The trematode Schistosoma mansoni lives in human blood vessels, causing the parasitic disease bilharziosis. Approximately 200 million people in tropical countries are infected by the helminth. Infection with S. mansoni results in a life-long chronic disease which is marked by increasing tissue damage caused by eggs deposited throughout the body. With 750,000 deaths annually, bilharziosis is the second most deadly parasitic disease after malaria.

Proteases are key components of the pathogenicity of parasites. They facilitate tissue penetration and determine nutritional sources of the parasite within intermediate and human hosts(1) . Cathepsin B is the major thiol protease of adult worms of Schistosoma mansoni and may be a valuable target for therapeutic agents.

Cathepsin B (EC 3.4.22.1) belongs to the family of cysteine proteases. On the basis of sequence analysis, cysteine proteases have recently been classified into ERFNIN and cathepsin B-like cysteine proteases (2) . Mammalian cathepsins B are lysosomal proteases involved in intracellular protein degradation. In addition, they are believed to play a role in tumor invasion and metastasis(3) .

Only little is known about cathepsin B of helminths. The genes of cathepsin B from Haemonchus contortus (4, EMBL accession number M60212), Ostertagia ostertagi (5, EMBL accession number M88503), S. mansoni (6, EMBL accession number M21309), and Schistosoma japonicum (EMBL accession number X70968) and of the free-living nematode Caenorhabditis elegans (7, EMBL accession number M74797) have been determined, but the corresponding enzymes have not been well characterized. Among these enzymes, cathepsin B of S. mansoni has evoked most attention as it is believed to be a key enzyme in the degradation of host hemoglobin(8) , and as it is highly immunogenic in man.

Early studies suggested that S. mansoni possesses a protease which specifically hydrolyzes human hemoglobin(9) , and two groups reported the purification of a hemoglobinolytic protease(10, 11) . The latter group described a cysteine protease with a molecular mass of 32 kDa and a substrate specifity similiar to mammalian cathepsin B. In contrast to the lysosomal localization of the mammalian cathepsin B, the schistosomal counterpart is secreted into the gut lumen, which is in line with its possible involvement in parasite nutrition(12) . Nevertheless, detailed studies of the protease were impossible due to the inavailability of sufficient amounts of purified protein from the obligate parasitic worm.

The gene of schistosomal cathepsin B was isolated from a cDNA gene bank of adult worms(6) , taking advantage of the fact that this protease is highly immunogenic in man. The protease (also termed Sm31) has been suggested as an immunodiagnostic antigen of bilharziosis(13) , which is at present diagnosed by laborious examination of feces and urine for eggs.

In view of its participation in host hemoglobin degradation and its potential as a possible component of an immunoassay, several attempts to express active schistosomal cathepsin B have been undertaken in the past.

Cathepsin B of S. mansoni has been expressed as a fusion protein with the amino-terminal region of the RNA replicase of the phage MS2 in Escherichia coli. However, the fusion protein aggregated in the cytoplasm and could only be solubilized with strong denaturants(14) . We expressed procathepsin B in its unfused form in E. coli, but the recombinant protein was also found to be insoluble. ()In addition, cathepsin B has been expressed in insect cells, but the yield of soluble enzyme was too low for purification and enzyme characterization (15) .

Recently, we succeeded in expressing cathepsin B in Saccharomyces cerevisiae. Here we report on the construction of a plasmid which allowed efficient expression of procathepsin B. The coding region of the zymogen was fused to the mating factor secretion signal, and the recombinant protein was secreted in the culture supernatant by the yeast cells. It was purified by taking advantage of a hexahistidine affinity tag which was added to the carboxyl terminus of the protein. The zymogen was subsequently processed to active cathepsin B in vitro by pepsin and characterized enzymatically.

EXPERIMENTAL PROCEDURES

Materials

()

Plasmid Constructions

pUC8-Sm31A

After destruction of the unique EcoRI site of the vector pMATA21/51/H-2, the plasmid was cut with NarI, treated with Klenow's fragment, digested with HindIII, and subsequently ligated to a 1.4-kilobase fragment obtained by partial digestion of pSP-Cb1 (17) with PvuII and HindIII. The 1.4-kilobase fragment contains the complete coding sequence of preprocathepsin B (EMBL accession number M21309). The resulting plasmid, referred to as intermediate, was cut with EcoRI and StuI and ligated to an EcoRI-restricted PCR fragment derived from pSP-Cb1 with a sense primer representing the amino terminus of procathepsin B plus the dipeptide Glu-Ala from the signal sequence (pCb5: GAAGCTCATATTTCAGTTAAG) and a reverse primer (pCb4: CCAACATGATCCACATCG) 280 bases further downstream. Clones containing the PCR fragment were detected by colony hybridization, and the correct in-frame fusion of preproMF with the amino-terminal part of procathepsin B, as well as the integrity of PCR-generated stretches, were confirmed by DNA sequencing. This plasmid was cut with EcoRI and NdeI and ligated to a 1.2-kilobase DNA fragment coding for the carboxyl-terminal part of Sm31, obtained by partial digestion of the intermediate with EcoRI and NdeI. The resulting construction pUC8-Sm31A contained a complete expression cassette: a MF promoter followed by the gene fusion coding for preproMF-procathepsin B (Fig. 1A).

