|
Volume 271, Number 29,
Issue of July 19, 1996
pp. 17417-17424
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
Platelet-derived Growth Factor Induction of the Immediate-early
gene MCP-1 Is Mediated by NF- B and a 90-kDa
Phosphoprotein Coactivator*
(Received for publication, February 20, 1996, and in revised form, April 25, 1996)
Rolf R.
Freter
,
John A.
Alberta
,
Grace Y.
Hwang
,
Amy L.
Wrentmore
and
Charles D.
Stiles
§
From the Department of Microbiology and Molecular Genetics,
Division of Clinical Oncology, and Division of Cellular and Molecular
Biology, Harvard Medical School and the Dana-Farber Cancer Institute,
Boston, Massachusetts 02115
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES
ABSTRACT
A broad panel of agents including serum,
interleukin-1, double-stranded RNA, and platelet-derived growth factor
(PDGF) stimulate transcription of the ``slow'' immediate-early gene
MCP-1. These disparate inducers act through a tight cluster
of regulatory elements in the distal 5 -flanking sequences of the
MCP-1 gene. We describe a 22-base element in this cluster
which, in single copy, confers PDGF-inducibility to a tagged
MCP-1 reporter gene. In mobility shift assays, the element
binds a PDGF-activated form of NF- B, and a 90-kDa protein (p90)
which binds constitutively. Antibody supershift and UV cross-linking
experiments indicate that the PDGF-activated NF- B species is a Rel A
homodimer. The DNA binding form of p90 is a nuclear-restricted
serine/threonine phosphoprotein. Mutagenesis of the 22-base element
shows that the NF- B and p90 binding sites overlap, but binding of
the two species is mutually independent. Both sites, however, are
required for optimum PDGF induction of MCP-1. Therefore,
p90 appears to be a coactivator with NF- B in PDGF-mediated induction
of MCP-1.
INTRODUCTION
Immediate-early genes are, by definition, induced at the
transcriptional level by a stimulus, and induction is not blocked by
drugs that inhibit protein synthesis (1, 2, 3, 4, 5). Currently there are
approximately 100 members of the immediate-early gene set. Because all
components of the transcriptional response pre-exist within cells,
cis- and trans-acting regulatory elements for the
immediate-early genes define convenient end points for analysis of
cellular signal transduction pathways.
A potentially useful means of subclassifying the growing set of
immediate-early genes, and one with apparent mechanistic implications,
is to divide the group into genes with ``fast'' or ``slow''
kinetics of induction. A well characterized example of a ``fast
kinetics'' immediate-early gene is c-fos. Platelet-derived
growth factor (PDGF)1 added to quiescent
3T3 cells stimulates transcription of c-fos within 10 min.
c-fos expression reaches peak levels within 30 min and
returns to baseline levels within 2 h (6, 7). A cluster of three
cis-acting regulatory elements, contained within the
proximal 5 -flanking sequences of c-fos, mediate serum and
growth factor-stimulated induction of c-fos and have proven
to be of general interest in problems of growth factor signal
transduction. The three functionally distinct c-fos elements
include a 22-nucleotide region of dyad symmetry, termed the ``serum
response element,'' a cyclic AMP response element, and an element
responsive to PDGF B:B homodimers known as the SIE (``sis-inducible
element'') (8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18). Nuclear trans-acting proteins
interacting with these cis-acting regulatory elements have
been isolated and characterized (19, 20, 21, 22, 23, 24, 25, 26, 27). By both sequence analysis and
functional analysis, the regulatory elements defined initially within
c-fos have also been detected within other fast kinetics
immediate-early genes, and appear to be required for their induction
(28, 29, 30).
The mechanisms underlying serum and growth factor-stimulated
transcription of the c-fos gene, however, do not appear to
be conserved among all members of the immediate-early gene set. Members
of a second subset of immediate-early genes are induced with slower
kinetics than c-fos (31, 32). Included in the ``slow
kinetics'' subset of immediate-early genes are the c-myc
proto-oncogene and the clinically important chemokine gene
JE/MCP-1 (for monocyte chemoattractant protein 1, hereafter
referred to as MCP-1) (33, 34, 35, 36). In contrast to the rapid but
transient response exhibited by c-fos, slow kinetics
immediate-early genes like c-myc and MCP-1
display a 60-90-min lag period before initiation of transcription in
response to serum or growth factor stimulation (7, 37, 38). Nuclear
run-off transcription analyses demonstrate that induction of
MCP-1 RNA by PDGF and serum is primarily the result of
increased transcription (31, 38, 39, 40). However, no fos-like
regulatory elements are found within several kilobases of 5 - or
3 -flanking sequences of the MCP-1 gene or within its coding
sequences. The distinct induction kinetics of the MCP-1
gene, and other slow immediate-early genes such as c-myc,
might therefore reflect the action of cis-acting genomic
elements distinct from the trio described for c-fos.
An obstacle to analysis of cis-acting regulatory elements
for the slow immediate-early genes has been achieving regulated
expression of these genes in transient transfections. This problem was
solved recently for MCP-1 with the discovery of a 7-base
motif, TTTTGTA, located in the proximal 3 MCP-1
untranslated sequences. This 7-mer is essential for regulated
expression of MCP-1 in transient transfections (41). The
discovery of the 3 7-mer enabled detection of a 240-bp DNA enhancer
fragment located 2.3 kb upstream of the MCP-1 transcription
start site. The 240-bp fragment contains a cis-acting
regulatory element(s) for serum, double-stranded RNA, interleukin-1 ,
and PDGF (41). When ligated to a truncated MCP-1 reporter
gene, the 240-base fragment mediates a slow and sustained induction of
the reporter gene, which parallels the response of the endogenous
MCP-1 gene to serum and PDGF. DNase I footprinting of the
240-bp MCP-1 enhancer fragment highlights four discrete
sequences protected by nuclear extracts prepared from PDGF-treated
murine 3T3 fibroblasts. Two of these sequences were described
previously (42). We now focus on a novel PDGF response element which
binds NF- B and a 90-kDa phosphoprotein.
EXPERIMENTAL PROCEDURES
Growth Factors and Reagents
Recombinant B:B isoform of PDGF
was obtained from Upstate Biotechnology, Inc. Ribonuclease A was from
Pharmacia. Proteinase K, ribonuclease T1, calf intestinal phosphatase
(CIP), and poly(dI-dC) were from Boehringer Mannheim Biochemicals.
Bovine calf serum was obtained from Hyclone. Human defibrinogenated
platelet-poor plasma was prepared as described (43). Monoclonal
antibodies to phosphoserine, phosphothreonine, and phosphotyrosine were
from Sigma. Polyclonal antibodies to Rel, Rel A, Rel
B, p50, p52, and JunD, and the peptides these antibodies were raised
against, were obtained from Santa Cruz Biotechnology. Synthetic
oligonucleotides were generated by Macromolecular Resources.
Cell Culture, DNA Transfections, Stimulation Assays, and RNA
Preparation and Analysis
NIH/3T3 cells were maintained in
Dulbecco's modified Eagle's medium (Life Technologies, Inc.)
supplemented with 10% bovine calf serum. NIH-3T3 cells were used for
transient transfections because of their significantly greater
transfection efficiency compared with Balb/c-3T3 cells. Twenty hours
prior to transfection, cells were plated at a density of 1.8 × 106 per 15-cm tissue culture dish.
Calcium-phosphate-mediated DNA transfections were performed as
described (10) with the following modifications. Cells were exposed to
DNA-containing precipitates for 6 h followed by a 2-min 20%
glycerin shock. Cells were then washed with Dulbecco's modified
Eagle's medium and placed in Dulbecco's modified Eagle's medium plus
5% platelet-poor plasma. Because of variable background levels of
MCP-1 transcripts in transfected cells made quiescent with
0.5% calf serum, we have found it more reliable to use 5%
platelet-poor plasma for making transfected cells quiescent after the
glycerin shock. Transfection mixtures included 35 µg of tagged
MCP-1 reporter constructs together with 3.5 µg of
-globin reference construct (pSV -1), a gift from M. Greenberg
(Harvard Medical School), per 15-cm tissue culture plate. After 40-44
h in 5% platelet-poor plasma, quiescent cells were exposed to the B:B
isoform of PDGF (30 ng/ml) for the times indicated in the figure
legends. Total RNA was prepared by the guanidinium isothiocyanate
method and purified on CsCl gradients (44).
Total RNA samples (30 µg) were analyzed by RNase protection assay as
described (45). RNase treatment was with 60 µg/ml RNase A and 2 µg/ml RNase T1 for 70 min at 35 °C. Nuclease-resistant fragments
were separated on 0.8-mm 6% polyacrylamide, 8 M urea gels.
