 (22). The clone FcRI.1 contained the nucleotide sequence of FcRI-NOD (19), and the clone FcRI.3 contained the nucleotide sequence of FcRI-BALB (2). The predicted amino acid sequence of FcRI-NOD (19) is shown in Fig. 1 and is compared with the amino acid sequence of FcRI-BALB (2) and human FcRI (23).

Comparison of amino acid sequences of FcRI derived from the mouse strains NOD/Lt (

Chimeric receptors were generated by exchanging extracellular domain sequences between FcRI-NOD, FcRI-BALB, and human FcRI using splice overlap extension-PCR (24). The exchange points in the extracellular domains were Leu²⁶⁸ (NOD), Leu²⁶³ (BALB/c), and Leu²⁶³ (human) and are illustrated in Fig. 1. Briefly, two PCRs were used to amplify the cDNA fragments encoding the extracellular domains of either human FcRI (cDNA gift from B. Seed) (5-primer T-9 and 3-primer T-10) or FcRI-BALB (5-primer MDH3 and 3-primer T-10) and the transmembrane and cytoplasmic domains of either FcRI-NOD or FcRI-BALB (both using 5-primer T-11 and 3-primer T-5). A third PCR was performed to splice the two fragments together and to amplify the spliced product. The cDNA sequences were checked by dideoxynucleotide sequencing (25). The receptor construct containing FcRI-BALB extracellular domains and transmembrane and cytoplasmic domains of FcRI-NOD origin was designated BALB-NOD. The chimeric receptors containing human FcRI extracellular domains and transmembrane and cytoplasmic domains of either FcRI-NOD or FcRI-BALB origin were designated Hu-NOD and Hu-BALB, respectively.

The oligonucleotide sequences (5  3) used as primers in PCR are listed below, and nonhomologous sequences are underlined: MDH3, ATGATTCTTACCAGCTT; TISM6, CAGTCTGTATATTTGC; T-9, ATGTGGTTCTTGACAACTCT; T-10, GAGCTCCAACTCAGGGCT; T-11, AGCCCTGAGTTGGAGCTC; and T-5, TTGCATGCCATGGTCCC.

The mouse FcRI -subunit cDNA was a kind gift from Dr. U. Blank and was subcloned into the expression vector pRc/CMV (Invitrogen). The -actin cDNA was used as a control (26).

COS-7 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, 2 mM glutamine, 100 units/ml penicillin, 100 µg/ml streptomycin (Commonwealth Serum Laboratories, Melbourne, Australia), and 50 µM 2-mercaptoethanol (Koch Light Ltd., Colnbrook, United Kingdom) at 37 °C in 10% CO₂. COS-7 cells at 70% confluency were transiently transfected with FcRI expression plasmids using DEAE-dextran (Pharmacia, Uppsala) as described (27). Assays were performed on transfected cells 48-72 h post-transfection.

The monoclonal antibody 49-11.1 (anti-Ly2.1) (28) was used as a source of mouse IgG2a and Fab fragments. Human IgG1 were purified from a myeloma patient, and antibodies were assessed as monomeric after size fractionation chromatography (Superose 12, Pharmacia). Polyclonal rabbit anti-sheep erythrocyte serum was used to sensitize sheep erythrocytes for EA rosetting studies of complexed IgG binding, and mouse IgG1 anti-trinitrobenzene sulfonate (29) was used to sensitize sheep erythrocytes coated with trinitrobenzene sulfonate (Fluka Chemika, Buchs, Switzerland). Polyclonal rabbit anti-FcRI -subunit serum used in immunoblotting was a kind gift from Dr. J.-P. Kinet. The monoclonal antibodies 2.4G2 (rat anti-mouse Ly17 mAb) (30) and F4/80 (rat anti-mouse macrophage marker) and human IgG1 myeloma IgG were used in FACS analysis and were detected with FITC-conjugated sheep anti-mouse Ig or FITC-conjugated sheep anti-human Ig (Silenus, Melbourne, Australia).

Monomeric IgG was radiolabeled using Na¹²⁵I (Amersham International, Buckinghamshire, United Kingdom) with chloramine T as described (31); unincorporated iodine was removed using pre-packed G-25 (PD-10) columns (Pharmacia); and the radiolabeled antibody was stored at 4 °C for up to 1 week. Radiolabeled IgG was shown to compete equally with unlabeled IgG in binding to FcRI-expressing COS-7 cells.