Figure 1: Yeast expression plasmid pEMBLyex2-Sm31. A, construction of the expression cassettes; B, physical map. The plasmid was constructed as described under ``Experimental Procedures.'' The ampicillin resistance gene (Amp) and the bacterial plasmid origin colE1 (ORI) allow selection and maintenance of the shuttle vector in E. coli hosts. Yeast selection markers are leu2-d (-isopropylmalate dehydrogenase gene with a defective promoter) and URA3 (orotidine-5`-phosphate decarboxylase gene). Replication in yeast cells is ensured in cir hosts through ORI 2µ and STB sequences. Expression of the fusion protein preproMF-procathepsin B (MF-Sm31) is controlled by the galactose-inducible GAL/CYC hybrid promoter. Polyadenylation and transcriptional termination signals are located between the HindIII and the STB sequence.

pUC8-Sm31B

pUC8-Sm31C

The expression cassettes of pUC8-Sm31A and pUC8-Sm31B were integrated into various S. cerevisiae shuttle vectors with different orgins of replication and resulted in expression vectors under the control of the constitutive MF promoter.

The construct we used for subsequent high level expression of recombinant procathepsin B was based on the yeast expression vector pEMBLyex2 (18) which provides an inducible GAL10/CYC1 hybrid promoter (19) , a polylinker and signals for transcriptional termination and polyadenylation, as well as the two selection markers URA3 and leu2-d. To construct pEMBLyex2-Sm31 (Fig. 1B), an AccI (filled-in)/BglII fragment encoding the preproMF-procathepsin B fusion was isolated from pUC8-Sm31C and cloned into the SalI (filled-in) and BamHI restrictions sites of the pEMBLyex2 polylinker.

Expression and Purification of Procathepsin B

The cleared culture supernatant was brought to 0.3 M NaCl with 5 M NaCl, diluted with 1 volume of buffer A (50 mM sodium dihydrogen phosphate, 300 mM NaCl) and adjusted to pH 8. Then, 0.02-0.002 volume of Ni-NTA agarose previously equilibrated with buffer A was added, and the suspension was stirred overnight at 4 °C. The agarose beads were collected by vacuum filtration and washed twice with 0.05 volume of buffer A and twice with buffer B (same as buffer A, but adjusted to pH 7). The matrix was poured in a C10 column or a C26 column (Pharmacia Biotech Inc.), and proteins were eluted with a pH step gradient (buffer A adjusted to pH 6, pH 5, pH 4, and pH 3, flow rate: 1 column volume/h). Procathepsin B eluted at pH 4. Alternatively, procathepsin B was eluted with 100 mM EDTA, 50 mM sodium phosphate, pH 6.3.

SDS-PAGE and Western Blotting

Amino-terminal Sequencing of Proteins

Determination of Procathepsin B

Activation of Procathepsin B

Enzyme Assay

Z-Arg-Arg-pNA

AMC Derivates

Reduction of Methemoglobin

Isolation of Peptides

Mass Spectrometry

RESULTS

Expression of Procathepsin B

In a second attempt, a glycosylation site of procathepsin B was destroyed. The primary structure of procathepsin B contains two consensus sequences for N-linked glycosylation, Asn-X-Ser/Thr/(Cys)(26) . However, one of the consensus sequences is followed by a proline residue which often prevents N-glycosylation(27) . The native protein is most probably not modified at this site, as only one N-linked sugar chain has been determined experimentally(28) . The mutated recombinant protein was no longer glycosylated, but the expression rate of procathepsin B under the control of the constitutive MF promoter remained low.

Reducing the copy number of constitutive expression units can lead to an increase of secretion efficiency in yeast(29) . Our attempts to improve expression using an integrating expression vector or an autonomously replicating expression plasmid, however, resulted in a decrease of expression. High level expression (up to 10 mg/liter) was finally achieved by expressing the preproMF-procathepsin B fusion protein under the control of the inducible galactose promoter of the yeast episomal plasmid pEMBLyex2 (Fig. 1B). This plasmid has an inefficiently transcribed leu2 gene leading to an unusually high copy number under selective growth conditions.

Expression was found to be optimal when the yeast strain HT393, which is deficient in several proteinases, was grown in complete medium, thus favoring high biomass accumulation. In Fig. 2A, the culture supernatant of HT393 (pEMBLyex2-Sm31) is compared with the supernatant of a control culture. A dominant 40-kDa protein is present in the culture medium of the expressing yeast strain, but not of the control culture. This protein corresponds to procathepsin B as demonstrated by the Western blot (Fig. 2A). In addition to the 40-kDa band, a protein of about 20 kDa is seen in the Western blot. This protein probably presents a degradation product of procathepsin B which seems to have lost the carboxyl-terminal hexahistidine affinity tag as it does not copurify with the intact zymogen (see below).

