| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
(Received for publication, July
27, 1995; and in revised form, November 10, 1995) From the
Analysis of the calcium-dependent cell adhesion molecule
E-cadherin has led to the identification of catenins, which are
necessary for cadherin function. Growing evidence that cadherins and
catenins are subjected to genetic alterations in carcinogenesis makes
it especially important to understand protein-protein interactions
within the cadherin-catenin complex. Here we report the identification
and analysis of the
Cadherins comprise a family of calcium-dependent, homophilic
cell adhesion molecules that function in establishing tissue integrity
and cell polarity(1) . E-cadherin is expressed on the
basolateral surfaces of epithelial cells and is concentrated at
adherens junctions. Three proteins termed The primary sequences of
Disruption of the CCC can
destabilize intercellular junctions, leading to altered cell morphology
and increased invasiveness(14, 15) . For instance,
nonadherent PC9 lung carcinoma cells and invasive colon carcinoma cells
which do not express Genetic studies support a possible role of the CCC in invasion
suppression. For instance, E-cadherin mutations are found in
gynecologic cancers and in 50% of diffuse-type gastritic carcinomas (20, 21) . The gene encoding human plakoglobin has
been mapped to chromosome 17q21, a complex genomic region which is
subjected to genetic alterations in both sporadic and familial breast
carcinomas (22) . Plakoglobin has been shown to be subjected to
loss of heterozygosity in breast and ovarian tumors(23) .
Because plakoglobin links Therefore, we analyzed the
interaction between plakoglobin and
To insert it into a prokaryotic expression
vector, the armadillo cDNA (10) was amplified with
forward primer Arm1801 (ACAGGATCCATGAGTTACATGCCAG), which introduces a BamHI site before the start codon, and reverse primer Arm2471R
(CCTTGGTGCTCTCCAGATCGTTG). The purified PCR product was digested with BamHI and EcoRI and simultaneously ligated with a
3`-terminal EcoRI-fragment (2481 bp) from clone E16 into a
pGEX4T1 digested with BamHI and EcoRI to create
pGEX.Arm. Point mutants were created as above, using the primer
Arm2610.Tag1 (GGTGGTGGGACTCGGACTGCTTCACAGAGTGGTAATTGCATAGAAC)
containing 22 nucleotides of Drosophila armadillo on its 3`
end and the Tag1 sequence on its 5` end, and the following mutagenic
primers: T128A (AGACGTTGCACTGCCGCGGGCTGTTGGGGAT, SacII); L140A
(CACCGCGTGCTTGGCCATTTGTGAC, MscI); Y150A
(AGCGTCGTCCTGGGCATTAATCAGATTGACCAC, AsnI); Y150F
(AGCGTCGTCCTGGAAATTAATCAGATTGACCAC, AsnI). The mutagenized
strand was selectively amplified by PCR using the primers pGEX903 and
Tag1. Purified PCR product was subcloned into pGEX.Arm using BamHI and CelII.
SW480 cells (1 The primary sequence of plakoglobin can be subdivided into
three domains according to sequence homology among homologs of
Armadillo. Depending on the alignment, the central region consists of a
modular structure of 12 or 13 hydrophobic Armadillo repeats (Fig. 1)(11, 12) . In order to study the
interaction between plakoglobin and
Figure 1:
Schematic
representation of GST- and MBP-fusion proteins of human plakoglobin
used. Their ability to interact with
Figure 2:
Mapping of the
In order to identify an N-terminal
boundary of the
Figure 3:
Mapping of the
Figure 4:
A sequence encoded by exon 3 of
plakoglobin but not Arm repeat 1 is sufficient to mediate the
interaction with
Figure 5:
A peptide corresponding to amino acids
109-137 of plakoglobin is sufficient to bind to
The interaction between the synthetic
peptide Q29A and
Figure 6:
Single amino acid substitutions in
proteins of the armadillo gene family abolish their
interaction with
To demonstrate that
the
Figure 7:
A, quantitative analysis of the alanine
mapping of the
Biochemical analysis of eukaryotic cells has already provided
important information on the molecular organization of the
cadherin-catenin complex (CCC). To investigate the interactions of
catenins, which are necessary for the adhesive function of E-cadherin,
we expressed components of the CCC as fusion proteins. We have
previously assembled the CCC in vitro with recombinant
proteins(4) . Here we have extended this study and add new
information about the interaction between plakoglobin and
The corresponding motif in
other homologs of Armadillo also serves as a binding domain for
Although highly
conserved in homologs of Armadillo, the Q29A motif is absent in more
distantly related proteins containing Armadillo repeats, indicating
that such proteins (e.g. p120 We have established the
partial genomic structure of the human plakoglobin (23) and
mouse Alanine mapping of the Exchanges of critical hydrophobic amino acids into
hydrophilic residues could affect the interaction between Armadillo
homologs and
Volume 271,
Number 3,
Issue of January 19, 1996 pp. 1520-1526
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
-Catenin (*)
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
-catenin binding site in plakoglobin
(-catenin). Using N- and C-terminal truncations of plakoglobin, we
identified a domain of 29 amino acids necessary and sufficient for
binding
-catenin. The -catenin binding site is fully encoded
within exon 3 of plakoglobin but only partially represented in
Armadillo repeat 1. This suggests that exons rather than individual Arm
repeats encode functional domains of plakoglobin. Site-directed
mutagenesis identified residues in the -catenin binding site
indispensable for binding in vitro. Analogous mutations in
-catenin and Armadillo had identical effects. Our results indicate
that single amino acid mutations in the -catenin binding site of
homologs of Armadillo could prevent a stable association with
-catenin, thus affecting cadherin-mediated adhesion.