Total RNA was harvested from COS-7 cells 48 h post-transfection as described (20), and the samples were treated with DNase I (Pharmacia) for 1 h before electrophoresis in agarose containing formaldehyde and Northern transfer to a nylon membrane as described (32). Northern blots were hybridized with either the complete cDNA of FcRI-BALB (2) or -actin cDNA (26) and autoradiographed.

Total DNA was harvested 48 h post-transfection from COS-7 cells by incubating cells in lysis buffer (50 mM Tris-Cl, pH 7.5, 100 mM EDTA, 100 mM NaCl, 1% SDS, and 500 µg/ml proteinase K) for 4 h at 55 °C prior to phenol and chloroform extractions and precipitation of DNA with an equal volume of isopropyl alcohol. The DNA was recovered by centrifugation and sheared through 23-gauge needles prior to overnight digestion with EcoRI. 10 µg of DNA was electrophoresed and transferred to a nylon membrane as described (32). Southern blots were hybridized with the complete cDNA of FcRI-BALB (2) and autoradiographed.

COS-7 cells transfected with various cDNA constructs were surface-radiolabeled using Na¹²⁵I and lactoperoxidase (Sigma) as described (32). After washing with phosphate-buffered saline, 5 × 10⁶ cells were lysed on ice with 1 ml of Brij 96 lysis buffer containing 0.5% Brij 96 (Sigma), 10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, and 1 mM phenylmethylsulfonyl fluoride (Sigma), and nuclear and cellular debris were removed by centrifugation.

Cell lysates were incubated with 30 µl of packed Sepharose beads coupled with either whole mouse IgG2a or Fab fragments of mouse IgG2a for 1 h at 4 °C with rotation before seven washes with lysis buffer. Samples were boiled in the presence of -mercaptoethanol and analyzed by SDS-PAGE.

Western Blotting and FcRI -Subunit Association

Transfected COS-7 cell lysates were incubated with whole mouse IgG2a-Sepharose and mouse IgG2a Fab fragment-Sepharose as described above, washed, and denatured under nonreducing conditions prior to SDS-PAGE and Western blotting onto an Immobilon-P membrane (Millipore Corp., Bedford, MA). After transfer, the membrane was blocked with 2% casein in Tris-buffered saline (10 mM Tris-Cl, pH 7.5, 150 mM NaCl) for 2 h before overnight incubation with polyclonal rabbit anti-FcRI -subunit antiserum in Tris-buffered saline containing 1% casein. After washing with Tris-buffered saline containing 0.1% Tween 20, the blots were incubated with peroxidase-conjugated swine anti-rabbit IgG (DAKO-PATTS) and then washed again prior to chemiluminescent detection (ECL, Amersham International).

Various concentrations of radiolabeled human IgG1 (¹²⁵I-hIgG1) and mouse IgG2a (¹²⁵I-mIgG2a) (radiolabeled as described above) were incubated with transfected COS-7 cells at 1 × 10⁶ cells/ml for 150 min on ice prior to centrifugation through phthalate oils (3:2 (v/v) dibutyl phthalate/dioctyl phthalate) (Fluka Chemika), and bound ¹²⁵I-IgG (cellular pellets) and free ¹²⁵I-IgG (supernatant) were determined. Nonspecific ¹²⁵I-IgG binding was determined either by the amount of ¹²⁵I-hIgG1 bound in the presence of 100-fold excess unlabeled IgG or by nonspecific binding to mock-transfected COS-7 cells, and the counts were subtracted from total binding to give specific IgG binding levels. Ratios of bound and free fractions were calculated, and Scatchard analysis was performed.

Association and dissociation kinetics of IgG binding were performed at 4 °C with monomeric ¹²⁵I-hIgG1 on COS-7 cells transfected with the FcRI constructs. The association of IgG was determined using transfected COS-7 cells (1 × 10⁶ cells/ml) and incubating with ¹²⁵I-hIgG1 (5 µg/ml) for the indicated times before assaying cell-bound ¹²⁵I-hIgG1 by pelleting cells through phthalate oils. To compensate for the various levels of surface expression of the two receptors, the data are presented as percent maximum bound IgG, where 100% is the level of binding demonstrated after 3 h of incubation on ice.