Synthesis of labeled complementary RNA probes was as described (46)
using pGEM vectors (Promega). Probes were gel purified before use. The
probe for ``tagged'' MCP-1 expression is a 272-bp
HincII MCP-1 cDNA fragment spanning portions
of the second and third exons. The fragment is elongated by addition of
a 33-bp ``tag'' into a blunted SauI site and inserted into
the SmaI site of pGEM 7 (41). The length of the unprotected
probe is 377 bases. As a control for equal transfection efficiencies
between groups of cells, 15 µg of total RNA was assayed by RNase
protection for the presence of a constitutively active co-transfected
-globin construct. Exposure and quantitation of gels for all
experiments was performed on a PhosphorImager (Molecular Dynamics).
Oligonucleotides
The following double-stranded
oligonucleotides containing 5 overhanging GG (top strand) and CC
(bottom strand) ends were used. All sequences shown are of the top
strand. Mutations of element IV sequences are boldfaced and underlined:
element I, 5 -GGGCCTTTCCCTTGGCTGCTCCCAAG; element II,
5 -CCTTTGTTGAGTCATTTCAGATTCTCC; element III,
5 -AGAACTGCTTGGCTGCAGGCCCAGCATC; element IV,
5 -AGAATGGGAATTTCCACGCTCT; element IV, mut1
5 - AATGGGAATTTCCACGCTCT; element IV, mut2
5 -AG GGGAATTTCCACGCTCT; element IV, mut3
5 -AGAAT TTTCCACGCTCT; element IV, mut4
5 -AGAATGGGAA ACGCTCT; element IV, mut5
5 -AGAATGGGAATTTCC CTCT; element IV, mut6
5 -AGAATGGGAATTTCCACG CT; element IV, mut7
5 -AGAATGGGAATTTCCACGCT ; element IV, mut9
5 -AGAATGGGAATTT ACGCTCT; element IV (13),
5 -AATGGGAATTTCC; NF- B, 5 -GGGACTTTCCGGGACTTTCC.
Preparation of Nuclear and Cytoplasmic Extracts and
Electrophoretic Mobility Shift Assays
Nuclear and cytoplasmic
S100 extracts from Balb/c-3T3 fibroblasts (clone A31) were prepared as
described by Dignam et al. (47). Chemically synthesized
oligonucleotides were annealed and labeled with
32P-nucleotides by fill-in with the Klenow fragment of DNA
polymerase I. Radiolabeled double-stranded oligonucleotides were gel
purified prior to use as probes in electrophoretic mobility shift
assays. Binding reactions contained 10-15 µg of fibroblast nuclear
extracts and 10,000 cpm (0.05-0.15 ng) radiolabeled oligonucleotide
probe. Shifts were performed in a binding buffer of 10 mM
Tris (pH 7.5), 5% (v/v) glycerin, 50 mM NaCl, 1 mM EDTA, and 1 mM dithiothreitol and final
volume of 20 µl. Following 30-min incubations on ice, DNA-protein
complexes were electrophoresed on 4% native polyacrylamide gels at 150 V at room temperature in 0.25 × TBE buffer. For antibody
supershift or competition experiments, antibodies or 100-1000-fold
excesses of unlabeled oligonucleotides were added for a 30-min
incubation on ice prior to addition of radiolabeled oligonucleotide
probe.
UV Cross-linking
UV cross-linking was performed as
described with the following modifications (48). Mobility shift
reactions were set up in 1.5-ml Eppendorf tubes on ice. After a 30-min
incubation with radiolabeled probe, UV cross-linking was performed
directly on the open tubes. Cross-linked complexes were resolved on 4%
native gels.
Plasmid Construction
A murine MCP-1 genomic
clone (pGMJE-1) with 466 bp of 5 -flanking sequences and 1.9 kb of
3 -flanking sequences was a gift from B. Rollins (Dana-Farber Cancer
Institute). The MCP-1 construct was originally inserted into
the EcoRI site of pGEM-1 (34). A non-inducible tagged
MCP-1 construct (construct T in Figs. 1, 2, and 6) was
created by blunt ligation of a 33-bp XhoI-ClaI
fragment of the pGEM-7 polylinker to a SauI site in the
third exon of pGMJE-1 (1049 nucleotides downstream of the transcription
start site). An identical 33-bp tag was inserted into the RNase
protection probe vector described above.
Fig. 1.
PDGF induction of MCP-1 involves
three distinct elements within a 240-bp enhancer fragment.
A, shown in schematic form (construct T) is the structure of
the 5 end of a non-inducible tagged MCP-1 reporter gene
(pGMJE-1) which includes 466 bp of 5 -flanking sequences and 1.9 kb of
3 -untranslated sequences. All additional constructs are derived from
construct T by addition of the shown 240-bp fragment or double-stranded
oligonucleotides. The 240-bp fragment is present in the distal 5
MCP-1 flanking sequences (with ends at 2537 and 2298 bp
relative to the MCP-1 start of transcription) and is added
back in the in vivo orientation. Sequences of
MCP-1 elements I-IV are listed under ``Experimental
Procedures.'' The rightward-facing bold arrow above each
element denotes readdition in the in vivo orientation.
B, RNase protection assays on 30 µg of total cellular RNA
from fibroblasts transfected with 35 µg of the shown constructs,
allowed to become quiescent, and then not exposed ( ) or exposed to
the B:B isoform of PDGF (30 ng/ml) for 1.5 or 3 h. The
upper and lower arrows highlight the 305- and
241-nucleotide protected fragments corresponding to expression of
transfected MCP-1 constructs and endogenous
MCP-1, respectively. PhosphorImager images were designed to
optimally demonstrate expression of the transfected constructs. Equal
inductions of the 240-bp addback construct and endogenous
MCP-1 were observed in all experiments. The experiment was
performed three times with similar results. PDGF inductions at the 3-h
time point were quantitated on a PhosphorImager. The inductions
observed at 3 h with elements I, II, III, and IV were 4, 31, 19, and 54%, respectively, of the induction observed with the intact
240-bp addback construct (set at 100%). C, RNase protection
assays on 15 µg of total cellular RNA from the transfections shown in
panel B with an -globin riboprobe.
Fig. 2.
PDGF-inducible and constitutive proteins bind
element IV. a, radiolabeled double-stranded oligonucleotide
probe, corresponding to element IV, was used in mobility-shift assays
with 15 µg of nuclear extracts prepared from quiescent fibroblasts
( ) or fibroblasts treated with the B:B isoform of PDGF (30 ng/ml) for
1.75 h (+). Increasing amounts of each of the shown unlabeled
double-stranded oligonucleotides were used as competitors in 100-, 250-, and 1000-fold excess. Upper and lower
arrows show the positions of the PDGF-inducible and constitutive
element IV binding complexes, respectively. Free probe is not shown in
this experiment. No complexes were observed with probe alone in the
absence of extract (data not shown). b, radiolabeled
double-stranded oligonucleotide probe, corresponding to element IV, was
used in mobility-shift assays with 15 µg of nuclear extracts prepared
from fibroblasts treated with the B:B isoform of PDGF (30 ng/ml) for
1.75 h. The shown double-stranded oligonucleotides, corresponding
to unlabeled wild type element IV (wt), 7 non-overlapping mutants of
element IV (M1-M7), element II (II), or element III (III) were used as
competitors in 250-fold excess. Sequences of the oligonucleotide
competitors are listed under ``Experimental Procedures.''
Upper and lower arrows show the positions of the
PDGF-inducible and constitutive element IV binding complexes,
respectively. Free probe is not shown in this experiment. No complexes
were observed with probe alone in the absence of extract (data not
shown). c: A, shown in schematic form (construct
T) is the structure of the 5 end of a non-inducible tagged
MCP-1 reporter gene (pGMJE-1) which includes 466 bp of
5 -flanking sequences and 1.9 kb of 3 -untranslated sequences. All
additional constructs are derived from construct T by addition of the
shown double-stranded oligonucleotides corresponding to wild type
element IV (wt) or element IV mutants 3 and 4 (mut 3 and mut 4, respectively). Sequences of the oligonucleotides are listed under
``Experimental Procedures.'' The rightward-facing bold
arrow above each element denotes readdition in the in
vivo orientation. B, RNase protection assays on 30 µg
of total cellular RNA from fibroblasts transfected with 35 µg of the
shown constructs, allowed to become quiescent, and then not exposed
( ) or exposed to the B:B isoform of PDGF (30 ng/ml) for 1.5 or 3 h. The upper and lower arrows highlight the 305- and 241-nucleotide protected fragments corresponding to expression of
transfected MCP-1 constructs and endogenous
MCP-1, respectively. PhosphorImager images were designed to
optimally demonstrate differences in expression of the transfected
constructs. C, RNase protection assays on 15 µg of total
cellular RNA from the transfections shown in panel B with an
-globin riboprobe.
Fig. 6.