-, -, and
-catenin are complexed with the cytoplasmic domain of
E-cadherin(2) . Biochemical evidence suggests that
-catenin is identical to the desmosomal component
plakoglobin(3, 4, 5) .
-Catenin and
plakoglobin seem to play a central role in the architecture of two
independent cadherin-catenin complexes (CCC) (
)by linking
E-cadherin to -catenin(4, 5, 6) . The
catenins are thought to be involved in connecting E-cadherin to the
cortical actin cytoskeleton (7) . For proper adhesive function
of the CCC, both the homophilic interaction of the extracellular domain
and the binding of the catenins to the cytoplasmic domain are
essential. If one component is missing or nonfunctional,
E-cadherin-dependent adhesion is abolished (7, 8, 9) .-catenin and plakoglobin contain a 42-amino acid motif repeated 12
or 13 times, originally identified in the Drosophila segment
polarity gene product Armadillo(10) . Proteins with these
repeats have been grouped together as the Armadillo (Arm) repeat
family. Arm repeats are present in a variety of proteins with diverse
cellular functions(11) . This gene family can be further
divided into two subclasses, true Armadillo homologs (Armadillo,
-catenin, plakoglobin) (12) and more distantly related
proteins (p120, band 6 protein, APC, smgGDS,
SRP1)(11, 13) .
-catenin recovered adhesiveness after
transfection with -catenin cDNA(16, 17) . Cells
of the human gastritic cancer cell line HSC-39 express a truncated
-catenin that does not associate with -catenin and barely
form cell aggregates, but made epithelial-like structures after
transfection with full-length -catenin(18, 19) . -catenin to E-cadherin, mutations in
important domains of plakoglobin mediating protein-protein interactions
could inhibit cadherin function.-catenin. We demonstrate here
that a 29-amino acid domain (Q29A) located at the N terminus of
plakoglobin (aa 109-137) is necessary and sufficient for high
affinity binding to -catenin in vitro. Single amino acid
substitutions in the Q29A sequence abolished the binding of
plakoglobin, -catenin, and Armadillo to -catenin in
vitro. These amino acids could represent mutational hot spots
during tumor progression, as disruption of the cadherin system leads to
decreased epithelial adhesion.
Chemicals and Reagents
Restriction
endonucleases, Pwo DNA polymerase and other molecular biology
reagents were purchased from Boehringer (Mannheim, Germany) or New
England Biolabs (Beverly, MA). ECL detection kit and x-ray films were
from Amersham (Braunschweig, Germany). Oligonucleotides were
synthesized on an Applied Biosystems model 394A synthesizer with
-cyanochemistry. Peptides were synthesized on an Applied
Biosystems model 431A with Fmoc (N-(9-fluorenyl)methoxycarbonyl) chemistry and purified by
reversed-phase high performance liquid chromatography on a Vydac TP218
column. Peptides were biotinylated at the N terminus with
biotinamidocaproate-N-hydroxysuccinimide-ester (Sigma)
directly after synthesis.Cell Culture and Antibodies
The human colon
carcinoma cell line SW480 (ATCC CCL-228) was grown in Dulbecco's
modified Eagle's medium supplemented with 10% (v/v)
heat-inactivated fetal calf serum at 37 °C in a 10% CO
atmosphere. Affinity-purified polyclonal antibodies against
synthetic peptides corresponding to -catenin (M12K) and
plakoglobin (D15A) have been described(24, 25) .
Peroxidase-labeled secondary antibodies were from Dianova (Hamburg,
Germany).Construction of GST-Plakoglobin Fusion Proteins with
Deletions of the C Terminus
The plasmid pGEXPlako, encoding a
GST-fusion protein for full-length human plakoglobin, has been
described(4) . C-terminal deletion constructs N110, N125, N129,
N137, and N144 were generated by PCR; all PCR reactions in this study
were performed using Pwo DNA polymerase with proofreading
activity. PCR was carried out with the forward primer BamHI.ATG (ATATGCCGGCGGATCCATGGAGGTGATGAACCTGATGG) and a
reverse primer which added a stop codon followed by an EcoRI
restriction site after the last desired codon, e.g. ATTGAATTCTTAGGCCTGCCCCTCCACCTG (PlakoN110). PCR products were
purified using the JetPure Kit (Genomed, Bad Oeynhausen, Germany) and
cloned into pGEX4T1 (Pharmacia, Freiburg, Germany) using the BamHI and EcoRI restriction sites. The N139 construct
was created by digesting PlakoR142H, which carries a unique SpeI site at codon 139 (see site-directed mutagenesis) with SpeI and NotI, filling with Klenow polymerase and
religating. The N233 construct was created by digesting pGEXPlako with SphI and NotI and religating after treatment with
Klenow polymerase. All PCR-derived constructs in this study were
sequenced to confirm their sequences using Sequenase 2.0 (U. S.
Biochemical Corp.).Construction of MBP-Plakoglobin Fusion Proteins with
Deletions of the N Terminus
The MBP-Plako construct was created
by recloning the full-length plakoglobin cDNA from pGEXPlako into
pMalC2 (New England Biolabs) using BamHI and SalI.