The dissociation of bound human ¹²⁵I-hIgG1 was measured by incubating either transfected COS-7 cells or mouse bone marrow-derived macrophages (±IFN-) with ¹²⁵I-hIgG1 (5 µg/ml) for 2 h before adding 200-fold excess unlabeled hIgG (1 mg/ml) to the cells at time 0. Cell-bound ¹²⁵I-hIgG1 was assayed at the indicated times by pelleting cells through phthalate oils. To compensate for the various levels of surface expression, the data are presented as percent maximum bound IgG, where 100% is the level of binding demonstrated at time 0. The dissociation of bound ¹²⁵I-hIgG1 from FcRI-transfected COS-7 cells was performed at both 4 and 22 °C, while the dissociation of ¹²⁵I-hIgG1 from FcRI on bone marrow-derived macrophages was measured at 4 °C.

NOD/Lt and BALB/c bone marrow-derived macrophages were generated as adherent cells from their nonadherent progenitors essentially as described before (33), but with minor modifications so that they could be removed from the culture surface. The macrophages were eventually grown on Petrie dishes for 4 days in RPMI 1640 medium supplemented with 50 µM 2-mercaptoethanol, 20 mM HEPES, 15% fetal calf serum, and 20% L-cell conditioned medium (as a crude source of colony-stimulating factor-1 or macrophage colony-stimulating factor). The bone marrow-derived macrophages were a relatively pure and homogeneous population, with 95% of adherent cells binding colony-stimulating factor-1. Cells were washed twice with phosphate-buffered saline and where stated were treated with 1000 units/ml recombinant murine IFN- (Nippon-Roche, Tokyo, Japan) 18 h before harvesting by vigorous washing.

Bone marrow-derived macrophages that had been stimulated with IFN- were incubated with mAb 2.4G2 (anti-FcRII/FcRIII), mAb F4/80 (anti-macrophage marker), and/or human IgG1 for 30 min on ice prior to washing and incubation with specific FITC-conjugated secondary antibodies. Since there are no mAbs that detect mouse FcRI, the ``specific'' staining of mouse FcRI was performed by blocking FcRII/FcRIII binding with mAb 2.4G2 (100 µg/ml) prior to the addition of monomeric human IgG (20 µg/ml). Human IgG bound by FcRI was detected using FITC-conjugated sheep anti-human Ig, which does not cross-react with rat IgG. Binding of antibodies was measured as surface fluorescence using the FACScan (Becton Dickinson).

RESULTS

Biochemical Characterization of FcRI-NOD

To establish the molecular mass of FcRI-NOD, COS-7 cells were transfected with either FcRI-NOD or FcRI-BALB cDNAs, and cells were radioiodinated and lysed 48 h post-transfection (Fig. 2). Immunoprecipitation studies were performed on cell lysates from COS-7 cells transfected with FcRI-NOD (Fig. 2, lanes a and b) and FcRI-BALB (lanes c and d) using whole mouse IgG2a-Sepharose (lanes a and c) and mouse IgG2a Fab fragment-Sepharose (lanes b and d). The 70-kDa moiety precipitated by whole mIgG2a from FcRI-BALB-transfected COS-7 cells (Fig. 2, lane c) was the expected size for FcRI-BALB (16). The molecular mass of FcRI-NOD, however, was expected to be smaller than 70 kDa due to the truncation of the cytoplasmic domain and was predicted to be 45 kDa. No such moiety was observed from immunoprecipitations with whole mIgG2a (Fig. 2, lane a), even after prolonged exposure of the autoradiograph. Fab fragments did not precipitate any material from either the FcRI-NOD-transfected (Fig. 2, lane b) or FcRI-BALB-transfected (lane d) lysates. The failure to immunoprecipitate FcRI-NOD was possibly due to low expression levels or failure to bind whole mIgG2a. These possibilities are addressed below.

Immunoprecipitation of FcRI from radioiodinated COS-7 cells.