PDGF induction of MCP-1 requires
both NF- B and p90. a, radiolabeled double-stranded
oligonucleotide probes, corresponding to wild type element IV (wt) and
element IV mutants 2 or 9 (mut 2 and mut 9, respectively), were used in
mobility shift assays with 15 µg of nuclear extracts prepared from
quiescent fibroblasts ( ) or fibroblasts treated with the B:B isoform
of PDGF (30 ng/ml) for 1.75 h (+). Sequences of the
oligonucleotides are listed under ``Experimental Procedures.'' The
upper and lower arrows show the positions of the
PDGF-inducible and constitutive (p90) element IV binding complexes,
respectively. Free probe is not shown in this experiment. No complexes
were observed with probe alone in the absence of extract (data not
shown). b, A, shown in schematic form (construct T) is the
structure of the 5 end of a non-inducible tagged MCP-1
reporter gene (pGMJE-1) which includes 466 bp of 5 -flanking sequences
and 1.9 kb of 3 -untranslated sequences. The additional constructs are
derived from construct T by addition of the shown double-stranded
oligonucleotides corresponding to wild type element IV (wt) or element
IV mutants 2 and 9 (mut 2 and mut 9, respectively). The
rightward-facing bold arrow above an element denotes
readdition in the in vivo orientation. B, RNase
protection assays on 30 µg of total cellular RNA from fibroblasts
transfected with 35 µg of the shown constructs, allowed to become
quiescent, and then not exposed ( ) or exposed to the B:B isoform of
PDGF (30 ng/ml) for 1.5 or 3 h. The upper and
lower arrows highlight the 305- and 241-nucleotide protected
fragments corresponding to expression of transfected MCP-1
constructs and endogenous MCP-1, respectively.
PhosphorImager images were designed to optimally demonstrate
differences in expression of the transfected constructs. C,
RNase protection assays on 15 µg of total cellular RNA from the
transfections shown in B with an -globin riboprobe.
Addback constructs shown in Figs. 1, 2, and 6 were generated by blunt
ligation of MCP-1 genomic sequences or double-stranded
synthetic oligonucleotides to tagged pGMJE-1 (construct T in Figs. 1,
2, and 6) opened with XbaI. The 240 construct in Fig. 1 was
generated by blunt ligation of a 240-bp
SmaI-HincII MCP-1 fragment (with ends
at 2537 and 2298 bp relative to the MCP-1 start of
transcription) to SalI opened construct 1 (41, 42). All
other constructs cited in Figs. 1, 4, and 7 were generated by blunt
ligations of the relevant double-stranded synthetic oligonucleotides to
XbaI opened construct T. All constructs were checked for
accuracy by DNA sequencing (49).
Fig. 4.
Characterization of PDGF-inducible binding to
element IV. A, a radiolabeled double-stranded
oligonucleotide probe corresponding to element IV was used in mobility
shift assays with 15 µg of nuclear extracts prepared from quiescent
fibroblasts ( ) or fibroblasts treated with the B:B isoform of PDGF
(30 ng/ml) for 1.75 h (+). Rabbit polyclonal antibodies raised
against Rel A or the 50-kDa subunit (p50) of NF- B (1 and 3 µg in
lanes 3 and 4 or 5 and 6,
respectively), or raised against the 52-kDa subunit (p52), or Rel
subunits of NF- B, or JunD (3 µg in all cases) were used for
supershifts. Upper and lower arrows show the
positions of the supershifted and unaltered PDGF-inducible complexes
binding element IV, respectively. Addition of the peptide used to
generate the Rel A antibody abolished the supershifts (data not shown).
DNA-protein complexes were not observed with any of the antibodies and
radiolabeled probe in the absence of nuclear extract (data not shown).
Free probe is not shown in this experiment. No complexes were observed
with probe alone in the absence of extract (data not shown).
B, a radiolabeled 5-bromodeoxyuridine substituted
double-stranded oligonucleotide probe corresponding to element IV (top
strand substituted) was used in mobility shift assays with nuclear
extracts prepared from fibroblasts treated with the B:B isoform of PDGF
(30 ng/ml) for 1.75 h. Complexes were initially UV irradiated with
2000 µJ, 1000 µJ, or mock irradiated (0), followed by
electrophoresis on 4% nondenaturing polyacrylamide gels. Only the
PDGF-inducible DNA-protein complex binding element IV was excised from
the nondenaturing gel and resolved by electrophoresis in an 8%
SDS-polyacrylamide protein gel. Molecular weight standards (kDa) are
shown at the left.
Fig. 7.
p90 is a serine-threonine phosphoprotein.
A, a radiolabeled double-stranded oligonucleotide probe
corresponding to element IV was used in mobility shift assays with 15 µg of nuclear extracts prepared from quiescent fibroblasts ( ) or
fibroblasts treated with the B:B isoform of PDGF (30 ng/ml) for
1.75 h (+). CIP pretreatment was with 2 units/µl for 30 min at
30 °C. Buffer denotes addition of the CIP storage buffer
alone for a 30-min incubation at 30 °C. Upper and
lower arrows show the positions of the PDGF-inducible and
constitutive element IV binding complexes, respectively. Free probe is
not shown in this experiment. No complexes were observed with probe
alone in the absence of extract (data not shown). B, a
radiolabeled double-stranded oligonucleotide probe corresponding to
element IV mutant 9 was used in mobility shift assays with 15 µg of
nuclear extracts prepared from quiescent fibroblasts ( ) or
fibroblasts treated with the B:B isoform of PDGF (30 ng/ml) for
1.75 h (+). S, monoclonal anti-phosphoserine antibodies
(Ab) added to supershifts (25 and 50 µg in lanes
2 and 3 or 8 and 9,
respectively). T, monoclonal anti-phosphothreonine
antibodies added to supershifts (6 and 13 µg in lanes 4 and 5 or 10 and 11, respectively).
Y, monoclonal anti-phosphotyrosine antibodies added to
supershifts (33 µg in lanes 6 and 12). Only the
constitutive (p90) element IV binding complexes is shown. Free probe is
not shown in this experiment. No complexes were observed with probe
alone in the absence of extract (data not shown).
RESULTS
PDGF Induction of MCP-1 Involves Three Distinct DNA
Elements
DNase I footprinting of the 240-bp MCP-1
enhancer fragment highlighted four discrete elements protected by
nuclear extracts prepared from PDGF-treated murine 3T3 fibroblasts
(42). Initial experiments examined the contributions of each of the
four elements compared to the PDGF induction observed with the intact
240-bp MCP-1 5 enhancer. The four elements were added back
individually to a 5 -truncated non-inducible MCP-1 reporter
gene and the resulting constructs tested for PDGF-inducibility in
transient transfections. MCP-1 addback constructs containing
elements II, III, or IV were all PDGF-inducible in these experiments
(Fig. 1). Summing the inductions observed with the
single element addback constructs at 1.5 or 3 h of PDGF treatment
equaled the induction observed with the 240-bp addback construct at
either time (Fig. 1). These latter findings suggest that synergistic
interactions between the four elements do not occur to a significant
degree in transient transfections. Second, the major elements
conferring PDGF-inducibility onto the truncated MCP-1 gene
are elements II and IV (Fig. 1).
PDGF-inducible and Constitutive Proteins Bind Element
IV
Synthetic oligonucleotides corresponding to element IV were
employed as double-stranded DNA probes in mobility shift assays using
nuclear extracts prepared from quiescent and PDGF-stimulated
fibroblasts. In these experiments both a strongly PDGF-inducible
protein complex, and a more rapidly migrating constitutively present
complex, bound labeled element IV (Fig. 2a,
upper arrow and lower arrow, respectively). Both
element IV binding complexes were also observed in nuclear extracts
prepared from PDGF-stimulated fibroblasts concurrently treated with
cycloheximide (data not shown). Binding of both complexes was specific
as it was competed by unlabeled oligonucleotide corresponding to
element IV but not competed by an unrelated oligonucleotide
corresponding to MCP-1 element II (Fig. 2a). An
oligonucleotide consisting of two tandem NF- B binding sequences also
competed PDGF-inducible binding to element IV. In contrast, the NF- B
oligonucleotide did not compete the constitutively bound complex (Fig.
2a, lanes 6-8), suggesting that the latter is
distinct in nature from the PDGF-inducible complex. These data also
demonstrate that binding of the constitutive complex occurs
independently of PDGF-inducible binding to element IV.
To better delineate the precise sequences required for protein binding
to the 22-base element IV, we performed mobility shifts using a series
of mutant competitors (i.e. seven, 22-base long,
double-stranded oligonucleotides containing non-overlapping, two to
five base, mutations spanning the length of element IV). Sequences
required for binding of the PDGF-inducible and/or constitutive protein
complexes to element IV, when altered in a mutant oligonucleotide,
should result in diminished or absent competition of one or both
complexes by the given mutant oligonucleotide competitor. Mutants 1, 5, 6, and 7 quantitatively competed all protein binding to element IV
probe (Fig. 2b), suggesting that the sequences altered in
these four mutants are not required for protein binding to element IV.