Constructs 109C and 120C were created by PCR using a forward primer
which added a BamHI site 5` of the first desired amino acid:
GATGGATCCCAAGCCACCAACCTGCAGCGA (109C), AGTGGATCCCAGCTGCTCAAGTC (120C),
and the reverse primer 2096R (GTCTGGGTTCTTGTCCTC). The purified PCR
product was subcloned into pGEXPlako using the BamHI and XmaI restriction sites. Construct 
128/139 was created by
joining a PCR-derived N-terminal plakoglobin fragment with a C-terminal
plakoglobin fragment. For the N-terminal fragment we used forward
primer BamHI.ATG with reverse primer 127MunIR
(GCACAATTGCCGACTTGAGCAGCTGGGACG), which introduced a MunI site
at amino acid 127. The second fragment was amplified with forward
primer 140MunI (CCTCAATTGTCACTCGCGCCCTGCC) and reverse primer 2096R.
The N-terminal and the C-terminal fragment were digested with BamHI/MunI or MunI/XmaI,
respectively, and ligated into pGEXPlako digested with BamHI
and XmaI. Construct 139C was created by digesting PlakoR142H
(see ``Site-directed Mutagenesis of Plakoglobin'')
with the enzymes NcoI and SpeI, filling in 5`
overhangs with Klenow polymerase and religating. In all cases, inserts
were recloned from pGEX4T1 into pMalC2 using BamHI and SalI.Construction of Plakoglobin Peptides Fused to
GST
GST-peptide fusion proteins were generated by PCR using the
same primers used for the N- and C-terminal truncations. The N- and
C-terminal amino acid numbers of the peptide refer to the forward and
reverse primer used in the above mentioned N- or C-terminal deletion
construct. Purified PCR products were digested with BamHI and EcoRI and ligated into the corresponding sites of pGEX4T1.
Colonies were selected by PCR typing(26) .Construction of GST-ECT Chimeric Proteins
The
construct pGEXUC1 encoding the cytoplasmic domain of mouse E-cadherin
(ECT) has been described(27) . All ECT chimeras were obtained
by simultaneously ligating a BamHI/XhoI ECT fragment
and a XhoI/EcoRI fragment containing the desired
domain of plakoglobin into pGEX4T1 digested with BamHI and EcoRI. The BamHI/XhoI fragment of ECT was
obtained by amplifying pGEXUCI with forward primer
ATAGGATCCAGAACGGTGGTCAAAGAG and reverse primer
ACTACTCGAGATCGTCCTCGCCACCGCCGTACA. The XhoI/EcoRI
fragment of plakoglobin Arm repeat 1 was generated by PCR using forward
primer TCACTCGAGCTCAAGTCGGCCATTGTGC and reverse primer
ACCGAATTCTCAAATCATGCCCGCCTTGGTC. The XhoI/EcoRI
fragment of plakoglobin exon 3 was generated by PCR using forward
primer GTTCTCGAGCTTGAGTACCAGATGTCC and reverse primer
ACTGAATTCTCACGGGTCCTCGTCGTTG. The ECT109-144 construct was
created by subcloning the insert of Plako109-144 into pMalC2
using BamHI and EcoRI, removing this insert with SalI and EcoRI, and ligating it with the BamHI/XhoI-digested ECT fragment into pGEX4T1 as
described above.Site-directed Mutagenesis of
Plakoglobin
Site-directed mutagenesis was performed as
described(28) . For the primer extension reaction we used the
reverse primer 856R.Tag1
(GGTGGTGGGACTCGGACTGCTTCACTGGCATAGAACAGGACCGACTC) containing 22
nucleotides of plakoglobin on its 3` end and a 25-nucleotide artificial
Tag sequence (Tag1) on its 5` end, and various mutagenic primers
30-43 nucleotides in length containing mismatches to replace
specific amino acids and to introduce or remove restriction sites by
silent mutation for colony identification, e.g. T111A
(GGCCAGTCGCTGCAAGTTGGCGGCCTGCCCCTCCACCT, -PstI); L113A
(GCCAGTCGCTGCGCGTTGGTGGCCTGCCCC, -PstI); L116A
(GGGACGGCTCGGCGGCTCGCTGCAGGTTGGT, -AlwNI); P119A
(ACTTGAGCAGCTGGGACGCCTCGGCAAGTCGCTGCAGGTTGGT, -AlwNI),
S120A (GCCGACTTGAGCAGCTGTGCCGGCTCGGCCAGTCGCT, NaeI), L123A
(AATGGCCGACTTGGCTAGCTGGGACGGCTCG, NheI); I127A
(TTGATGAGATGCACAGCGGCCGACTTGAGCAGCTGGGACG, EagI); L130A
(ATCGTCCTGGTAGTTGATGGCGTGCACAATGGCCGACT, ApaLI); I131A
(ATCGTCCTGGTAGTTCGCGAGATGCACAATGGCCGACT, NruI); Y133A
(CTCGGCATCGTCCTGGGCATTAATGAGATGCACAATG, AsnI); R142H
(CGGGCAGGGCGTGAGTGACTAGTTCGGCATCGT, SpeI). Five pmol of
mutagenic primers and 0.1 pmol of primer 856R.Tag1 were annealed to the
sense strand of 0.1 pmol of heat-denatured pGEXPlako. Primer extension
and ligation were then performed using T4 polymerase and T4 ligase. The
mutagenized strand was selectively amplified by PCR using forward
primer pGEX 903 (CCTCCAAAATCGGATCTGGTTC), which binds all pGEX vectors
5` of the multiple cloning site and reverse primer Tag1
(GGTGGTGGGACTCGGACTGCTTCAC). Purified PCR products were subcloned into
full-length pGEXPlako using BamHI and SphI.