Expression of FcRI and Binding of IgG

To assess if ligand binding differences were the reason for the observed immunoprecipitation difference between FcRI-NOD and FcRI-BALB, binding studies using monomeric ¹²⁵I-mIgG2a and ¹²⁵I-hIgG1 were performed (Fig. 3). COS-7 cells transfected with FcRI-NOD (Fig. 3A) or FcRI-BALB (Fig. 3B) were incubated with various concentrations of ¹²⁵I-hIgG1 or ¹²⁵I-mIgG2a. It is clear that both FcRI-NOD and FcRI-BALB are able to bind IgG; however, the total saturable binding of IgG2a to FcRI-NOD was one-tenth that of IgG2a binding to FcRI-BALB. This difference was apparent in the binding of both hIgG1 and mIgG2a by FcRI-NOD and was ~0.5 ng bound per 5 × 10⁴ cells, 10-fold less than cells transfected with FcRI-BALB (5-6 ng bound per 5 × 10⁴ cells). This 10-fold difference in expression levels was reproducible in all 10 experiments performed.

Specific binding of radiolabeled human IgG1 () or mouse IgG2a () to FcRI-NOD (

) or FcRI-BALB (

To establish that the difference in surface expression was due to FcRI-NOD receptor difference and not variability in the assay systems, the efficiency of transfection and mRNA levels were investigated. Total RNA (treated with DNase I) was harvested from COS-7 cells transfected with FcRI-NOD (Fig. 4A, lane a), FcRI-BALB (lane b), or the FcRI -subunit (negative control) (lane c) and hybridized with FcRI-BALB cDNA (upper panel) and -actin cDNA (lower panel). Hybridization of the mouse FcRI cDNA revealed equivalent amounts of RNA in cells transfected with either FcRI-NOD (Fig. 4A, lane a) or FcRI-BALB (lane b). Moreover, hybridization was specific as no FcRI mRNA was detected in cells transfected with FcRI -subunit cDNA only (Fig. 4A, lane c). RNA probed with -actin cDNA revealed that similar amounts of total RNA were present in each sample.

) from COS cells transfected with FcRI-NOD (

), FcRI-BALB (

), or the FcRI -subunit (

Southern blot analysis of total DNA was performed to determine the levels of plasmid DNA in the transfected cells (Fig. 4B). Total DNA, digested with EcoRI (which linearizes transfected plasmid to 4.76 kilobases) and hybridized with FcRI-BALB cDNA, indicated that approximately equivalent amounts of FcRI plasmid DNA were present in samples from cells transfected with FcRI-NOD (Fig. 4B, lane a) and FcRI-BALB (lane b). Specificity was demonstrated by the failure to detect any hybridizing material in cells transfected with the FcRI -subunit (Fig. 4B, lane c). No difference in levels of mRNA or transfected DNA was observed.

Chimeric Fc receptors were generated to localize the region of FcRI-NOD affecting the level of cell-surface expression. These receptors were generated using splice overlap extension-PCR, wherein the extracellular domains of FcRI-NOD were replaced with either FcRI-BALB sequence, to generate chimeric BALB-NOD, or human FcRI sequence, to generate Hu-NOD (Fig. 5A) (see also ``Experimental Procedures''). These sequence exchanges were made at the conserved leucine (positions 268, 263, and 263 of NOD/Lt, BALB/c, and human FcRI, respectively) within the conserved sequence LEQVLG on the N-terminal side of the predicted transmembrane region of each receptor (Figs. 1 and 5A).

Construction and IgG binding properties of chimeric FcRI.

Surface expression of chimeric receptors was tested by assessing the binding of monomeric human ¹²⁵I-IgG1 (Fig. 5B). The binding of ¹²⁵I-hIgG1 to BALB-NOD, which has BALB/c extracellular domains but the NOD transmembrane region and cytoplasmic tail, was indistinguishable from that to FcRI-BALB, implying that the reduced expression of FcRI-NOD is likely to be due to differences in the extracellular domains of FcRI-NOD rather than the membrane-spanning region or truncated cytoplasmic tail (see Fig. 5A). Similarly, the binding of IgG to the Hu-NOD chimeric receptor (human FcRI has similar affinity for hIgG as FcRI-BALB) was also indistinguishable from that of FcRI-BALB. Thus, replacement of the FcRI-NOD extracellular domains with either FcRI-BALB or human FcRI sequence restored ¹²⁵I-hIgG1 binding levels to those of FcRI-BALB and indicated that the mutant transmembrane region and residual cytoplasmic domain of FcRI-NOD did not appear to influence surface expression of FcRI.

