Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ferraris, J. D.
Right arrow Articles by García-Pérez, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ferraris, J. D.
Right arrow Articles by García-Pérez, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 271, Number 31, Issue of August 2, 1996 pp. 18318-18321
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

COMMUNICATION:
ORE, a Eukaryotic Minimal Essential Osmotic Response Element
THE ALDOSE REDUCTASE GENE IN HYPEROSMOTIC STRESS*

(Received for publication, March 8, 1996, and in revised form, April 19, 1996)

Joan D. Ferraris Dagger , Chester K. Williams , Kyu-Yong Jung , Jennifer J. Bedford §, Maurice B. Burg and Arlyn García-Pérez

From the Laboratory of Kidney and Electrolyte Metabolism, NHLBI, National Institutes of Health, Bethesda, Maryland 20892-1598

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES


ABSTRACT

Organisms, almost universally, adapt to hyperosmotic stress through increased accumulation of organic osmolytes but the molecular mechanisms have only begun to be addressed. Among mammalian tissues, renal medullary cells are uniquely exposed to extreme hyperosmotic stress. Sorbitol, synthesized through aldose reductase, is a predominant osmolyte induced under hyperosmotic conditions in renal cells. Using a rabbit renal cell line, we originally demonstrated that hyperosmotic stress induces transcription of the aldose reductase gene. Recently, we cloned the rabbit aldose reductase gene, characterized its structure, and found the first evidence of an osmotic response region in a eukaryotic gene. Now, we have progressively subdivided this 3221-base pair (bp) region into discrete fragments in reporter gene constructs. Thereby, we have functionally defined the smallest sequence able to confer hyperosmotic response on a downstream gene independent of other putative cis-elements, that is, a minimal essential osmotic response element (ORE). The sequence of the ORE is CGGAAAATCAC(C) (bp -1105/-1094). A 17-bp fragment (-1108/-1092) containing the ORE used as a probe in electrophoretic mobility shift assays suggests hyperosmotic induction of a slowly migrating band. Isolation of trans-acting factor(s) and characterization of their interaction with the ORE should elucidate the basic mechanisms for regulation of gene expression by hyperosmotic stress.


INTRODUCTION

In nature, one of the most prevalent types of stress is that caused by prolonged exposure of an organism to a hyperosmotic environment. Although the cellular responses to hyperosmotic stress are among the most profound, the molecular mechanisms involved have only recently begun to be addressed. Thus, contrary to the earnest study of heat shock at the molecular level, relatively little is known about the cascade of signals between the initial extracellular stimulus (hyperosmolality) and the ultimate adaptative response. It is recognized that, across the evolutionary spectrum, organisms have developed a universal adaptation process to cope with hyperosmotic stress; that is, increased accumulation of osmotically active organic solutes (organic osmolytes) (1). Cells accumulate high concentrations of organic osmolytes in place of inorganic ions. This is because, unlike equivalent concentrations of inorganic ions, the organic osmolytes apparently are not perturbing to cellular macromolecules (1).

Some of the predominant organic osmolytes are: betaine in bacteria (e.g. Escherichia coli) (2), glycerol in yeast (e.g. Saccharomyces cerevisiae) (3, 4), and sorbitol and betaine in cells of the mammalian renal medulla, the only mammalian tissue routinely exposed to extreme hyperosmotic stress in normal physiological conditions (5). In bacteria, where the molecular mechanisms for accumulation of organic osmolytes have been studied most extensively, hyperosmotic stress induces transcription of the proU operon. proU encodes the transport system involved in accumulation of betaine (2). Osmotic control of proU transcription is exerted, at least in part, by an ``upstream activating region'' that is currently being characterized by several groups (reviewed in Ref. 2). In S. cerevisiae, studies of the <UNL>h</UNL>igh-<UNL>o</UNL>smolarity <UNL>g</UNL>lycerol (HOG) response have concentrated on the signal transduction pathway immediately following hyperosmotic stress and preceding induction of target genes that directly control accumulation of glycerol (reviewed in Ref. 4). Thus, only one ultimate gene target in the HOG pathway has been identified. That is GPD1, which encodes glycerol-3-phosphate dehydrogenase, one of the two enzymes that catalyze the synthesis of glycerol. Most recently, osmotic stress was shown to increase glycerol-3-phosphate dehydrogenase activity and mRNA levels (3). The identification of GPD1 gene regions that control the osmotic response has not been reported.