In contrast, mutants 3 and 4, corresponding to mutations in the first
half and second half of the decameric B motif (GGGAATTTCC) contained
within element IV, respectively, did not compete the PDGF-inducible
complex binding element IV, and only partially competed the
constitutive complex binding element IV (Fig. 2b). Mutant 2, containing three altered nucleotides immediately 5 to the B motif,
quantitatively competed the PDGF-inducible complex binding element IV.
Mutant 2, however, only partially competed constitutive binding to
element IV when compared with mutants 1, 5, 6, and 7 (Fig.
2b). These data suggest that no more than 13 of the 22 bases
constituting element IV (i.e. the combined length of
sequences altered in mutants 2, 3, and 4) are required for constitutive
and PDGF-activated protein binding to element IV. In agreement with
this prediction, similar PDGF-inducible and constitutive protein
complexes were observed in mobility shifts using probes corresponding
to full-length element IV and a truncated element IV, the latter
containing only the 13 bases altered in mutants 2, 3, and 4 (data not
shown). In the competition experiments mutants 1, 5, 6, and 7 reproducibly competed constitutive binding to element IV more
efficiently than wild type element IV competitor (Fig. 2b).
The reason(s) for this enhanced competitive efficiency are unclear.
Time courses of PDGF stimulation, using wild type element IV and mutant
3 and 4 addback constructs, were determined in transient transfections
(Fig. 2b). As would be predicted from the results shown in
Fig. 2b, using mutants 3 and 4 as probes in mobility shift
assays resulted in no appreciable protein binding compared with binding
to a wild type element IV probe (data not shown). Addback constructs
containing mutants 3 and 4 exhibited considerably decreased PDGF
inductions at both 1.5 and 3 h of stimulation compared with the
wild type element IV addback construct (63 and 91% decreases at 3 h, respectively, the time of maximum induction of the wild type element
IV addback construct) (Fig. 2c). Hence, two separate
mutations, which ablate the interaction(s) between element IV and
nuclear proteins in vitro, greatly diminish biological
function in vivo (Fig. 2c). The minimal
PDGF-inducibility noted with the element 3 addback construct is most
likely due to a small degree of transcription factor binding to the
mutated element in vivo (i.e. in the
transfections), which is not observed in the in vitro
mobility shift competition experiments.
Taken together, these data suggest the PDGF-inducible protein complex
binding element IV includes member(s) of the NF- B/Rel family of
transcription factors. The constitutive protein complex binding element
IV appears to be distinct from the PDGF-inducible complex, and binds to
a site partially overlapping the B motif in element IV. These data
also establish a correlation between protein binding to element IV and
PDGF-mediated induction of MCP-1 RNA.
PDGF-activated Binding to Element IV Occurs with Delayed
Kinetics
The time course of PDGF-activated binding to element IV
was determined using nuclear extracts prepared from quiescent
fibroblasts or fibroblasts treated with PDGF for increasing times. A
low basal level of the PDGF-activable complex was observed in quiescent
cells (Fig. 3, upper arrow). PDGF-activated
binding to element IV occurred with slow kinetics. No increase in
binding was observed during the first hour of PDGF treatment. Maximum
binding to element IV occurred after 2 h of PDGF treatment (Fig.
3, upper arrow). The slow kinetics of PDGF-activated binding
to element IV closely parallel the slow kinetics of PDGF induction of
MCP-1 RNA (42) suggesting a connection between the two.
Fig. 3.
PDGF-inducible binding to element IV occurs
with delayed kinetics. A radiolabeled double-stranded
oligonucleotide probe, corresponding to element IV, was used in
mobility shift assays with 15 µg of nuclear extracts prepared from
quiescent fibroblasts (0) or fibroblasts treated with the B:B isoform
of PDGF (30 ng/ml) for the shown times (in hours). Upper and
lower arrows show the positions of the PDGF-inducible and
constitutive element IV binding complexes, respectively. Free probe is
not shown in this experiment. No complexes were observed with probe
alone in the absence of extract (data not shown).
Characterization of PDGF-inducible and Constitutive Proteins
Binding Element IV
Competition experiments suggested that
PDGF-inducible binding to element IV is a form of NF- B (Fig. 2,
a and b). To characterize PDGF-inducible binding
further, antibodies to the five proteins known to comprise the NF- B
transcription factor were used in mobility supershift analyses. Only
those antibodies specific for Rel A (formerly p65) supershifted
PDGF-inducible binding to element IV (Fig. 4,
A). As a control for the specificity of these results,
antibodies raised against Rel B (data not shown), p50, p52, and Rel, as
well as the unrelated transcription factor JunD, were also tested and
did not supershift the PDGF-inducible species (Fig. 4, A).
Two doses of anti-Rel A and anti-p50 (1 and 3 µg) were used in these
experiments. PDGF-inducible binding to element IV was quantitatively
supershifted upon addition of 1 µg of anti-Rel A (Fig. 4, A,
lane 3). In contrast, PDGF-inducible binding to element IV was
somewhat diminished, in the absence of a supershift, upon addition of
the larger amount of anti-p50 (Fig. 4, A, lane 6). As a
positive control for the p50 antibodies used in these experiments, we
demonstrated that these antibodies could supershift recombinant p50
homodimers bound to element IV (data not shown). Given that the p50
antibodies quantitatively supershifted a p50-containing complex in
these additional mobility shifts, it is unlikely that the
PDGF-inducible complex binding element IV contains the p50 subunit of
NF- B. Last, selective UV cross-linking of the PDGF-inducible complex
binding element IV detected only a single 65-kDa protein, consistent
with the known mass of Rel A (65 kDa) (Fig. 4, B). Taken
together, these data suggest that the NF- B species comprising
PDGF-inducible binding to element IV is a Rel A homodimer. It should be
noted that the B site contained within element IV (GGGAATTTCC) is an
ideal binding site for Rel A (p65) homodimers (50).
Selective UV cross-linking of the constitutive complex binding element
IV detected only a single 90-kDa species, to be called p90 in the
remainder of the text (Fig. 5, A). To
determine the cellular location(s) of p90, nuclear and cytoplasmic
extracts were prepared from the same groups of quiescent or
PDGF-treated fibroblasts and used in mobility shift assays. p90 binding
to element IV was observed only in nuclear extracts (Fig. 5, B,
lower arrow). As a control for the integrity of the cytoplasmic
extracts, PDGF-inducible binding to element IV was observed in both
nuclear and cytoplasmic extracts (Fig. 5, B, upper
arrow).
Fig. 5.
Characterization of the constitutive protein
complex binding element IV. A, a radiolabeled
5-bromodeoxyuridine substituted double-stranded oligonucleotide probe
corresponding to element IV (top strand substituted) was used in
mobility shift assays with nuclear extracts prepared from quiescent
fibroblasts ( ) or fibroblasts treated with the B:B isoform of PDGF
(30 ng/ml) for 1.75 h (+). Complexes were initially UV irradiated
with 1000 µJ followed by electrophoresis on 4% nondenaturing
polyacrylamide gels. Only the constitutive DNA-protein complex binding
element IV was excised from the nondenaturing gel and resolved by
electrophoresis in an 8% SDS-polyacrylamide protein gel. Molecular
mass standards (kDa) are shown at the left. Similar results
are observed with 500 µJ UV irradiation (data not shown). No
cross-linking was observed in the absence of UV irradiation (data not
shown). B, a radiolabeled double-stranded oligonucleotide
probe corresponding to element IV was used in mobility-shift assays
with 15 µg of nuclear (N) or cytoplasmic (C) extracts
prepared from quiescent fibroblasts ( ) or fibroblasts treated with
the B:B isoform of PDGF (30 ng/ml) for 1.75 h (+).
Upper and lower arrows show the positions of the
PDGF-inducible and constitutive element IV binding complexes,
respectively. Free probe is not shown in this experiment. No complexes
were observed with probe alone in the absence of extract (data not
shown).
PDGF Induction of MCP-1 Requires Both NF- B and
p90
Mutational analysis of element IV established a correlation
between PDGF-inducible and constitutive (p90) proteins binding element
IV, and PDGF induction of MCP-1 (Fig. 2, c).
Those data did not, however, resolve whether both species together are
required for PDGF induction of MCP-1. To address this
question, additional mutants of element IV were generated which bound
either p90 or NF- B, but not both, and their PDGF-inducibility
determined in transient transfection experiments. Mutant 2 was
described previously (Fig. 2) and contains 3 altered nucleotides
immediately 5 to the element IV B motif. In mobility shift assays,
p90 only minimally bound mutant 2 probe (seen only upon overexposure of
the gel), whereas PDGF-inducible NF- B binding to mutant 2 was
undiminished compared with the wild type element IV probe (Fig.