Association of FcRI -Subunit with Mouse FcRI

Mouse FcRI is not known to associate with protein subunits. However, human FcRI, FcRIII, and FcRI all share a common subunit (FcRI -subunit) (12, 13, 14, 34, 35, 36, 37). The association with the FcRI -subunit has been found to be dependent upon membrane-spanning regions of FcRI and FcRIII (34, 35, 36, 37). While expression of human FcRI is not dependent on the association with the FcRI -subunit, FcRIII and FcRI both require the FcRI -subunit for expression. Thus, the FcRI -subunit may be required to ``optimize'' mouse FcRI expression, especially that of FcRI-NOD.

Cotransfection and immunoprecipitation experiments were performed with FcRI-BALB or FcRI-NOD and the FcRI -subunit to demonstrate any association of the FcRI -subunit with mouse FcRI. The cotransfection of the FcRI -subunit and FcRI-NOD did not increase cell-surface expression of FcRI-NOD. Mouse IgG2a failed to immunoprecipitate any labeled material from the transfected COS-7 cells (Fig. 6A, lane a). However, FcRI-BALB was clearly precipitated by IgG2a from cells cotransfected with the FcRI -subunit (Fig. 6A, lane e). No material was precipitated by IgG2a from cells transfected with the FcRI -subunit only (Fig. 6A, lanes c and d) or by Fab fragment-conjugated beads (lanes b, d, and f). It was clear, however, that the transfected cells were expressing the FcRI -subunit as Western blots of whole cell lysates indicated the presence of the 22-kDa dimer protein (Fig. 6B) in cells cotransfected with FcRI-BALB and the FcRI -subunit (lane a) and with FcRI-NOD and the FcRI -subunit (lane c) and in cells transfected with the FcRI -subunit cDNA only (lane b).

Immunochemical characterization of FcRI and FcRI -chain association in transfected cells.

To establish if the FcRI -subunit was capable of association with mouse FcRI, COS-7 cells were transfected with FcRI-BALB and FcRI -subunit cDNA (Fig. 6C, lanes a and b), with FcRI-NOD and the FcRI -subunit (lanes c and d), or with the FcRI -subunit alone (lanes e and f). Samples were incubated with either intact mouse IgG2a-Sepharose (Fig. 6C, lanes a, c, and e) or Fab fragment-Sepharose (lanes b, d, and f). Following SDS-PAGE under nonreducing conditions, Western blotting revealed the presence of the FcRI -subunit 22-kDa dimer in association with FcRI-BALB (Fig. 6C, lane a); however, no FcRI -subunit was detected in precipitates from cells transfected with FcRI-NOD and the FcRI  subunit (lane c) or with the FcRI -subunit alone (lane e). As expected, precipitation was specific for FcRI as no material was precipitated from these cells after incubation with Fab fragments of mouse IgG2a (Fig. 6C, lanes b, d, and f). Thus, the observation that FcRI-NOD did not appear to associate with the FcRI -subunit was presumably due to the low surface expression of this receptor (Fig. 6A) and, consequently, the low level of coimmunoprecipitation of the FcRI -subunit.

Since the membrane-spanning region of the FcRI -subunit and FcRIIIa have been shown to be crucial for the association with the FcRI -subunit (34, 35, 36), the question of whether the membrane-spanning region of FcRI-NOD and amino acid changes found therein would influence association with the FcRI -subunit was assessed. Chimeric receptors (see Fig. 5A) with extracellular domains of human FcRI origin and transmembrane and cytoplasmic domains from either FcRI-BALB (Hu-BALB) (Fig. 6D, lanes a and b) or FcRI-NOD (Hu-NOD) (lanes c and d) were cotransfected into COS-7 cells with the FcRI -subunit (lanes e and f, FcRI -subunit alone). Radiolabeled cell lysates were incubated with whole mIgG2a-Sepharose (Fig. 6D, lanes a, c, and e) or mIgG2a Fab fragment-Sepharose (lanes b, d, and f) prior to SDS-PAGE under nonreducing conditions. Western blotting revealed that the 22-kDa homodimer of the FcRI -subunit was coprecipitated with Hu-BALB chimeric FcRI (Fig. 6D, lane a) and also with Hu-NOD FcRI (lane c), which contains only the membrane-spanning sequence and residual cytoplasmic tail of FcRI-NOD. No material was precipitated from lysates from cells transfected with the FcRI -subunit alone (Fig. 6D, lane e) or from samples incubated with Fab fragment-Sepharose (Fig. 6D, lanes b, d, and f). It is clear from these results that the FcRI -subunit is able to associate with mouse FcRI and that this association can take place in the presence of BALB/c- or NOD-derived membrane-spanning and cytoplasmic tail sequences. Thus, it is likely that the reduced expression of FcRI-NOD is due to the mutations in the extracellular domains.