Figure 2: Expression and purification of schistosomal procathepsin B. A, Coomassie Blue-stained gel (lanes 1 and 2) and Western blot (lanes 3 and 4) of yeast culture supernatants. Proteins contained in 0.1 ml of supernatant each were trichloroacetic acid-precipitated and analyzed by SDS-PAGE. Western blot analysis was performed with anti-cathepsin B serum. Lanes 1 and 3, HT393; lanes 2 and 4, HT393 transformed with pEMBLyex2-Sm31. B, elution profile of Ni-NTA agarose. Proteins from 250 ml of cell-free culture supernatant were batch-absorbed on 0.35-ml Ni-NTA-agarose. The matrix was washed and poured in a C10 column (Pharmacia), and proteins were eluted by applying pH-steps as indicated. The fractions containing the eluate at pH 4.0 were pooled (approximately 100 µg of procathepsin B). C, purified procathepsin B analyzed by SDS-PAGE and stained with Coomassie Blue. Lane 1, acidic elution protocol as in B; lane 2, EDTA elution protocol (see text for details).

To accomplish secretion of procathepsin B, the gene was cloned behind the preproMF peptide. This sequence promotes secretion of the mating factor in yeast cells. Processing by the KEX2-protease has been reported to be a rate-limiting step in secretion(30) . In order to best mimic the authentic KEX2-processing site (Lys-ArgGlu-Ala), the Glu-Ala dipeptide which belongs to the signal sequence of preprocathepsin B was not deleted during construction of the fusion protein. Indeed, the fusion proMF-procathepsin B was never observed in the culture supernatant of transformed yeast cells.

Purification of Secreted Recombinant Procathepsin B

The eluant of the metal chelate chromatography depended on the elution method applied (Fig. 2C). When using EDTA to desorb the protein from the matrix, a single protein of about 40 kDa (theoretical molecular mass of procathepsin B, 38 kDa) was observed. When the protein was eluted by low pH, two immunoreactive proteins (40 kDa and 35 kDa) appeared in the eluant.

It was first considered that the 35-kDa protein is a degradation product of cathepsin B caused by a contaminating protease which is active either at low pH or in the absence of EDTA. However, when purified procathepsin B obtained by EDTA elution (pH 6.3) was incubated at pH 5, the 35-kDa protein was observed even in the presence of protease inhibitors (Fig. 3). The 35-kDa protein was absent when the thiol protease inhibitor E-64 was included in the incubation mixture.

Figure 3: Autoprocessing of procathepsin B. 20 pmol of procathepsin B (final concentration 1 µM) were incubated in 50 mM sodium phosphate, 300 mM NaCl, 10 mM DTT, pH 5.0, at 37 °C for 16 h in the presence and absence of protease inhibitors as indicated. M, molecular weight standards, E-64, addition of 1 µM E-64; PMSF, 2 mM phenylmethylsulfonyl fluoride; PepA, 1 µM pepstatin A; , no addition of protease inihibitor. The samples were analyzed by SDS-PAGE and Coomassie Blue staining .

Since no vacuolar cysteine protease has been detected in S. cerevisiae(32) and since the yeast strain used for expression is deficient in a subunit of yscE, the only known cellular cysteine protease of S. cerevisiae(33) , the 35-kDa protein is probably an autoprocessing product of procathepsin B. It is noteworthy that autocatalytic processing has also been described for mammalian cathepsin B (34, 35) and for papain(36) .

Structural Analysis

Figure 4: Amino-terminal sequences and processing sites. Amino-terminal sequences of recombinant procathepsin B (proCb), its autocatalytic product (intCb), and the pepsin-activated cathepsin B (pepCb), as determined by Edman degradation of the purified proteins, are compared with those of rat cathepsin B (R. nor.). The amino-terminal sequences of the mature enzymes are in bold letters. The amino termini of the recombinant schistosomal zymogen are indicated (>). Arrows indicate processing sites of KEX2 and STE13, of autoproteolysis (S. m. and R. nor.), and of pepsin activation. Processing sites of the rat enzyme were determined by Rowan et al.(34) . The sequences were aligned using GAP (GCG programm package). Identical amino acids residues are marked with asterisks, similar residues with dots.

In comparision with the native protein, the recombinant zymogen has a ragged amino terminus, is not glycosylated, due to the engineered mutation Asn-183 Gln, and has six additional carboxyl-terminal histidine residues. These carboxyl-terminal residues are not removed during expression when using the protease-deficient strain HT393. This is demonstrated by the fact that metal-chelate purification was feasible with this strain.

Enzymatic Analysis

In order to convert the inactive procathepsin B into an enzymatically active form, several proteases were tested. The aspartic protease pepsin was found to activate procathepsin B in a time- and dose-dependent manner (Fig. 5A). SDS-PAGE analysis of the activated protease revealed that a 34-kDa product only slightly shorter than autoprocessed intCb was the enzymatically active species (Fig. 5B). The amino terminus of this product, subsequently termed pepCb, was determined (Fig. 4) and revealed a pepsin digestion site only nine residues carboxyl-terminal to the autocatalytic cleavage site. The cleavage by pepsin occurs carboxyl-terminal to leucine, which is in line with the substrate specificity of pepsin. Interestingly, the removal of only nine amino acids, as compared to inactive intCb, is sufficient for activation.