Efficiencies of up to 70% mutated colonies were achieved using this
protocol.Site-directed Mutagenesis of
To facilitate recloning of -Catenin and
Armadillo-catenin cDNAs with
single amino acid substitutions, a XbaI site was introduced
into the -catenin cDNA by silent mutation using the Clontech
Transformer kit (Clontech, Palo Alto, CA). The -catenin cDNA was
recloned from pGEX (4) into pUC19 using BamHI.
Mutagenesis was performed according to the instructions of the
manufacturer using the SspI/EcoRV trans
oligonucleotide (CTCTTCCTTTTTCGATATCATTGAAGCATT) and a mutagenic
oligonucleotide (CATGATGGCATGTCTAGAGGCTTCCTTTTTGGA). Clones positive
for the XbaI mutation were isolated, and the insert was
recloned into pGEX4T1 using BamHI. The resulting plasmid
(pGEX.MX) was used for all subsequent mutagenesis. For primer
extension, we used the primer M733.Tag1
(GGTGGTGGGACTCGGACTGCTTCACGAGCTGTCTCTACATCATTTG), containing 23
nucleotides of mouse -catenin on its 3` end and the artificial
Tag1 sequence on its 5` end, and the following mutagenic primers: T120A
(CAGCCAAGCGCTGAACGTTTGCGGGATGAGCAGCGT, Psp1406I); Y142A
(CCGCGTCATCCTGAGCATTAATCAAATTGACA, AsnI); Y142F
(CCGCGTCATCCTGAAAATTAATCAAATTGACA, AsnI). The mutagenized
strand was selectively amplified with forward primer pGEX 903 and the
reverse primer Tag1 and subcloned into pGEX.MX using NdeI
and XbaI.Expression and Purification of Recombinant Fusion
Proteins
All GST- and 6 
His-tagged proteins were
expressed and purified as described previously(4) . MBP-fusion
proteins were isolated according to the instructions of the
manufacturer (New England Biolabs). Briefly, bacteria were resuspended
in lysis buffer (20 mM Tris-HCl, pH 7.5, 200 mM NaCl,
2 mM EGTA, 1 mM MgCl, 1 mM NaF,
and 10 µg/ml of DNase I, leupeptin, and phenylmethylsulfonyl
fluoride). Cells were lysed by two passages through a French pressure
cell (18,000 lbf/in; 1 lbf/in 6.9
kilopascals). MBP-fusion proteins from cleared lysates were purified
with amylose-agarose beads at 4 °C. Beads were washed with lysis
buffer. Proteins were eluted with 10 mM maltose in lysis
buffer and dialyzed against 20 mM Tris-HCl, pH 7.5. Protein
solutions were stored in 50% glycerol at -20 °C.
In Vitro Reconstitution and Affinity
Purification
All plastic materials were coated with 0.1% (v/v)
Triton X-100. Recombinant proteins were mixed in association buffer (10
mM HEPES-NaOH, pH 7.4, 100 mM KCl, 1 mM MgCl, 0.1% Triton X-100) to a final concentration of
10 µg/ml of each protein. The mixture was incubated for 1 h at room
temperature. Protein complexes were isolated by adding 60 µl of
glutathione-agarose beads (50% slurry). After 20-min gentle agitation
at 4 °C the beads were pelleted (2 min, 800 g) and
washed four times with association buffer at room temperature. Bound
proteins were eluted with Laemmli sample buffer, separated by SDS-PAGE,
and analyzed by Coomassie Blue staining or immunoblotting. Affinity
precipitations for MBP-tagged proteins were carried out with
amylose-agarose using the same protocol, except that the Triton X-100
concentration was lowered to 0.05%, and all washes were performed at 4
°C. 10
) were metabolically
labeled with 50 µCi/ml [S]methionine (1000
Ci/mmol) (Amersham) for 4-12 h, washed twice with
phosphate-buffered saline, and extracted with 1 ml of lysis buffer (10
mM HEPES-NaOH, pH 7.4, 100 mM KCl, 1 mM MgCl
, 2 mM EGTA, 0.2% Triton X-100)
phosphatase inhibitors (1 mM each of NaVO
and NaF)
and protease inhibitors (10 µg/ml of leupeptin and
phenylmethylsulfonyl fluoride, 0.1 unit/ml of
-macroglobulin). Crude extracts were clarified by
centrifugation (4 °C, 16, 000 g, 10 min). The
soluble fraction was precleared with 10% (v/v) glutathione-agarose
beads; 200 µl of precleared supernatant (2 10
cells) was mixed with 800 µl of association buffer and
incubated with 2 µg of recombinant protein for 1 h at room
temperature. Protein complexes were purified with 60 µl of
glutathione-agarose beads for 20 min at 4 °C. Beads were washed
five times with association buffer at room temperature. Proteins were
eluted with Laemmli sample buffer, separated by SDS-PAGE, and analyzed
by fluorography, autoradiography, or immunoblotting. Precipitated
-catenin was quantified with the aid of a Fujix BAS 1000
PhosphorImager.