6a). A second mutant, mutant 9, contains 2 altered nucleotides at the 3 end (positions 9 and 10) of the decameric
element IV NF- B binding site. In mobility shift assays p90 bound
equally well to mutant 9 and wild type element IV probes, whereas the
PDGF-inducible NF- B species bound a mutant 9 probe very poorly
compared with its binding to a wild type element IV probe (Fig. 6,
a).
Mutant 2 and 9 addback constructs exhibited considerably decreased PDGF
inductions at both 1.5 and 3 h of stimulation compared with the
wild type element IV addback construct in transient transfections (62 and 78% decreases at 3 h, respectively, the time of maximum
induction of the wild type element IV addback construct) (Fig. 6,
b). Hence, two element IV mutants which bind either the
PDGF-inducible NF- B (Rel A) species or p90, but not both, each
confer significantly decreased PDGF-inducibility on a non-inducible
MCP-1 reporter construct when added back in single copy.
These data suggest that both NF- B and p90 together are required for
optimum PDGF induction of MCP-1 via element IV.
p90 Is a Serine/Threonine Phosphoprotein
Pretreatment of
nuclear extracts from quiescent or PDGF-stimulated fibroblasts with CIP
decreased the migration of the p90 complex in native gels, but did not
significantly decrease p90 binding to element IV (Fig.
7, A, lower arrow). In contrast, migration of
the PDGF-inducible complex binding element IV was not significantly
altered by CIP treatment (Fig. 7, A, upper arrow). As an
additional control, no difference in migration of the p90 complex was
noted after pretreatment of nuclear extracts with CIP storage buffer
alone (Fig. 7, A). Furthermore, no change in migration of
free element IV probe was noted after pretreatment of nuclear extracts
with CIP or storage buffer alone (data not shown). Changes in p90
migration after CIP treatment are consistent with a loss of
phosphate(s), thereby decreasing the mobility of p90 in native gels
through loss of negative charge(s).
To determine the identity of the phosphorylation site(s) on p90,
nuclear extracts prepared from quiescent or PDGF-treated fibroblasts
were used in mobility ``supershift'' assays in conjunction with three
monoclonal antibodies specific for the phosphorylated forms of serine,
threonine, or tyrosine. An element IV mutant 9 probe was used in these
experiments to examine the effects of the added antibodies on p90
binding alone. Binding of p90 is decreased, in a
dose-dependent manner, in the presence of monoclonal
anti-phosphoserine or anti-phosphothreonine antibodies (Fig. 7,
B). These data are consistent with antibody binding to
phosphoserine(s) or phosphothreonine(s) on p90 thereby sterically
interfering with p90 binding to the mutant 9 probe. In contrast, p90
binding was not affected by addition of monoclonal anti-phosphotyrosine
antibody (Fig. 7, B). As each of the monoclonal antibodies
is provided as ascites fluid, the latter results using monoclonal
anti-phosphotyrosine antibody constitute a control for the specificity
of the findings with the monoclonal anti-phosphoserine and
anti-phosphothreonine antibodies.
DISCUSSION
Three Discrete PDGF-regulated Genomic Elements Mediate Induction of
the MCP-1 Gene
The mechanisms underlying PDGF induction of a
growing class of slow immediate-early genes, induced with slower
kinetics than the well studied c-fos gene, remain
incompletely resolved. In this study we show that four distinct
elements, contained within a 240-bp PDGF-regulated enhancer present 2.3 kb upstream of the MCP-1 transcription start site, are
capable of restoring PDGF-inducibility to different degrees in
transient transfections (Fig. 1). Interestingly, the sum of the
inductions obtained with the individual elements is similar to the PDGF
induction obtained with the complete 240-bp enhancer (Fig. 1),
suggesting that synergistic interactions between the four elements are
not occurring to a significant extent in these transfections. We have
shown previously that the proteins binding MCP-1 elements
II, III, and IV are unrelated in mobility shift competitions (elements
I and IV contain similar sequences and bind related PDGF-activated
proteins) (42), suggesting that PDGF induction of MCP-1 in
fibroblasts occurs via at least three different PDGF-activated
signaling pathways.
Whether the three PDGF-activated signal transduction pathways originate
from different signal-generating regions of the PDGF receptor, or
represent bifurcations from a common cytoplasmic or membrane signaling
protein, remains to be determined. Given the marked sequence
dissimilarity of elements II, III, and IV, and the apparent
unrelatedness in mobility shifts of the proteins binding these
elements, a less likely scenario would include a common signaling
intermediate acting directly on all the DNA-binding proteins involved.
Recent evidence suggests that src kinase is required for
PDGF induction of c-myc, another member of the slow kinetics
subset of immediate-early genes (51). Given the conserved nature of
control elements among members of the fast kinetics subset of
immediate-early genes (17), it is not unlikely that a src
kinase is an intermediate in at least one of the pathways involved in
PDGF induction of MCP-1.
A PDGF-inducible NF- B Species and a Constitutively Present
Phosphoprotein (p90) Bind Element IV
Mobility shifts using
nuclear extracts prepared from quiescent and PDGF-treated fibroblasts
demonstrated two distinct protein complexes binding element IV. One
complex is PDGF-inducible (Fig. 2a, upper arrow). Evidence
presented herein suggests the PDGF-inducible complex binding to element
IV is a Rel A homodimeric species of NF- B (Figs. 2 and 4). Of note,
the B motif present within element IV (GGGAATTTCC) has been shown
previously to be an ideal binding sequence for Rel A homodimers
(50).
We have also provided evidence that a second, constitutively binding
protein complex contains a 90-kDa nuclear-restricted, serine/threonine
phosphoprotein which we have termed p90 (Figs. 5 and 7). Mutational
analysis of element IV, most informatively element IV mutants 2 and 9, demonstrated the binding site for p90 partially overlaps the B site
within element IV (Fig. 6). From these results the maximal sequence
required for p90 binding can be inferred to be an 11-mer, AATGGGAATTT.
Sequence comparisons reveal no known transcription factor-binding
sequences matching this predicted 11-bp p90-binding site. These
findings suggest p90 is a novel DNA-binding phosphoprotein.
NF- B and p90 Together Are Required for PDGF Induction of MCP-1
via Element IV
Two element IV mutants, mutants 2 and 9, were
shown to bind only NF- B or p90, respectively, in mobility shifts
(Fig. 6). MCP-1 addback constructs containing either mutant
2 or mutant 9, however, demonstrate significantly less PDGF-inducible
expression than a wild type element IV addback construct in transient
transfections (Fig. 6). Since PDGF induction of MCP-1 has
been shown previously to be the result of increased transcription (31,
38, 39, 40, 52), these data are strongly consistent with NF- B and p90
together being required for increased transcription of the
MCP-1 immediate-early gene in response to PDGF. p90
therefore appears to function as a coactivator with NF- B in PDGF
induction of MCP-1 via element IV. These results would also
predict that in vivo both NF- B and p90 bind element IV
simultaneously, forming a large ternary complex, while participating in
PDGF induction of MCP-1. Consistent with this prediction are
the results of mobility shift experiments using increasing amounts of
nuclear extracts prepared from PDGF-treated fibroblasts, which
demonstrated an additional complex binding element IV specifically and
migrating more slowly than the individual NF- B or p90 complexes,
under conditions of extract excess (data not shown).
Also consistent with a dual requirement for NF- B and p90 in PDGF
induction of MCP-1, are the results of transient transfections using an
element I MCP-1 addback construct. Element I contains a B
motif within its sequences (GGGCCTTTCC), and in mobility shift assays
binds a PDGF-inducible complex which co-migrates with the
PDGF-inducible (NF- B) complex binding element IV (data not shown).
Element I, however, does not bind p90 (data not shown), and the element
I containing MCP-1 reporter construct is only minimally
PDGF-inducible in transient transfections (Fig. 1).
Our data suggest that the -chemokine MCP-1 (36), a member
of the slow kinetics subset of immediate-early genes, is one of a small
group of genes regulated by the Rel A homodimeric form of NF- B.
Another group has recently suggested a role for NF- B in inducible
transcription of MCP-1 in several tumor cell lines (53).
This study, however, did not characterize the species of NF- B
mediating transcriptional stimulation, nor was the apparent requirement
for a coactivator with NF-kB noted in the study (53). The latter
discrepancy is likely due to the use of chloroamphenicol
acetyltransferase constructs. Chloramphenicol acetyltransferase
constructs often exhibit high degrees of basal (unstimulated)
expression in transient transfections, thereby minimizing the induction
observed after a growth factor or cytokine stimulus (potentially
obscuring the effects of a required coactivator with NF- B).