Figure 5: Activation of schistosomal procathepsin B by pepsin. A, dose-dependent activation kinetics. 50 pmol of procathepsin B (final concentration 1 µM) were incubated with 120, 50, and 12 pmol of porcine pepsin. Aliquots of 10 pmol of cathepsin B were withdrawn at various time intervals for enzymatic analysis with the substrate Z-Arg-Arg-pNA, which is not hydrolyzed by pepsin. B, Coomassie Blue-stained SDS-PAGE gel of pepsinactivated cathepsin B. Lane 1, 10 pmol of intermediate cathepsin B (intCb); lane 2, 10 pmol of pepsin-activated cathepsin B (pepCb); lane M, molecular mass standard.

The pH dependence of pepsin-activated schistosomal cathepsin B was studied. It shows a roughly bell-shaped activity profile under nonsaturating substrate concentrations with a pH optimum around pH 6.0 (Fig. 6). As expected, schistosomal cathepsin B is susceptible to all thiol protease inhibitors tested (Table 1).

Figure 6: pH-activity profile of schistosomal cathepsin B. 15 pmol of pepsin-activated cathepsin B were added to the assay buffer (10 mM DTT, 1 µM pepstatin A, 0.4 mM EDTA) buffered with 100 mM NaHPO, 50 mM citrate (43) in the range of pH 2.5 to 8.0. The enzymatic reaction was started by the addition of 0.8 mM Z-Arg-Arg-pNA. The standard deviation of three assays is indicated.

A detailed comparison with native schistosomal cathepsin B is impossible since the native enzyme is only poorly characterized and doubts about the purity of the preparations persist(55) . Lindquist et al.(10) reported a very low K and k with the fluorogenic substrates Z-Arg-Arg-AMC and with other AMC derivates. We found K and k values which are more than one order of magnitude higher than the previously published kinetic data on schistosomal cathepsin B. However, the enzymatic properties of the recombinant schistosomal cathepsin B are in line with the better characterized mammalian cathepsin B (Table 2). Interestingly, schistosomal cathepsin B seems to prefer Z-Arg-Arg-AMC, whereas rat and human cathepsin B prefers the Phe-Arg derivate. Homology of primary structure between schistosomal cathepsin B and mammalian counterparts and the comparable kinetic data as well as similiar hemoglobin digestion patterns (Fig. 7) suggest that the recombinant cathepsin B is functionally equivalent to the native enzyme. In addition, recombinant cathepsin B from rat, expressed and secreted by S. cerevisiae, as well as human cathepsin B, expressed in E. coli, renaturated, and pepsin-activated, were both fully functional(25, 45) .

Figure 7: Hemoglobin digestion by cathepsin B. Approximately 1 nmol of substrate (globin or freshly oxygenated hemoglobin) was digested with approximately 50 pmol of pepsin-activated schistosomal cathepsin B or 5 pmol of bovine cathepsin B in 15 mM MES, 150 mM NaCl, 2 mM DTT, 1 mM EDTA, 2 µM pepstatin A, pH 5.9. The digestion reaction was allowed to proceed for 16 h before the reaction was analyzed by HPLC. a, human globin digested with 10 pmol of schistosomal cathespsin B. b, human hemoglobin digested with schistosomal cathepsin B. Major peaks (see arrows) underwent molecular mass determination and amino-terminal amino acid sequencing. c, human hemoglobin digested with bovine cathepsin B. d, as b but in the presence of 5 µM thiol-protease inhibitor E-64.

Active site titration with the inhibitor E-64 revealed that pepsin-activated recombinant cathepsin B was 60% active (data not shown). The inactive fraction can be explained by denaturation during fermentation and purification or by incomplete pepsin activation.

Schistosomal cathepsin B was originally described as a hemoglobinolytic protease isolated from the gut of S. mansoni. Although hemoglobin degradation was considered to be the physiological role of this protease, there are no reports to our knowledge concerning the degradation products of hemoglobin proteolysis.

We analyzed the peptide fragments of hemoglobin digestion by schistosomal cathepsin B. Peptide fragments were separated by HPLC. Peptides occurred only when cathepsin B was included in the digestion reaction and when the inhibitor E-64 was omitted from the reaction ( Fig. 7and Fig. 8). Unexpectedly, the overall pattern of peptides was very similiar regardless of enzyme source (bovine or schistosomal cathepsin B) or of substrate (freshly oxygenated hemoglobin, methemoglobin (not shown), or globin). Although globin digestion proceeded the fastest, we used freshly oxygenated hemoglobin for the digestion reaction in order to best mimic the in vivo situation. Major peptide fragments were subjected to molecular mass determination by matrix-assisted laser desorption/ionization time of flight mass spectrometry and amino-terminal amino acid sequencing. Considering an experimental error of 1 g/mol, it was impossible to unambiguously assign a peptide fragment from molecular mass determination alone. But, together with the amino-terminal amino acids, peptide fragments could be assigned (Table 3).