Specificity and Affinity of IgG Interactions with FcRI Forms

Since mutations in the extracellular domains affected cell-surface expression but not FcRI -subunit association, possible additional effects on ligand interactions were tested using both complexed and monomeric IgG (Table I). First, the binding of immune complexes was tested on FcRI-NOD- and FcRI-BALB-transfected COS-7 cells. Both FcRI-NOD and FcRI-BALB exhibited binding of complexed rabbit IgG-sensitized sheep erythrocytes assessed by rosetting, but could not bind complexed mouse IgG1-sensitized sheep erythrocytes, thereby confirming that the extracellular changes did not affect the specificity of mouse FcRI. While the specificity of FcRI-BALB and FcRI-NOD was identical, repeated Scatchard analysis demonstrated that although both receptors bound monomeric IgG, FcRI-NOD bound ¹²⁵I-mIgG2a or ¹²⁵I-hIgG1 with a 10-fold increase in affinity compared with FcRI-BALB (Table I).

Table I. Ligand binding and specificity of FcRI-NOD and FcRI-BALB Liganda FcRI-NOD FcRI-BALB Binding Ka Binding Ka ×109 M1 ×109 M1 Complexed IgG Rabbit IgG (EA)b + ND + ND Mouse IgG1 (EA)         Monomeric IgG Mouse IgG2a + 1.34  ± 0.41 (n=3) + 0.122  ± 0.48 (n=3) Human IgG1 + 1.64  ± 0.41 (n=5) + 0.133  ± 0.45 (n=5) a Complexed IgG binding by FcRI-transfected COS-7 cells was assessed using sheep erythrocytes sensitized with either rabbit or mouse IgG, and binding was scored (+) when 10 or more erythrocytes were bound by the COS-7 cell. Monomeric IgG binding was assessed by Scatchard analysis. b EA, erythrocyte coated with antibody; ND, not determined.

The reasons for the increased affinity were addressed by kinetic analysis of IgG binding (Fig. 7). The association of monomeric ¹²⁵I-hIgG1 with FcRI-NOD or FcRI-BALB showed identical kinetics, with 95% of maximum ligand bound by 30 min (4 °C) (Fig. 7A). By contrast, the dissociation of monomeric ¹²⁵I-hIgG1 from FcRI-NOD and FcRI-BALB was remarkably different (Fig. 7B). Whereas IgG showed a biphasic dissociation from FcRI-BALB with a rapid initial phase and a slower second phase, the dissociation from FcRI-NOD was extremely slow. Only a single phase was apparent, with <10% of bound IgG dissociated from FcRI-NOD after 45 min compared with ~75% from FcRI-BALB. The differences in dissociation of IgG from FcRI-NOD and FcRI-BALB were observed at both 4 and 22 °C.

Kinetics of association and dissociation of radiolabeled human IgG1 with FcRI.