A large body of literature strongly supports the participation of
NF- B, primarily as a p50/p65 (Rel A) heterodimer, in the
transcription of many genes (54, 55, 56, 57). In contrast, Rel A homodimers
have been proposed to play a role in the transcriptional control of a
much smaller group of genes including, intracellular adhesion
molecule-1 (58), mucosal vascular addressin cell adhesion molecule 1 (59), interleukin 2 (60), and interleukin 8 (61). It is interesting
that the genes for the -chemokine interleukin-8 (36) and
-chemokine MCP-1 both appear to require activation of the Rel A
homodimeric form of NF- B for transcriptional induction in response
to growth factors or cytokines. Given the conserved nature of control
elements among members of the fast kinetics subset of immediate-early
genes, it is quite possible that Rel A homodimers, or other members of
the NF- B/Rel family of transcription factors, also play a role in
growth factor induction of other slow kinetics immediate-early genes
such as c-myc.
Our results also suggest that p90 functions as a coactivator with
NF- B participating in PDGF induction of MCP-1. Another
coactivator with NF- B, the high mobility group protein, HMG I(Y),
has been shown to operate in viral induction of the human
interferon- gene (62). p90 appears to be distinct from HMG I(Y) in
several important respects. HMG I(Y) was described as an approximately
13-kDa basic protein which binds to A-T rich regions within the
-interferon B site, thereby facilitating the binding of NF- B
to its decameric site (62). Furthermore, HMG I(Y) appears to act
specifically with the p50-Rel A heterodimeric form of NF- B (63). In
contrast, p90 is considerably larger than HMG I(Y) and binds to a
previously unreported sequence which only partially overlaps the
MCP-1 element IV B motif. p90 also appears to interact
with the Rel A homodimeric form of NF- B. Last, binding of p90 and
NF- B to element IV appear to be mutually independent events (Figs.
2a and 6a). The apparent requirement for p90 in
PDGF induction of MCP-1 effectively adds an additional level
of regulation on the function of the potent transcription factor
NF- B. Requirements for coactivators like p90, therefore, can be a
mechanism by which specificity of growth factor-stimulated
transcriptional responses may be achieved using powerful and widely
present transcription factors such as NF- B.
FOOTNOTES
*
This research was supported by Grant CA22042 from the
National Institutes of Health (to C. D. S.). The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
``advertisement'' in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Present address: Columbia University, Division of Medical
Oncology, MHB 6-435, 177 Fort Washington Ave., New York, NY 10032.
§
To whom correspondence should be addressed. Tel.: 617-632-3511;
Fax: 617-632-4663.
1
The abbreviations used are: PDGF,
platelet-derived growth factor; bp, base pair(s); kb, kilobase(s); CIP,
calf intestinal phosphatase; HMG, high mobility group.
Acknowledgments
We thank Drs. Barrett Rollins, Rolf G. Freter, Thomas Roberts, and Kerry Reinertsen for critical reading of
the manuscript. In compliance with Harvard Medical School guidelines on
possible conflict of interest, we disclose that one of the authors (C. D. S.) has consulting relationships with Upstate Biotechnology and
Sandoz Pharmaceuticals Inc.
REFERENCES
-
Almendral, J. M.,
Sommer, D.,
Macdonald-Bravo, H.,
Burckhardt, J.,
Perera, J.,
Bravo, R.
(1988)
Mol. Cell. Biol.
8,
2140-2148
[Abstract/Free Full Text]
-
Lau, L. F.,
Nathans, D.
(1985)
EMBO J.
4,
3145-3151
[Medline]
[Order article via Infotrieve]
-
Lau, L. F.,
Nathans, D.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
1182-1186
[Abstract/Free Full Text]
-
Herschman, H. R.
(1991)
Annu. Rev. Biochem.
60,
281-319
[CrossRef][Medline]
[Order article via Infotrieve]
-
Rollins, B. J.,
Stiles, C. D.
(1989)
Adv. Cancer Res.
53,
1-32
[Medline]
[Order article via Infotrieve]
-
Greenberg, M. E.,
Ziff, E. B.
(1984)
Nature
311,
433-437
[CrossRef][Medline]
[Order article via Infotrieve]
-
Kelly, K.,
Siebenlist, U.
(1988)
J. Biol. Chem.
263,
4828-4831
[Abstract/Free Full Text]
-
Berkowitz, L. A.,
Riabowol, K. T.,
Gilman, M. Z.
(1989)
Mol. Cell. Biol.
9,
4272-4281
[Abstract/Free Full Text]
-
Fisch, T. M.,
Prywes, R.,
Simon, M. C.,
Roeder, R. G.
(1989)
Genes Dev.
3,
198-211
[Abstract/Free Full Text]
-
Gilman, M. Z.
(1988)
Genes Dev.
2,
394-402
[Abstract/Free Full Text]
-
Graham, R.,
Gilman, M.
(1991)
Science
251,
189-192
[Abstract/Free Full Text]
-
Greenberg, M. E.,
Siegfried, Z.,
Ziff, E. B.
(1987)
Mol. Cell. Biol.
7,
1217-1225
[Abstract/Free Full Text]
-
Hill, C. S.,
Treisman, R.
(1995)
EMBO J.
14,
5037-5047
[Medline]
[Order article via Infotrieve]
-
Sassone-Corsi, P.,
Visvader, J.,
Ferland, L.,
Mellon, P. L.,
Verma, I. M.
(1988)
Genes Dev.
2,
1529-1538
[Abstract/Free Full Text]
-
Treisman, R.
(1985)
Cell
42,
889-902
[CrossRef][Medline]
[Order article via Infotrieve]
-
Treisman, R.
(1986)
Cell
46,
567-574
[CrossRef][Medline]
[Order article via Infotrieve]
-
Treisman, R.
(1990)
Semin. Cancer Biol.
1,
47-58
[Medline]
[Order article via Infotrieve]
-
Wagner, B. J.,
Hayes, T. E.,
Hoban, C. J.,
Cochran, B. H.
(1990)
EMBO J.
9,
4477-4484
[Medline]
[Order article via Infotrieve]
-
DeBelle, I.,
Walker, P. R.,
Smith, I. C. P.,
Sikorska, M.
(1991)
Mol. Cell. Biol.
11,
2752-2759
[Abstract/Free Full Text]
-
Hill, C. S.,
Wynne, J.,
Treisman, R.
(1995)
Cell
81,
1159-1170
[CrossRef][Medline]
[Order article via Infotrieve]
-
Johansen, F.-E.,
Prywes, R.
(1993)
Mol. Cell. Biol.
13,
4640-4647
[Abstract/Free Full Text]
-
Johansen, F.-E.,
Prywes, R.
(1994)
Mol. Cell. Biol.
14,
5920-5928
[Abstract/Free Full Text]
-
Misra, R. P.,
Rivera, V. M.,
Wang, J. M.,
Fan, P.,
Greenberg, M. E.
(1991)
Mol. Cell. Biol.
11,
4545-4554
[Abstract/Free Full Text]
-
Norman, C.,
Runswick, M.,
Pollock, R.,
Treisman, R.
(1988)
Cell
55,
989-1003
[CrossRef][Medline]
[Order article via Infotrieve]
-
Prywes, R.,
Roeder, R. G.
(1986)
Cell
47,
777-784
[CrossRef][Medline]
[Order article via Infotrieve]
-
Prywes, R.,
Roeder, R. G.
(1987)
Mol. Cell. Biol.
7,
3482-3489
[Abstract/Free Full Text]
-
Treisman, R.
(1987)
EMBO J.
6,
2711-2717
[Medline]
[Order article via Infotrieve]
-
Christy, B.,
Nathans, D.
(1989)
Mol. Cell. Biol.
9,
4889-4895
[Abstract/Free Full Text]
-
Perez-Albuerne, E. D.,
Schatteman, G.,
Sanders, L. K.,
Nathans, D.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
11960-11964
[Abstract/Free Full Text]
-
Qureshi, S. A.,
Cao, X.,
Sukhatme, V. P.,
Foster, D. A.
(1991)
J. Biol. Chem.
266,
10802-10806
[Abstract/Free Full Text]
-
Hall, D. J.,
Jones, S. D.,
Kaplan, D. R.,
Whitman, M.,
Rollins, B. J.,
Stiles, C. D.
(1989)
Mol. Cell. Biol.
9,
1705-1713
[Abstract/Free Full Text]
-
Hall, D. J.,
Stiles, C. D.
(1987)
J. Biol. Chem.
262,
15302-15308
[Abstract/Free Full Text]
-
Cochran, B. H.,
Reffel, A. C.,
Stiles, C. D.
(1983)
Cell
33,
939-947
[CrossRef][Medline]
[Order article via Infotrieve]
-
Rollins, B. J.,
Morrison, E. D.,
Stiles, C. D.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
3738-3742
[Abstract/Free Full Text]
-
Rollins, B. J.,
Stier, P.,
Ernst, T.,
Wong, G. G.