Figure 8: Globin degradation by schistosomal cathepsin B. 2 nmol of human globin /-chains were digested with approximately 150 pmol of pepsin-activated procathepsin B. The incubation was carried out in 10 mM DTT, 1 mM EDTA, 2 µM pepstatin A, 200 mM sodium phosphate, pH 6.0 at 37 °C. Aliquots were withdrawn at various time intervals as indicated. The control digestion reaction (lane C) contained 5 µM thiol-protease inhibitor E-64 and was allowed to proceed for 16 h at 37 °C. The digestion products were analyzed on a SDS-Tricine-polyacrylamide gel (16.5% total, 6% cross-linking, (22) ). Lane M, molecular mass standard.

The time course of globin digestion is best demonstrated by the SDS-PAGE analysis of peptides (Fig. 8). Peptide length decreases over the time of incubation. There do not seem to exist any particuliar stable peptide intermediates.

DISCUSSION

The aim of this study was the functional expression of schistosomal cathepsin B. This protease might play a key role in the nutrition of the parasitic worm and is highly immunogenic in man.

Functional expression of this important enzyme was unsuccessful in E. coli, but secretion by the host organism S. cerevisiae led to active enzyme. This is in line with former observations that secretion can be essential for correct folding and disulfide bridge formation of proteins which naturally pass through the secretion pathway(38, 39) . The expression/secretion of procathepsin B was optimized by using an inducible promoter and by increasing the number of expression units.

Purification using metal-chelate chromotography turned out to be extremely simple. There was no need to lyse cells, and the application of the highly specific adsorbent circumvented a volume reduction step usually required to purify secretory proteins.

Although the fusion protein proMF-procathepsin B was processed completely by the prohormone-processing enzyme KEX2, the recombinant protein displayed microheterogenity at the amino terminus (Fig. 4). Occurrence of the minor product with the amino-terminal residue His-3 can be explained by partial processing with STE13, an aminodipeptidylpeptidase which removes the spacer peptide Glu-Ala-(Glu/Asp)-Ala-Glu-Ala in three steps during processing of mating factor (40) . So far, we have no explanation for the appearance of the products with the amino-terminal amino acids Val-6 and Asn-8.

When comparing the primary structure of mammalian cathepsin B with schistosomal cathepsin B, it is evident that the amino acids of the mature enzymes are well conserved (50-60% identity) whereas those of the propeptide are more divergent (20-30% identity). Clearly, the mature enzyme has more structural restrains than the activation peptide. We also found that the enzymatic properties of rat cathepsin B and schistosomal cathepsin B are comparable.

On the other hand, we observed that the processing mode of the respective zymogens differs. According to Koelsch et al.(41) , there are three processing modes for zymogens: complete self-processing, partially assisted processing, and fully assisted processing. Rat cathepsin B is capable of complete self-processing (34) . Although we cannot completely rule out the possibility that a contaminating thiol protease is responsible for the appearance of intermediate schistosomal cathepsin B, our experimental evidence indicates that processing of schistosomal procathepsin B is partially assisted in vitro. In fact, despite numerous attempts under varying conditions, we did not succeed in obtaining active cathepsin B without an assisting protease.

In the case of aspartic proteases, the processing mode can be predicted to a limited extent from the primary structure(41) . Comparing the amino acid sequences of the propeptides, there is no obvious relationship between the processing site of mammalian cathepsin B (Gly/Met/Ala)Phe and schistosomal cathepsin B MetGly. Strikingly, neither site is conserved (Fig. 4) nor do they correspond with the specificity of cathepsin B, suggesting that the spatial organization might be important. However, the position of the processing sites differ by 19 amino acids. The mechanism of autoprocessing of mammalian cathepsin B is not understood, but kinetic data with propapain and human procathepsin B suggest that both intramolecular and intermolecular proteolysis takes place in vitro(35, 36) .

As the intermediate schistosomal cathepsin B is not active, it probably does not contribute to the conversion of procathepsin B. Rather, procathepsin B may undergo intramolecular processing, or minor amounts of mature cathepsin B (although not detected in enzyme assays) may catalyze the conversion. Future constructions of hybrid proteins and the introduction of specific amino acid changes in the propeptide of cathepsin B will shed light on the mechanism of zymogen activation and on the underlying structural requirements.

Upon incubation of procathepsin B or intermediate cathepsin B with pepsin, active enzyme was obtained. Since intermediate and pepsin-activated cathepsin B differ only by nine residues, it is tempting to speculate that the two adjacent arginines located within the removed peptide (Fig. 4) interact with the substrate binding site and block the enzyme as long as the peptide is covalently linked to the enzyme.