Assessment of Expression and Dissociation Rate of FcRI on NOD Macrophages

It was of some concern that the differences between FcRI-BALB and FcRI-NOD had been defined using a somewhat artificial transfection system. Thus, a series of experiments were performed to analyze FcRI from macrophages derived from mice, and indeed, the results of the transfections were confirmed using macrophages. FACS analysis of expression of cell-surface markers and FcRI was performed on BALB/c or NOD/Lt bone marrow-derived macrophages treated with IFN- (to up-regulate mouse FcRI). Using the 2.4G2 antibody, it was found that the expression of the low affinity IgG receptors (FcRII/FcRIII) was approximately the same on both BALB/c- and NOD/Lt-derived macrophages (Fig. 8A). Similarly, both BALB/c- and NOD/Lt-derived macrophages expressed nearly identical levels of a macrophage marker detected by antibody F4/80 (Fig. 8B). In contrast, NOD/Lt-derived macrophages bound less monomeric human IgG via FcRI than did BALB/c-derived macrophages (Fig. 8C). Since no monoclonal anti-mouse FcRI is available, FcRI was detected by using monomeric human IgG in the presence of excess mAb 2.4G2 (which blocks any binding to FcRII/FcRIII) (Fig. 8C). The expression of FcRI on NOD/Lt-derived macrophages was ~5-fold lower than that of BALB/c-derived macrophages with (see above) or without IFN- (data not shown), indicating that the expression defect observed in the COS-7 transfection system is also observed in vivo on macrophages, although not to quite the same extent (10-fold versus 5-fold expression difference).

The slower dissociation of ligand from FcRI-NOD expressed on COS-7 cells was also observed using NOD/Lt-derived macrophages (Fig. 9). As previously observed, monomeric human IgG dissociates quickly from BALB/c FcRI and less quickly from NOD/Lt FcRI. Treatment of the macrophages with or without IFN- did not appear to influence the dissociation rate of monomeric IgG from macrophages from either strain of mouse (although FcRI expression levels were altered (data not shown)). As noted previously with the expression phenotype of FcRI from NOD/Lt-derived macrophages, the difference in the dissociation rate of IgG from FcRI on NOD/Lt- and BALB/c-derived macrophages was also not as dramatic as that seen in the COS-7 transfection system; however, the interaction of FcRI on NOD/Lt-derived macrophages was still dramatically different than that of FcRI on BALB/c-derived macrophages.

Kinetics of dissociation of radioiodinated human IgG1 from FcRI on bone marrow-derived macrophages incubated with or without IFN- and derived from either BALB/c or NOD/Lt mice.

DISCUSSION

The mutations of FcRI from the diabetes-prone NOD mouse have profound effects on receptor function. Whereas many protein mutations may result in loss of function, the FcRI-NOD mutations result in a 10-fold increase in receptor affinity. Since artificially introduced mutations in mouse FcRI are known to alter affinity and specificity (21), the binding of IgG to FcRI-NOD and FcRI-BALB was tested. The specificity of FcRI-NOD and FcRI-BALB was identical, with both receptors binding human IgG1, mouse IgG2a, and rabbit IgG, but not mouse IgG1 (Table I). The 10-fold increase in affinity was observed for both human IgG1 and mouse IgG2a. Through the use of chimeric receptors, the increased affinity of FcRI-NOD for ligand could be attributed to mutations in the extracellular (ligand-binding) domains rather than to a secondary effect of the transmembrane region and residual cytoplasmic tail.

Previous studies of mouse FcRI indicate that extracellular domain 3 is important in modulating the affinity and specificity of the receptor and that the first two domains interact with ligand with low affinity (21). It is interesting to note that there is a four-amino acid insertion between domains 2 and 3 of FcRI-NOD. In addition, the FcRI-BALB His²¹¹ to FcRI-NOD Tyr²¹⁶ mutation occurs in the body of domain 3, but is unlikely to affect binding as human FcRI contains tyrosine in this position (see Fig. 1). Many of the amino acid changes found in FcRI-NOD either are identical to normal human FcRI or are conservative changes. However, the insertion of Glu⁸⁹ between domains 1 and 2 and the substitution of Asp¹³⁵ (FcRI-BALB) for Gly¹³⁶ in FcRI-NOD are potentially more disruptive. Indeed, the Asp¹³⁵  Gly¹³⁶ mutation falls within a region homologous to Ig-interactive regions of FcRII (38, 39, 40), FcRIII (41), and FcRI (27). It is also possible, however, that the change in binding characteristics is due to a combination of the mutations.