(1989)
Mol. Cell. Biol.
9,
4687-4695
[Abstract/Free Full Text]
-
Rollins, B. J.
(1995)
Hematopoietic Growth Factors in Clinical Application
(Mertelsmann, R.,
Herrmann, F.,
eds)
, 2nd Ed.
, p. 357, Marcel Dekker
Inc., New York
-
Dean, M.,
Levine, R. A.,
Ran, W.,
Kindy, M. S.,
Sonenshein, G. E.,
Campisi, J.
(1986)
J. Biol. Chem.
261,
9161-9166
[Abstract/Free Full Text]
-
Hall, D. J.,
Alberta, J. A.,
Stiles, C. D.
(1989)
Oncol. Res.
1,
127-184
-
Rameh, L. E.,
Armelin, M. C. S.
(1992)
Mol. Cell. Biol.
12,
4612-4621
[Abstract/Free Full Text]
-
Kawahara, R. S.,
Deng, Z. W.,
Deuel, T. F.
(1991)
J. Biol. Chem.
266,
13261-13266
[Abstract/Free Full Text]
-
Freter, R. R.,
Irminger, J. C.,
Porter, J. A.,
Jones, S. D.,
Stiles, C. D.
(1992)
Mol. Cell. Biol.
12,
5288-5300
[Abstract/Free Full Text]
-
Freter, R. R.,
Alberta, J. A.,
Lam, K.,
Stiles, C. D.
(1995)
Mol. Cell. Biol.
15,
315-325
[Abstract]
-
Pledger, W. J.,
Stiles, C. D.,
Antoniades, H. N.,
Scher, C. D.
(1977)
Proc. Natl. Acad. Sci. U. S. A.
74,
4481-4485
[Abstract/Free Full Text]
-
Chirgwin, J. M.,
Przybyla, A. E.,
Macdonald, R. J.,
Rutter, W. J.
(1979)
Biochemistry
18,
5294-5299
[CrossRef][Medline]
[Order article via Infotrieve]
-
Zinn, K.,
DiMaio, D.,
Maniatis, T.
(1983)
Cell
34,
865-879
[CrossRef][Medline]
[Order article via Infotrieve]
-
Melton, D. A.,
Krieg, P. A.,
Rebagliati, M. R.,
Maniatis, T.,
Zinn, K.,
Green, M. R.
(1984)
Nucleic Acids Res.
12,
7035-7056
[Abstract/Free Full Text]
-
Dignam, J. D.,
Lebovitz, R. M.,
Roeder, R. G.
(1983)
Nucleic Acids Res.
11,
1475-1489
[Abstract/Free Full Text]
-
Chittenden, T.,
Livingston, D. M.,
DeCaprio, J. A.
(1993)
Mol. Cell. Biol.
13,
3975-3983
[Abstract/Free Full Text]
-
Sanger, F.,
Nicklen, S.,
Coulson, A. R.
(1977)
Proc. Natl. Acad. Sci. U. S. A.
74,
5463-5467
[Abstract/Free Full Text]
-
Kunsch, C.,
Ruben, S.,
Rosen, C. A.
(1992)
Mol. Cell. Biol.
12,
4412-4421
[Abstract/Free Full Text]
-
Barone, M. V.,
Courtneidge, S. A.
(1995)
Nature
378,
509-512
[CrossRef][Medline]
[Order article via Infotrieve]
-
Rollins, B. J.,
Morrison, E. D.,
Stiles, C. D.
(1987)
Science
238,
1269-1271
[Abstract/Free Full Text]
-
Ueda, A.,
Okuda, K.,
Ohno, S.,
Shirai, A.,
Igarashi, T.,
Matsunaga, K.,
Fukushima, J.,
Kawamoto, S.,
Ishigatsubo, Y.,
Okubo, T.
(1994)
J. Immunol.
153,
2052-2063
[Abstract]
-
Baeuerle, P. A.,
Henkel, T.
(1994)
Annu. Rev. Immunol.
12,
141-179
[Medline]
[Order article via Infotrieve]
-
Grilli, M.,
Chiu, J. J.,
Lenardo, M. J.
(1993)
Int. Rev. Cytol.
143,
1-62
[Medline]
[Order article via Infotrieve]
-
Siebenlist, U.,
Franzoso, G.,
Brown, K.
(1994)
Annu. Rev. Cell Biol.
10,
405-455
[CrossRef]
-
Verma, I. M.,
Stevenson, J. K.,
Schwarz, E. M.,
Van Antwerp, D.,
Miyamoto, S.
(1995)
Genes Dev.
9,
2723-2735
[Free Full Text]
-
Ledebur, H. C.,
Parks, T. P.
(1995)
J. Biol. Chem.
270,
933-943
[Abstract/Free Full Text]
-
Takeuchi, M.,
Baichwal, V. R.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
3561-3565
[Abstract/Free Full Text]
-
Lai, J.,
Horvath, G.,
Subleski, J.,
Bruder, J.,
Ghosh, P.,
Tan, T.
(1995)
Mol. Cell. Biol.
15,
4260-4271
[Abstract]
-
Kunsch, C.,
Rosen, C. A.
(1993)
Mol. Cell. Biol.
13,
6137-6146
[Abstract/Free Full Text]
-
Thanos, D.,
Maniatis, T.
(1992)
Cell
71,
777-789
[CrossRef][Medline]
[Order article via Infotrieve]
-
Thanos, D.,
Maniatis, T.
(1995)
Mol. Cell. Biol.
15,
152-164
[Abstract]
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
N. K. Dhillon, F. Peng, R. M. Ransohoff, and S. Buch
PDGF Synergistically Enhances IFN-{gamma}-Induced Expression of CXCL10 in Blood-Derived Macrophages: Implications for HIV Dementia
J. Immunol.,
September 1, 2007;
179(5):
2722 - 2730.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. W. Tullai, M. E. Schaffer, S. Mullenbrock, G. Sholder, S. Kasif, and G. M. Cooper
Immediate-Early and Delayed Primary Response Genes Are Distinct in Function and Genomic Architecture
J. Biol. Chem.,
August 17, 2007;
282(33):
23981 - 23995.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Teferedegne, M. R. Green, Z. Guo, and J. M. Boss
Mechanism of Action of a Distal NF-{kappa}B-Dependent Enhancer
Mol. Cell. Biol.,
August 1, 2006;
26(15):
5759 - 5770.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-H. Yang, I-M. Fang, C.-P. Lin, C.-M. Yang, and M.-S. Chen
Effects of the NF-{kappa}B Inhibitor Pyrrolidine Dithiocarbamate on Experimentally Induced Autoimmune Anterior Uveitis
Invest. Ophthalmol. Vis. Sci.,
April 1, 2005;
46(4):
1339 - 1347.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. W. Kopp, T. Holzenbein, S. Steiner, R. Marculescu, H. Bergmeister, D. Seidinger, I. Mosberger, C. Kaun, M. Cejna, R. Horvat, et al.