-catenin, various domains of
plakoglobin were expressed as bacterial fusion proteins carrying at the
N terminus either GST or MBP. Recombinant -catenin carries six
histidine residues (6 His) as a Tag sequence at the C terminus.
The fusion partner was used as a Tag for both purification from crude
lysates and affinity isolation of reconstituted protein complexes. The
presence of a GST- or MBP-Tag alters the electrophoretic mobility of
the recombinant proteins in comparison with their native counterparts
(by 26 or 42 kDa, respectively). The identity of the fusion partner in
a given deletion mutant had no effect on the interaction with
-catenin. Fusion proteins seemed to be folded correctly, because
they were recognized by specific antibodies in immunoprecipitation
experiments (not shown) and they interacted with their endogenous
binding partners in lysates of SW480 human colon carcinoma cells (Fig. 2).
-catenin is indicated at the right. The numbers refer to the amino acids of
plakoglobin according to the published sequence (GenBank M23410). GST, glutathione S-transferase; MBP,
maltose-binding protein; ECT, cytoplasmic domain of mouse
E-cadherin; R1, plakoglobin Arm repeat 1; E3,
plakoglobin sequence encoded by exon 3.
-catenin binding site
in plakoglobin with C-terminal truncations. A, interaction of
recombinant plakoglobin with endogenous -catenin. The indicated
recombinant proteins were incubated with S-labeled lysates
of SW480 cells as described under ``Materials and Methods.''
Proteins bound to the GST-tagged plakoglobin proteins were separated by
SDS-PAGE and processed for fluorography. The prominent protein at 46
kDa binds to the glutathione-agarose beads. B, an analogous
gel was blotted onto nitrocellulose and developed with
anti-
-catenin antibody. C, fine mapping of the
-catenin binding site. The indicated GST-fusion proteins were
incubated with 6 His-tagged -catenin in reconstitution
assays. Protein complexes were affinity-purified with
glutathione-agarose and separated by SDS-PAGE. Molecular weight markers
are indicated on the left. CBB, Coomassie Blue
staining.
N- and C-terminal Mapping of the
SW480 cells have cytoplasmic pools of catenins which
are not associated with cadherins(29, 30) . In
particular, a pool of free -Catenin Binding Site in
Plakoglobin-catenin exists, which is not bound to
-catenin or plakoglobin. Triton X-100 extracts from radioactively
labeled SW480 cells were incubated with full-length and C-terminally
truncated plakoglobin proteins. As can be seen in Fig. 2A, PlakoN144, PlakoN233, and full-length
plakoglobin bind specifically to a 102-kDa protein. Recombinant
-catenin could specifically compete for this binding (not shown).
The 102-kDa protein was identified as -catenin by immunoblotting
the samples with -catenin-specific antibodies (Fig. 2B). The GST-fusion proteins PlakoN110 and
PlakoN125 did not interact with endogenous -catenin (Fig. 2A). To further narrow down essential amino acids
involved in the interaction, various C-terminally truncated fusion
proteins were examined in reconstitution assays (Fig. 2C). -Catenin interacted with plakoglobin
polypeptides containing amino acids 1-137, 1-139, and
1-144, but not with 1-125 and 1-129. Results with
C-terminal deletion mutants suggest that amino acids located in a
highly conserved 8-amino acid cluster (aa 129-137) are necessary
for binding -catenin.-catenin binding site, deletion mutants were
constructed lacking parts of the N terminus but extending to the C
terminus of plakoglobin. The pMAL-C2 vector, encoding the MBP, was
chosen for these constructs, because a flexible spacer of 20 amino
acids renders the MBP unlikely to overlap the putative binding site at
the N terminus of the truncated plakoglobin proteins. Purified
MBP-plakoglobin fusion proteins were incubated with 6
His-tagged -catenin and affinity-isolated with amylose-agarose
beads. The precipitates were immunoblotted with plakoglobin-specific or
-catenin-specific antibodies (Fig. 3, A and B). Plako109C bound strongly to -catenin. In contrast,
Plako120C, Plako139C, and Plako128/139 (a construct carrying an
in-frame deletion of the amino acid cluster mapped with C-terminal
truncated proteins) were unable to interact with -catenin. The
results with N-terminal deletion mutants of plakoglobin suggest that
amino acids between 109 and 120 are necessary for interaction with
-catenin. In summary, N- and C-terminal mapping narrowed down the
N- and C-terminal borders of the -catenin binding region to amino
acids 109-137 of plakoglobin (Q29A).
-catenin binding site
with N-terminal deletions of plakoglobin. MBP-fusion proteins of
plakoglobin were incubated with -catenin carrying a 6
His-Tag in reconstitution assays as indicated. Protein complexes were
affinity purified with amylose-agarose beads and separated by SDS-PAGE.
Subsequent immunoblots were developed with anti-plakoglobin antibody (A) or anti--catenin antibody (B). The double
bands in A are due to proteolytic degradation of the
MBP-plakoglobin fusion proteins. Molecular weight markers are indicated
on the left.