Our results prove that schistosomol cathepsin B cleaves human hemoglobin at several positions. We were able to determine some of the positions. A dicarboxypeptidase activity has been reported for cathepsin B(46) . Although our data did not give any hints that an exopeptidase activity was present, we only used the amino-terminal ends of fragments for the calculation of the consensus sequence of cleavage sites (Table 3). The consensus sequence 6X1181 (1, hydroxyl/small aliphatic; 6, aliphatic; 8, hydrophobic) revealed a low specificity toward primary structure. We are currently trying to better define the substrate specificity of schistosomal cathepsin B.

The early studies from Senft and co-workers (50, 51) suggested the existence of a protease which prefers hemoglobin toward globin. This result was taken as evidence that this protease is able to degrade human hemoglobin very specifically and effectively and was subsequently termed hemoglobinase. Cathepsin B is not inhibited by phenylalanine (not shown), a property attributed to the hemoglobinolytic activity analyzed by Senft and co-workers(50, 51) , and does not show a preference toward hemoglobin. Therefore, cathepsin B does not merit the term hemoglobinase and most likely is not identical with these early reports of hemoglobinolytic activity.

Cathepsin L and cathepsin D have also been proposed to play a crucial role in hemoglobin digestion (47, 48) but so far hemoglobin degradation by these proteases has not been studied in detail.

Hemoglobin digestion by the intraerythrocytic parasite Plasmodium falciparum has been analyzed more thoroughly(42, 49) . After the initial and specific attack of a hemoglobinolytic aspartic protease, hemoglobin molecules are further broken down by another aspartic protease and a cysteine protease. The three proteases are reported to act in a synergistic manner. Interestingly, the cysteine protease involved also prefers globin before hemoglobin. However, at this time, it is too early to speculate if hemoglobin digestion in S. mansoni proceeds analogously to the digestion in P. falciparum.

So far it is unclear how schistosomal cathepsin B is activated in vivo, whether cathepsin B preferentially degrades other human serum proteins, and how blood proteinase inhibitors act on cathepsin B. The procedure described here, however, makes it possible to obtain larger amounts of the zymogen, which will enable further studies to define the physiological role of this protease and its possible use in the diagnosis of bilharziosis.

FOOTNOTES

*

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§

To whom correspondence should be addressed: ScheBoTech, Bahnhofstrasse 6, D-35435 Wettenberg, Federal Republic of Germany. Tel.:49-6406-9155-16; Fax: 49-6406-9155-77.

()

G. Lipps, unpublished results.

()

The abbreviations used are: Z-Arg-Arg-pNA, N-benzyloxycarbonyl-L-arginyl-L-arginine-p-nitroanilide; Z-Arg-Arg-AMC, N-benzyloxycarbonyl-L-arginyl-L-arginine-7-amido-4-methylcoumarin; Z-Phe-Arg-AMC,N-benzyloxycarbonyl-L-phenylalanyl-L-arginine-7-amido-4-methylcoumarin; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis; HPLC, high performance liquid chromatography; MES, 4-morpholineethanesulfonic acid; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine; DTT, dithiothreitol.