Inhibition of restenosis by tissue factor pathway inhibitor: in vivo and in vitro evidence for suppressed monocyte chemoattraction and reduced gelatinolytic activity
Blood,
March 1, 2004;
103(5):
1653 - 1661.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Bosco, M. Puppo, S. Pastorino, Z. Mi, G. Melillo, S. Massazza, A. Rapisarda, and L. Varesio
Hypoxia Selectively Inhibits Monocyte Chemoattractant Protein-1 Production by Macrophages
J. Immunol.,
February 1, 2004;
172(3):
1681 - 1690.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Kutlu, M. I. Darville, A. K. Cardozo, and D. L. Eizirik
Molecular Regulation of Monocyte Chemoattractant Protein-1 Expression in Pancreatic {beta}-Cells
Diabetes,
February 1, 2003;
52(2):
348 - 355.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. H. Wu and B. Y. M. Yung
UV Stimulation of Nucleophosmin/B23 Expression Is an Immediate-early Gene Response Induced by Damaged DNA
J. Biol. Chem.,
December 6, 2002;
277(50):
48234 - 48240.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. X. Rong, J. W. Berman, M. B. Taubman, and E. A. Fisher
Lysophosphatidylcholine Stimulates Monocyte Chemoattractant Protein-1 Gene Expression in Rat Aortic Smooth Muscle Cells
Arterioscler. Thromb. Vasc. Biol.,
October 1, 2002;
22(10):
1617 - 1623.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Oda, A. Ueda, N. Shimizu, H. Handa, and T. Kasahara
Suppression of Monocyte Chemoattractant Protein 1, But Not IL-8, by Alprazolam: Effect of Alprazolam on c-Rel/p65 and c-Rel/p50 Binding to the Monocyte Chemoattractant Protein 1 Promoter Region
J. Immunol.,
September 15, 2002;
169(6):
3329 - 3335.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N.-H. Cho, S.-Y. Seong, M.-S. Huh, N.-H. Kim, M.-s. Choi, and I.-s. Kim
Induction of the Gene Encoding Macrophage Chemoattractant Protein 1 by Orientia tsutsugamushi in Human Endothelial Cells Involves Activation of Transcription Factor Activator Protein 1
Infect. Immun.,
September 1, 2002;
70(9):
4841 - 4850.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Lacroix-Lamande, R. Mancassola, M. Naciri, and F. Laurent
Role of Gamma Interferon in Chemokine Expression in the Ileum of Mice and in a Murine Intestinal Epithelial Cell Line after Cryptosporidium parvum Infection
Infect. Immun.,
April 1, 2002;
70(4):
2090 - 2099.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Ha, M. R. Yu, Y. J. Choi, M. Kitamura, and H. B. Lee
Role of High Glucose-Induced Nuclear Factor-{kappa}B Activation in Monocyte Chemoattractant Protein-1 Expression by Mesangial Cells
J. Am. Soc. Nephrol.,
April 1, 2002;
13(4):
894 - 902.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Delgado and D. Ganea
Inhibition of Endotoxin-Induced Macrophage Chemokine Production by Vasoactive Intestinal Peptide and Pituitary Adenylate Cyclase-Activating Polypeptide In Vitro and In Vivo
J. Immunol.,
July 15, 2001;
167(2):
966 - 975.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Mori, A. Ueda, S. Ikeda, Y. Yamasaki, Y. Yamada, M. Tomonaga, S. Morikawa, R. Geleziunas, T. Yoshimura, and N. Yamamoto
Human T-Cell Leukemia Virus Type I Tax Activates Transcription of the Human Monocyte Chemoattractant Protein-1 Gene through Two Nuclear Factor-{{kappa}}B Sites
Cancer Res.,
September 1, 2000;
60(17):
4939 - 4945.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. A. Nelson, J. P. Aris, B. K. R. Patel, and W. J. LaRochelle
Multiple Growth Factor Induction of a Murine Early Response Gene That Complements a Lethal Defect in Yeast Ribosome Biogenesis
J. Biol. Chem.,
April 28, 2000;
275(18):
13835 - 13841.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Saccani, S. Saccani, S. Orlando, M. Sironi, S. Bernasconi, P. Ghezzi, A. Mantovani, and A. Sica
Redox regulation of chemokine receptor expression
PNAS,
March 14, 2000;
97(6):
2761 - 2766.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N.-H. Cho, S.-Y. Seong, M.-S. Huh, T.-H. Han, Y.-S. Koh, M.-S. Choi, and I.-S. Kim
Expression of Chemokine Genes in Murine Macrophages Infected with Orientia tsutsugamushi
Infect. Immun.,
February 1, 2000;
68(2):
594 - 602.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Ping, G. Boekhoudt, F. Zhang, A. Morris, S. Philipsen, S. T. Warren, and J. M. Boss
Sp1 Binding Is Critical for Promoter Assembly and Activation of the MCP-1 Gene by Tumor Necrosis Factor
J. Biol. Chem.,
January 21, 2000;
275(3):
1708 - 1714.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Inadera, T. Sekiya, T. Yoshimura, and K. Matsushima
Molecular Analysis of the Inhibition of Monocyte Chemoattractant Protein-1 Gene Expression by Estrogens and Xenoestrogens in MCF-7 Cells
Endocrinology,
January 1, 2000;
141(1):
50 - 59.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Ping, G. Boekhoudt, and J. M. Boss
trans-Retinoic Acid Blocks Platelet-derived Growth Factor-BB-induced Expression of the Murine Monocyte Chemoattractant-1 Gene by Blocking the Assembly of a Promoter Proximal Sp1 Binding Site
J. Biol. Chem.,
November 5, 1999;
274(45):
31909 - 31916.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Alberta, K. R. Auger, D. Batt, P. Iannarelli, G. Hwang, H. L. Elliott, R. Duke, T. M. Roberts, and C. D. Stiles
Platelet-derived Growth Factor Stimulation of Monocyte Chemoattractant Protein-1 Gene Expression Is Mediated by Transient Activation of the Phosphoinositide 3-Kinase Signal Transduction Pathway
J. Biol. Chem.,
October 22, 1999;
274(43):
31062 - 31067.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Weiss, A. Nath, E. O. Major, and J. W. Berman
HIV-1 Tat Induces Monocyte Chemoattractant Protein-1-Mediated Monocyte Transmigration Across a Model of the Human Blood-Brain Barrier and Up-Regulates CCR5 Expression on Human Monocytes
J. Immunol.,
September 1, 1999;
163(5):
2953 - 2959.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Lemay, T. V. Lebedeva, and A. K. Singh
Inhibition of Cytokine Gene Expression by Sodium Salicylate in a Macrophage Cell Line through an NF-kappa B-Independent Mechanism
Clin. Vaccine Immunol.,
July 1, 1999;
6(4):
567 - 572.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Sridhar, Y. Liu, L. D. Chin, C. E. Borja, M. Mann, H. A. Skopicki, and R. R. Freter
Platelet-Derived Growth Factor-Stimulated Expression of the MCP-1 Immediate-Early Gene Involves an Inhibitory Multiprotein Complex
Mol. Cell. Biol.,
June 1, 1999;
19(6):
4219 - 4230.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Ping, G. H. Boekhoudt, E. M. Rogers, and J. M. Boss
Nuclear Factor-{kappa}B p65 Mediates the Assembly and Activation of the TNF-Responsive Element of the Murine Monocyte Chemoattractant-1 Gene
J. Immunol.,
January 15, 1999;
162(2):
727 - 734.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Weiss, S. A. Downie, W. D. Lyman, and J. W. Berman
Astrocyte-Derived Monocyte-Chemoattractant Protein-1 Directs the Transmigration of Leukocytes Across a Model of the Human Blood-Brain Barrier
J. Immunol.,
December 15, 1998;
161(12):
6896 - 6903.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Gupta, D. Xia, M. Jiang, S. Lee, and A. B. Pernis
Signaling Pathways Mediated by the TNF- and Cytokine-Receptor Families Target a Common cis-Element of the IFN Regulatory Factor 1 Promoter
J. Immunol.,
December 1, 1998;
161(11):
5997 - 6004.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Valente, J.-f. Xie, M. A. Abramova, U. O. Wenzel, H. E. Abboud, and D. T. Graves
A Complex Element Regulates IFN-{gamma}-Stimulated Monocyte Chemoattractant Protein-1 Gene Transcription
J. Immunol.,
October 1, 1998;
161(7):
3719 - 3728.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Y. Bogdanov, M. Poon, and M. B. Taubman
Platelet-derived Growth Factor-specific Regulation of the JE Promoter in Rat Aortic Smooth Muscle Cells
J. Biol. Chem.,
September 18, 1998;
273(38):
24932 - 24938.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Hellerbrand, C. Jobin, L. L. Licato, R. B. Sartor, and D. A. Brenner
Cytokines induce NF-kappa B in activated but not in quiescent rat hepatic stellate cells
Am J Physiol Gastrointest Liver Physiol,
August 1, 1998;
275(2):
G269 - G278.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Ueda, Y. Ishigatsubo, T. Okubo, and T. Yoshimura
Transcriptional Regulation of The Human Monocyte Chemoattractant Protein-1 Gene. COOPERATION OF TWO NF-kappa B SITES AND NF-kappa B/Rel SUBUNIT SPECIFICITY
J. Biol. Chem.,
December 5, 1997;
272(49):
31092 - 31099.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Poon, X. Zhang, K. G. Dunsky, M. B. Taubman, and P. C. Harpel
Apolipoprotein(a) Induces Monocyte Chemotactic Activity in Human Vascular Endothelial Cells
Circulation,
October 21, 1997;
96(8):
2514 - 2519.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
T. Marumo, V. B. Schini-Kerth, B. Fisslthaler, and R. Busse
Platelet-Derived Growth Factor–Stimulated Superoxide Anion Production Modulates Activation of Transcription Factor NF-{kappa}B and Expression of Monocyte Chemoattractant Protein 1 in Human Aortic Smooth Muscle Cells
Circulation,
October 7, 1997;
96(7):
2361 - 2367.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J.-Y. Liu, G. F. Morris, W.-H. Lei, C. E. Hart, J. A. Lasky, and A. R. Brody
Rapid Activation of PDGF-A and -B Expression at Sites of Lung Injury in Asbestos-exposed Rats
Am. J. Respir. Cell Mol. Biol.,
August 1, 1997;
17(2):
129 - 140.
[Abstract]
[Full Text]
|
 |
|
Copyright © 1996 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|