Amino Acid Sequences Encoded by Exon 3 and Not Arm Repeat
1 of Plakoglobin Bind to
The complete Q29A motif
is contained within amino acids encoded by exon 3 of the plakoglobin
gene (E3, aa 72-156)(23) , but is not completely within
the first Arm repeat of plakoglobin (R1, aa 123-168). To
determine whether Arm repeat 1 or the sequence encoded by exon 3 is
sufficient for binding to -Catenin-catenin as an independent binding
domain, fusion proteins with the cytoplasmic domain of E-cadherin (ECT)
were generated. Since -catenin cannot bind directly to
ECT(4, 30) , the -catenin binding site of
plakoglobin fused to ECT should permit direct binding of -catenin
to the chimeric protein. As can be seen in Fig. 4, A and B, neither ECT nor (more importantly) the chimeric
protein ECT fused to Arm repeat 1 of plakoglobin (ECT.R1) interacted
with -catenin in reconstitution assays. In contrast, the chimeric
proteins of both exon 3 (ECT.E3) and amino acids 109-144
(ECT.109-144) of plakoglobin fused to ECT bound tightly to
-catenin. The interaction between E-cadherin and -catenin was
not affected by the additional association of ECT.E3 with
-catenin, strongly suggesting that the ECT fusion partner did not
interfere with proper folding of the sequence encoded by exon 3 (not
shown). These results strongly suggest that an amino acid sequence
encoded by exon 3 of plakoglobin, but not Arm repeat 1, can serve as an
independent binding domain for -catenin.
-catenin. A, GST-tagged chimeric
proteins were incubated with recombinant -catenin as indicated.
Protein complexes were purified with glutathione-agarose beads,
separated by SDS-PAGE, and stained with Coomassie Blue. B,
duplicate gels were blotted and developed with antibodies specific for
-catenin. C, schematic localization with respect to
full-length plakoglobin of Arm repeat 1, the -catenin binding site
Q29A, and amino acids encoded by exon 3.
The Synthetic Peptide Q29A Competes with Plakoglobin for
Binding to
To see whether the binding site could
be further narrowed down, short peptides of plakoglobin were expressed
as GST-fusion proteins (Fig. 5A). In reconstitution
assays Plako109-129 fused to GST could not associate with
recombinant -Catenin-catenin, whereas Plako109-137 and
Plako109-144 could. Plako109-137 and Plako109-144,
but not Plako109-129 or Plako120-144, also co-precipitated
native -catenin from metabolically labeled SW480 cells (not
shown). These binding assays demonstrate that the amino acid sequence
109-137 of plakoglobin is sufficient to bind to -catenin. A
biotinylated synthetic peptide (peptide Q29A; plakoglobin, aa
109-137) competed with the binding between full-length
plakoglobin and recombinant -catenin in a dose-dependent fashion (Fig. 5, B and C). Increasing amounts of the
peptide Q29A (0, 0.1, 1, and 10 µg/ml) were incubated with
recombinant -catenin and plakoglobin (1 µg/ml each). The
ability of 6 His-tagged -catenin to interact with
plakoglobin was analyzed by affinity isolation of the GST-fusion
protein followed by immunoblotting. The results shown in Fig. 5, B and C, demonstrate that a constant amount of
plakoglobin was associated with decreasing amounts of -catenin due
to increasing concentrations of the peptide competitor. No bound
-catenin was observed at a peptide concentration of 3
10M (Fig. 5C).
Precipitation first with glutathione-agarose beads and then with
avidin-agarose beads demonstrated that
-catenin not bound to
GST-plakoglobin indeed was associated with the peptide Q29A (not
shown). A biotinylated control peptide S19A comprising only the
C-terminal half of the binding site (aa 125-143) did not
associate with -catenin, nor could it compete with plakoglobin for
the formation of heterodimers.
-catenin. A, GST-tagged peptides of plakoglobin were incubated with
recombinant -catenin in association buffer as indicated. Protein
complexes were purified with glutathione-agarose beads, separated by
SDS-PAGE, and stained with Coomassie Blue. GST migrates at the same
molecular weight as GST-Plako109-129, because the polylinker of
pGEX4T1 adds additional amino acids. B and C, the
synthetic peptide PlakoQ29A competes with full-length plakoglobin to
bind -catenin. GST-tagged plakoglobin was incubated with
recombinant -catenin and the indicated amounts of the peptide Q29A
(numbers indicate the protein concentration in µg/ml). Protein
complexes of plakoglobin were purified with glutathione-agarose and
immunoblotted with antibodies specific for plakoglobin (B) and
-catenin (C). D, sequence comparison of the
-catenin binding site in homologs of Armadillo. The position of
the sequence within the full-length protein is given at the left. Residues identical to those of human plakoglobin are
shaded in black. Alignment was performed by the Clustal
alignment algorithm.
-catenin was also studied using surface plasmon
resonance detection(31) . This technique measures real-time
association and dissociation of molecules on a sensor surface and
allows estimates of kinetic binding constants. The biotinylated peptide
Q29A was immobilized on a streptavidin-coated sensor surface.
Concentration-dependent binding of -catenin was observed and used
to calculate kinetic rate constants (not shown). The association rate
constant k
was 2.0 10 ±
2.9 10
M s
(n = 5). The dissociation phase was biphasic,
probably due either to heterogeneity in the biological material or to
rebinding of
-catenin during the dissociation phase. Therefore,
two dissociation rate constants were obtained: k
1
1.4 10 ± 2.3
10 s
and k
2 2.1
10 ± 4.6
10 s
(n = 5). The apparent
dissociation equilibrium constant (K
= k/k) was 7.0
10M for k
1 and 1.1
10M for k
2.