ACKNOWLEDGEMENTS

REFERENCES

1. McKerrow, J. H. (1989) Exp. Parasitol. 68, 111-115 [CrossRef][Medline] [Order article via Infotrieve]
2. Karrer, M. K., P., Stacia, L. & DiTomas, M. E. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 3063-3067 [Abstract/Free Full Text]
3. Keppler, D., Abramanson, M. & Sordat, B. (1994) Biochem. Soc. Trans. 22, 43-49 [Medline] [Order article via Infotrieve]
4. Pratt, D., Cox, G. N., Milhausen, M. J. & Boisvenue, R. J. (1990) Mol. Biochem. Parasitol. 43, 181-192 [CrossRef][Medline] [Order article via Infotrieve]
5. Pratt, D., Boisvenue, R. J. & Cox, G. N. (1992) Mol. Biochem. Parasitol. 56, 39-48 [CrossRef][Medline] [Order article via Infotrieve]
6. Klinkert, M.-Q., Ruppel, A. & Beck, E. (1987) Mol. Biochem. Parasitol. 25, 247-255 [CrossRef][Medline] [Order article via Infotrieve]
7. Ray, C. & McKerrow, J. H. (1992) Mol. Biochem. Parasitol. 51, 239-250 [CrossRef][Medline] [Order article via Infotrieve]
8. Chappell, C. L. & Dresden, M. H. (1987) Arch. Biochem. Biophys. 256, 560-568 [CrossRef][Medline] [Order article via Infotrieve]
9. Timms, A. R. & Bueding, E. (1959) Br. J. Pharmacol. 14, 68-73 [Medline] [Order article via Infotrieve]
10. Lindquist, R. N., Senft, A. W., Petitt, M. & McKerrow, J. (1986) Exp. Parasitol. 61, 398-404 [CrossRef][Medline] [Order article via Infotrieve]
11. Dresden, M. H. & Deelder, A. M. (1979) Exp. Parasitol. 48, 190-197 [CrossRef][Medline] [Order article via Infotrieve]
12. Chappell, C. L. & Dresden, M. H. (1986) Exp. Parasitol. 61, 160-167 [CrossRef][Medline] [Order article via Infotrieve]
13. Klinkert, M.-Q., Bommert, K., Moser, D., Felleisen, R., Link, G., Doumbo, O. & Beck, E. (1991) Trop. Med. Parasitol. 42, 319-324 [Medline] [Order article via Infotrieve]
14. Klinkert, M.-Q., Ruppel, A., Felleisen, R., Link, G. & Beck, E. (1988) Mol. Biochem. Parasitol. 27, 233-240 [CrossRef][Medline] [Order article via Infotrieve]
15. Götz, B. & Klinkert, M.-Q. (1993) Biochem. J. 290, 801-806
16. Sambrook, J., Frisch, E. F. & Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratory, Cold Spring, NY
17. Felleisen, R. & Klinkert, M.-Q. (1990) EMBO J. 9, 371-377 [Medline] [Order article via Infotrieve]
18. Baldari, C., Murray, J. A. H., Ghiara, P., Cesareni, G. & Galeotti, C. L. (1987) EMBO J. 6, 229-234 [Medline] [Order article via Infotrieve]
19. Guarante, L., Yocum, R. R. & Gifford, P. (1982) Proc. Natl. Acad. Sci. U. S. A. 79, 7410-7414 [Abstract/Free Full Text]
20. Dohmen, R. J., Strasser, A. W. M., Höner, C. B. & Hollenberg, C. P. (1991) Yeast 7, 691-692 [CrossRef][Medline] [Order article via Infotrieve]
21. Laemmli, U. K. (1970) Nature 227, 680-685 [CrossRef][Medline] [Order article via Infotrieve]
22. Schägger, H. & von Jagow, G. (1987) Anal. Biochem. 166, 368-379 [CrossRef][Medline] [Order article via Infotrieve]
23. Matsudaira, P. (1987) J. Biol. Chem. 262, 10035-10038 [Abstract/Free Full Text]
24. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254 [CrossRef][Medline] [Order article via Infotrieve]
25. Hasnain, S., Hirama, T., Tam, A. & Mort, J. S. (1992) J. Biol. Chem. 267, 4713-4721 [Abstract/Free Full Text]
26. Marshall, R. D. (1972) Annu. Rev. Biochem. 41, 673-702 [CrossRef][Medline] [Order article via Infotrieve]
27. Bause, E. (1983) Biochem. J. 209, 331-336 [Medline] [Order article via Infotrieve]
28. Felleisen, R. (1990) Molekular biologische Ansätze zur Immundiagnose der Bilharziose und Charakterisierung der hierfür verwendeten Antigene Sm31 und Sm32 von Schistosoma mansoni. Ph.D. thesis, University of Heidelberg, Germany
29. Ernst, J. F. (1986) DNA (NY) 5, 483-491 [Medline] [Order article via Infotrieve]
30. Hitzeman, R. A., Chen, C. Y., Dowbenko, D. J., Renz, M. E., Liu, C., Pai, R., Simpson, N. J., Kohr, W. J., Singh, W. J., Chisholm, V., Hamilton, R. & Chang, C. N. (1990) Methods Enzymol. 185, 421-440 [Medline] [Order article via Infotrieve]
31. Hochuli, E., Bannwarth, W., Döbeli, H., Gentz, R. & Stüber, D. (1988) Bio/Technology 6, 1321-1325 [CrossRef]
32. Jones, E. W. (1991) Methods Enzymol. 194, 428-453 [Medline] [Order article via Infotrieve]
33. Hirsch, H. H., Rendueles, P. S. & Wolf, D. H. (1989) in Molecular and Cell Biology of Yeast (Walton, E. F. & Yarranton, G. T., eds) pp. 134-200, Blackie, Glasgow
34. Rowan, A. D., Mason, P., Mach, L. & Mort, J. S. (1992) J. Biol. Chem. 267, 15993-15999 [Abstract/Free Full Text]
35. Mach, L., Mort, J. S. & Glössl, J. (1994) J. Biol. Chem. 269, 13030-13055 [Abstract/Free Full Text]
36. Vernet, T., Khouri, H. E., Laflamme, P., Tessier, D. C., Musil, R., Gour-Salin, B. J., Storer, A. C. & Thomas, D. Y. (1991) J. Biol. Chem. 266, 21451-21457 [Abstract/Free Full Text]
37. Fox, T., de Miguel, E., Mort, J. S., and Storer, A. C. (1992) Biochemistry 31, 12571-12576 [CrossRef][Medline] [Order article via Infotrieve]
38. Duffaud, G. D., March, P. E. & Inouye, M. (1987) Methods Enzymol. 153, 492-507 [Medline] [Order article via Infotrieve]
39. Moir, D. T. & Davidow, L. S. (1991) Methods Enzymol. 194, 491-507 [Medline] [Order article via Infotrieve]
40. Fuller, R. S., Sterne, R. E. & Thorner, J. (1988) Annu. Rev. Physiol. 50, 345-362 [CrossRef][Medline] [Order article via Infotrieve]
41. Koelsch, G., Mares, M., Metcalf, P. & Fusek, M. (1994) FEBS Lett. 343, 6-10 [CrossRef][Medline] [Order article via Infotrieve]
42. Goldberg, D. E., Slater, A. F. G., Beavis, R., Chait, B., Cerami, A. & Henderson, G. B. (1991) J. Exp. Med. 173, 961-969 [Abstract/Free Full Text]
43. Stoll, V. S. & Blanchard, J. S. (1990) Methods Enzymol. 182, 24-38 [Medline] [Order article via Infotrieve]
44. Barrett, A. J. & Kirschke, H. (1981) Methods Enzymol. 80, 535-561
45. Kuhelj, R., Dolinar, M., Pungercar, J. & Turk, V. (1995) Eur. J. Biochem. 229, 533-539 [Medline] [Order article via Infotrieve]
46. Polgar, L. & Csoma, C. (1987) J. Biol. Chem. 262, 14448-14453 [Abstract/Free Full Text]
47. Dalton, J. P., Smith, A. M., Clough, K. A. & Brindley, P. J. (1995) Parasitol. Today 11, 299-303 [CrossRef][Medline] [Order article via Infotrieve]
48. Bogitsh, B. J., Kirschner, K. F. & Rotmans, J. P. (1992) J. Parasitol. 78, 454-459 [CrossRef][Medline] [Order article via Infotrieve]
49. Gluzman, I. Y., Francis, S. E., Oksman, A., Smith, C. E., Duffin, K. L. & Goldberg, D. E. (1994) J. Clin. Invest. 93, 1602-1608
50. Grant, C. T. & Senft, A. W. (1971) Comp. Biochem. Physiol. 38, 663-678 [CrossRef]
51. Sauer, M. C. V. & Senft, A. W. (1972) Comp. Biochem. Physiol. 42, 205-220 [CrossRef]
52. Barrett, A. J., Kembhavi, A. A., Brown, M. A., Kirschke, H., Knight, C. G., Tamai, M. & Hananda, K. (1982) Biochem. J. 201, 189-198 [Medline] [Order article via Infotrieve]
53. Dixon, H. B. F. & McIntosh, R. (1967) Nature 213, 399-400 [CrossRef][Medline] [Order article via Infotrieve]
54. Winterbourn, C. (1990) Methods Enzymol. 186, 265-272 [Medline] [Order article via Infotrieve]
55. El Meanawy, M. A., Aji, T., Phillips, N. F. B., Davis, R. E., Salata, R. A., Malhotra, I., McClain, D., Aikawa, M. & Davis, A. H. (1990) Am. J. Trop. Med. Hyg. 43, 67-78