In addition to the observed altered affinity, FcRI-NOD was expressed at approximately one-tenth of the level of FcRI-BALB in the COS-7 cell system. The mechanism of this difference remains unclear and could not be explained by the level of transient transfection efficiency or steady-state RNA amounts. Mouse FcRI is able to associate with the FcRI -subunit (Fig. 6); however, cotransfection of FcRI-NOD and FcRI -subunit cDNA does not rescue the expression of FcRI-NOD. The region in the transmembrane domain thought to be involved in the FcRI -subunit association is conserved between human FcRI and FcRI-NOD and was not expected to be disrupted by the truncation of the cytoplasmic tail of FcRI-NOD. This was formally demonstrated when chimeric FcRI mutants containing this sequence were shown to be able to associate with the FcRI -subunit.

The mutations within the extracellular domains of FcRI-NOD were shown to be involved in altering cell-surface expression as constructs containing FcRI-NOD transmembrane and residual cytoplasmic tail domains were expressed at levels comparable to those of human FcRI or FcRI-BALB. However, it is not clear how the extracellular domain mutations can affect the surface expression and whether the mutations affect processes such as translation, the assembly of the polypeptide, transport to the cell surface, or even stability of the protein.

By measuring the level of surface expression using total saturable ligand binding, it is possible that the reduced expression of functional FcRI-NOD is due to alterations in the receptor's configuration that allow only a small fraction (10%) of the total receptor pool to bind ligand rather than to a decrease in total receptor protein. Currently, this possibility cannot be directly tested as there are no mouse FcRI-specific antibodies (monoclonal or polyclonal) to evaluate total cell-surface receptor levels. Nonetheless, it is clear that the mutations in the extracellular domains of FcRI-NOD affect the levels of functional receptor on the cell surface.

Transfection of the FcRI cDNAs into COS-7 cells was chosen primarily as a way to study mouse FcRI in the absence of other Fc receptors with which it is normally coexpressed (necessary because of the lack of monoclonal antibody reagents); however, the disadvantage of the system is that COS-7 cells may lack other proteins necessary for mouse FcRI function. Indeed, although bone marrow-derived macrophages from NOD/Lt mice expressed less functional FcRI on their surface (Fig. 8), the expression difference varied between 3- and 5-fold less than that of FcRI from BALB/c-derived macrophages, not the reproducible 10-fold difference observed in the COS-7 system. This implies that other molecules, possibly even other Fc receptors, may play a role in the surface expression of functional FcRI. Indeed, the dissociation of IgG from FcRI on NOD/Lt-derived macrophages was again slower than that of FcRI on BALB/c-derived macrophages; however, the effect was less dramatic than that seen in the COS-7 system, again pointing to other molecules being involved with FcRI in macrophages. Despite this, however, the trend of higher affinity, slower dissociation, and lower expression was still observed in the NOD/Lt-derived macrophages.

The initial study of mutated FcRI-NOD also demonstrated a lower surface expression of functional FcRI on peripheral blood MAC-1⁺ cells from NOD mice (19). This study reported that immune complexes bound to this receptor were still present on the surface of NOD-derived cells and not on C57BL/10SnJ-derived cells after incubation of the cells at 37 °C for a few minutes. This observation indicates either that FcRI from NOD mice was unable to internalize the complexes or that the immune complexes bound well and had not dissociated from the receptor on NOD cells. The fact that FcRI-NOD demonstrated markedly reduced dissociation of ligand in the COS-7 system, demonstrated herein, directly supports the latter hypothesis.

The functional capacity of mouse FcRI on cells from NOD mice must be questioned as it appears that the mutations in the extracellular domains lead to reduced expression of functional receptor, and receptors that are expressed exhibit higher affinity for monomeric ligand. Not only is ligand bound, but it does not appear to dissociate normally, implying that mouse FcRI on NOD cells would be permanently saturated or perhaps continually signaling. The fact that FcRI-NOD can associate with the FcRI -subunit implies that signaling through this pathway may be intact. NOD mice, however, have numerous other defects, including aberrant protein kinase C function (42), and this, in conjunction with the FcRI-NOD phenotype, may affect immune complex and antigen-immune complex handling. As signaling via human FcRI in macrophages can lead to inflammatory mediator release such as interleukin-8 (43), interleukin-6 (44), and tumor necrosis factor (9), the role of dysfunctional mouse FcRI in the exacerbation of the NOD mouse pathology requires further investigation.