The values for the K obtained from the biosensor
agree well with the peptide concentration needed to inhibit binding of
-catenin to plakoglobin (3 10M
10 K).Site-directed Mutagenesis
To identify amino acids
that are indispensable for stable complex formation, each of the
residues within the binding motif was mutated individually to alanine
(alanine mapping). The ability of full-length plakoglobin carrying
single point mutations to interact with recombinant -catenin was
analyzed by in vitro reconstitution assays (Fig. 6A and 7A). Interestingly, no exchange of a charged amino
acid to alanine abolished the binding (e.g. E118A, K124A,
D135A, D136A). The mutation of the evolutionarily conserved proline
P119 also had no effect. This was somewhat unexpected, as computer
predictions suggested this should alter the secondary structure. The
mutation Y133A abolished the interaction with -catenin.
Interestingly, binding could be restored if the tyrosine was replaced
by phenylalanine. Similarly, most mutations of hydrophobic amino acids
in the sequence led to loss of binding. This observation suggests that
hydrophobic interactions stabilize the heterodimeric complex. The
binding activities of a representative group of mutants were unchanged
in assays performed in HEPES, phosphate-buffered saline, or imidazole
buffers. Reconstitution assays at various temperatures (4, 20, and 37
°C) and salt concentrations (20-200 mM KCl) showed
no significant differences. However, the stability of the
-catenin-plakoglobin dimers could be slightly improved by
stabilizing hydrophobic interactions with high salt concentrations (1 M KCl) during the washing procedure.
-catenin in vitro.A,
full-length plakoglobins carrying single point mutations in the
-catenin binding site were assayed with recombinant -catenin
as indicated. Reconstituted protein complexes were separated by
SDS-PAGE and stained with Coomassie Blue. GST-tagged plakoglobin and 6
His-tagged -catenin have approximately the same molecular
weight. B, extracts of metabolically labeled SW480 cells were
incubated with GST-fusion proteins of plakoglobin, -catenin, and
Armadillo, either wild type or carrying identical mutations at
corresponding amino acids. Protein complexes were affinity-purified
with glutathione-agarose beads. Bound proteins were separated by
SDS-PAGE and processed for fluorography.
-catenin binding site is conserved in members of the armadillo gene family, point mutations were introduced in the
-catenin binding site of mouse -catenin and Drosophila Armadillo (Fig. 6B). Wild type -catenin and
Armadillo were able to interact with -catenin from lysates of
metabolically labeled SW480 cells. As with plakoglobin, the mutants
T120A, Y142A, armT128A, and armY150A showed strongly reduced
binding. Again, replacement of the tyrosine with phenylalanine restored
the binding. The amount of metabolically labeled -catenin in the
precipitates was used to quantify the ability of a given mutant protein
to interact with -catenin. The results of these measurements are
summarized in Fig. 7A. The data suggest that identical
amino acids in all homologs of Armadillo are required for the stable
interaction with -catenin via a not yet known hydrophobic
interaction mechanism.
-catenin binding site in plakoglobin,
-catenin, and Armadillo. In the chart above, only the amino acids
differing from the wild type sequence are shown. The relative
percentage of a given mutant protein associating with metabolically
labeled -catenin in comparison with wild type plakoglobin is shown
on the right. The values represent the mean of four
independent measurements using a PhosphorImager. Individual values
obtained from a given mutant varied less than 20%. Numbers higher than
100 indicate an increased stability of the heterodimeric complex during
the washing procedure. B, schematic representation of a
partial sequence (aa 121-133) of the -catenin binding site
as a helical wheel. All hydrophobic amino acids which affect the
binding (black circles) are located on one side of the
putative helix.
-catenin. N- and C-terminal truncated proteins defined a 29-amino
acid sequence in plakoglobin (Q29A, aa 109-137) necessary and
sufficient for binding to -catenin.-catenin. The homologous sequence in -catenin is located
between amino acids 118 and 146, which fits well with our previous
study identifying amino acids between 120 and 151 of -catenin as
necessary for interaction with -catenin(4) . The human
gastritic cancer cell line HSC-39 has a homozygous in-frame deletion in
-catenin that removes amino acids 28-134, the N-terminal
part of the -catenin binding site. This cell line shows extremely
weak cadherin-mediated adhesion, because the truncated -catenin
cannot interact with -catenin(18, 19) . Using
amino acid exchanges in mouse -catenin and Drosophila Armadillo, we confirm that this motif mediates the interaction
with -catenin in homologs of plakoglobin., APC, band 6
protein) (11, 13) cannot be associated with
-catenin by the same mechanism as are homologs of Armadillo.
Indeed, previous studies have shown that APC and p120 do
not directly interact with
-catenin(32, 33) .