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				C. Janoir, S. Pechine, C. Grosdidier, and A. Collignon Cwp84, a Surface-Associated Protein of Clostridium difficile, Is a Cysteine Protease with Degrading Activity on Extracellular Matrix Proteins J. Bacteriol., October 15, 2007; 189(20): 7174 - 7180. [Abstract] [Full Text] [PDF]

				A. L. Williamson, P. Lecchi, B. E. Turk, Y. Choe, P. J. Hotez, J. H. McKerrow, L. C. Cantley, M. Sajid, C. S. Craik, and A. Loukas A Multi-enzyme Cascade of Hemoglobin Proteolysis in the Intestine of Blood-feeding Hookworms J. Biol. Chem., August 20, 2004; 279(34): 35950 - 35957. [Abstract] [Full Text] [PDF]

				P. R. Collins, C. M. Stack, S. M. O'Neill, S. Doyle, T. Ryan, G. P. Brennan, A. Mousley, M. Stewart, A. G. Maule, J. P. Dalton, et al. Cathepsin L1, the Major Protease Involved in Liver Fluke (Fasciola hepatica) Virulence: PROPEPTIDE CLEAVAGE SITES AND AUTOACTIVATION OF THE ZYMOGEN SECRETED FROM GASTRODERMAL CELLS J. Biol. Chem., April 23, 2004; 279(17): 17038 - 17046. [Abstract] [Full Text] [PDF]

				R. H. P. Law, P. M. Smooker, J. A. Irving, D. Piedrafita, R. Ponting, N. J. Kennedy, J. C. Whisstock, R. N. Pike, and T. W. Spithill Cloning and Expression of the Major Secreted Cathepsin B-Like Protein from Juvenile Fasciola hepatica and Analysis of Immunogenicity following Liver Fluke Infection Infect. Immun., December 1, 2003; 71(12): 6921 - 6932. [Abstract] [Full Text] [PDF]

				C. P. Brady, A. J. Dowd, P. J. Brindley, T. Ryan, S. R. Day, and J. P. Dalton Recombinant Expression and Localization of Schistosoma mansoni Cathepsin L1 Support Its Role in the Degradation of Host Hemoglobin Infect. Immun., January 1, 1999; 67(1): 368 - 374. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Lipps, G. Articles by Beck, E. Search for Related Content PubMed PubMed Citation Articles by Lipps, G. Articles by Beck, E. Social Bookmarking