Based on the alanine mapping, it is also worth noting that the part of
the Q29A sequence derived from Arm repeat 1 does not match the
consensus sequence for Armadillo repeats (11) and cannot be
substituted by any other published Armadillo repeat to reconstitute a
functionally -catenin binding site.-catenin genes(34) . The region of plakoglobin
encoded by exon 3 (aa 72-156) constitutes a defined protein
domain sufficient for interaction with -catenin. In contrast, Arm
repeat 1 (aa 123-165) contains only the C-terminal portion of the
binding region and is not by itself sufficient to bind to
-catenin. This could also be observed in vivo with
adhesion-deficient HSC-39 cells, in which the truncated -catenin
has an almost complete copy of Arm repeat 1(19) . This finding
argues that exon-encoded protein domains rather than individual repeats
could be carriers of function in plakoglobin. It favors the idea that
individual Arm repeats could assemble together into a scaffold-like
structure, which might serve to place functional amino acids at the
right place.-catenin binding site
identified mostly hydrophobic amino acids as indispensable for
interaction with -catenin in vitro. The implicated
residues are spaced appropriately for an -helical interaction
mechanism (Fig. 7B). Further analysis of the potential
secondary structure using three different software packages (DNAstar,
MacVector, and GCG) resulted in different predictions, probably due to
the conserved proline residue in the center of the -catenin
binding site. Assuming a stabilization of -catenin-plakoglobin
dimers through hydrophobic forces, one should expect a similar motif in
-catenin.-catenin in vivo. This, in turn, would
probably disturb cadherin-mediated adhesiveness, leading to a
destabilization of intercellular junctions which might play an
important role in the progression of cancer from an adhesive to an
invasive state.
)
We gratefully acknowledge Dr. W. James Nelson
(Stanford University, Palo Alto, CA) for providing the cell line SW480
and the plasmid pGEXUC1 and Dr. Eric Wieschaus (Princeton University,
Princeton, NJ) for providing the armadillo clone E16. We are
grateful to Dr. Jürgen Engel (Biozentrum, Basel,
Switzerland) for helpful discussions. We thank Andreas Scherer and Dr.
Christiane Bierkamp for providing unpublished sequences, Johann
Wirsching for excellent technical assistance, Lore Lay for preparing
the photographs and Dr. Randy Cassada for critically reading the
manuscript.
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  M. D. David, A. Yeramian, M. Dunach, M. Llovera, C. Canti, A. G. de Herreros, J. X. Comella, and J. Herreros Signalling by neurotrophins and hepatocyte growth factor regulates axon morphogenesis by differential {beta}-catenin phosphorylation J. Cell Sci., August 15, 2008; 121(16): 2718 - 2730. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-H. Kim, H. Neiswender, E. J. Baik, W. C. Xiong, and L. Mei {beta}-Catenin Interacts with MyoD and Regulates Its Transcription Activity Mol. Cell. Biol., May 1, 2008; 28(9): 2941 - 2951. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Tominaga, Y. Fukunaga, E. Abelardo, and A. Nagafuchi Defining the function of beta-catenin tyrosine phosphorylation in cadherin-mediated cell-cell adhesion. Genes Cells, January 1, 2008; 13(1): 67 - 77. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Zamora, J. Manner, and P. Ruiz-Lozano Epicardium-derived progenitor cells require {beta}-catenin for coronary artery formation PNAS, November 13, 2007; 104(46): 18109 - 18114. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Okuda, L. M. Y. Yu, L. A. Cingolani, R. Kemler, and Y. Goda beta-Catenin regulates excitatory postsynaptic strength at hippocampal synapses PNAS, August 14, 2007; 104(33): 13479 - 13484. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Zhang, S. Luo, X.-P. Dong, X. Zhang, C. Liu, Z. Luo, W.-C. Xiong, and L. Mei {beta}-Catenin Regulates Acetylcholine Receptor Clustering in Muscle Cells through Interaction with Rapsyn J. Neurosci., April 11, 2007; 27(15): 3968 - 3973. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. H. Bustos, A. Ferrarese, A. Venerando, O. Marin, J. E. Allende, and L. A. Pinna The first armadillo repeat is involved in the recognition and regulation of beta-catenin phosphorylation by protein kinase CK1 PNAS, December 26, 2006; 103(52): 19725 - 19730. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Peruzzi, G. Athauda, and D. P. Bottaro The von Hippel-Lindau tumor suppressor gene product represses oncogenic beta-catenin signaling in renal carcinoma cells PNAS, September 26, 2006; 103(39): 14531 - 14536. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Sato, N. Fujita, A. Yamada, T. Ooshio, R. Okamoto, K. Irie, and Y. Takai Regulation of the Assembly and Adhesion Activity of E-cadherin by Nectin and Afadin for the Formation of Adherens Junctions in Madin-Darby Canine Kidney Cells J. Biol. Chem., February 24, 2006; 281(8): 5288 - 5299. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Solanas, S. Miravet, D. Casagolda, J. Castano, I. Raurell, A. Corrionero, A. G. de Herreros, and M. Dunach {beta}-Catenin and Plakoglobin N- and C-tails Determine Ligand Specificity J. Biol. Chem., November 26, 2004; 279(48): 49849 - 49856. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Teuliere, M. M. Faraldo, M. Shtutman, W. Birchmeier, J. Huelsken, J. P. Thiery, and M. A. Glukhova {beta}-Catenin-Dependent and -Independent Effects of {Delta}N-Plakoglobin on Epidermal Growth and Differentiation Mol. Cell. Biol., October 1, 2004; 24(19): 8649 - 8661. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. D. Mruk and C. Y. Cheng Sertoli-Sertoli and Sertoli-Germ Cell Interactions and Their Significance in Germ Cell Movement in the Seminiferous Epithelium during Spermatogenesis Endocr. Rev., October 1, 2004; 25(5): 747 - 806. [Abstract] [Full Text] [PDF]
|
|