In mammalian renal medullary cells under hyperosmotic stress, the synthesis of sorbitol, catalyzed by aldose reductase (AR),1 is increased (6). PAP-HT25 cells are a line of rabbit inner medullary cells (7) that accumulate large amounts of sorbitol (8) and other organic osmolytes (9) under hyperosmotic conditions. Using this line, we originally demonstrated that hyperosmotic stress induces transcription of the AR gene (10), resulting in increased AR mRNA levels (11), followed by a rise in AR protein synthesis rate (12) and, ultimately, increased sorbitol accumulation (13). Recently, we cloned the rabbit AR gene, characterized its structure, and found the first evidence of an osmotic response element (ORE) within a eukaryotic gene (14). A 3221 base pair (bp) fragment of the 5'-flanking region of the aldose reductase gene was shown to confer osmotic response to a downstream luciferase gene with the AR promoter as well as with a heterologous, B19, promoter (14). Here, we present the identification of the minimal essential ORE that controls induction of AR transcription by hyperosmotic stress.


EXPERIMENTAL PROCEDURES

Reporter Gene Expression Analysis of Transient Transfectants

Expression vectors, 007Luc, ARLuc, and B19CAT, were as described (14). 007Luc is promoterless and contains the luciferase gene, whereas ARLuc contains the rabbit AR promoter (bp -208/+27) in unique XhoI-HindIII sites immediately upstream of the luciferase gene. ARLuc was previously demonstrated to exhibit basal promoter activity (as construct ARLuc6 in Ref. 14). B19CAT contains the B19 promoter immediately upstream of the chloramphenicol acetyltransferase (CAT) gene (14, 15). ARL and TKL were constructed to obtain the ability to subclone AR fragments directionally in vectors containing either the AR or a heterologous promoter from the polyoma virus thymidine kinase (TK) gene, respectively, upstream of the luciferase gene. ARL and TKL vectors were constructed by using PCR primers synthesized with appropriate restriction enzyme sites toward their 5' ends. ARL contains the AR promoter (bp -208/+27) flanked immediately upstream by XhoI, NcoI, and KpnI sites and immediately downstream by AflII and HindIII sites. TKL contains the same restriction enzyme sites flanking the mutant polyoma virus enhancer PYF441 and the thymidine kinase promoter PCR-amplified as a unit from pSSC-9 (16). The AR and TK promoters were subcloned directionally into unique XhoI-HindIII sites in 007Luc to produce ARL and TKL.

AR fragments longer than 70 bp to be subcloned into expression vectors were PCR-amplified from genomic clone gAR56-5 (GenBankTM accession number is U12317[GenBank]) (14) using primers synthesized with appropriate restriction enzyme sites toward their 5' end. Fragments less than 70 bp, inclusive of appropriate restriction enzyme sites, were created by annealing synthesized sense and antisense oligonucleotides (DNA/RNA Synthesizer, model 392, Applied Biosystems Inc.). Fragments were subcloned into the XhoI site of ARLuc, followed by selection of clones carrying the fragment in the forward direction. Alternatively, fragments were directionally cloned into the XhoI-KpnI sites of ARL or TKL. Construct sequences were verified by primer-directed, double-stranded plasmid sequencing (Sequenase DNA Sequencing Kit, U. S. Biochemical Corp.). To confirm osmotic regulation of a heterologous promoter by the ORE, a 17-bp fragment (bp -1108/-1092) containing the minimal essential ORE was subcloned in the forward direction into the XhoI-KpnI sites of TKL upstream of the TK promoter.

Transfection, Luciferase, and CAT Assays

Transfections were performed as described previously (14). Briefly, rabbit renal medulla PAP-HT25 cells (passage 72-80) were grown in isoosmotic medium (300 mosm/kg H2O) (7) in 150-mm dishes (Corning) and co-transfected with a given luciferase construct (3 µg) and B19CAT (12-20 µg) using Cell-Phect (Pharmacia Biotech Inc.). From each transfected 150-mm dish, cells were seeded into six 35-mm dishes and left overnight. The medium in three of the dishes was changed to fresh isoosmotic medium (300 mosm/kg H2O); the medium in the three other dishes was changed to the same medium made hyperosmotic (500 mosm/kg H2O) with NaCl. Twenty-four hours after changing the medium, cells were harvested by adding 100 µl of lysis buffer (Enhanced Luciferase Assay Kit, Analytical Luminescence Laboratory).

Cell lysates were analyzed for total protein, luciferase activity, and CAT protein using the following kits as per manufacturers' instructions. Total protein was determined using the Bio-Rad Protein Assay Kit (Bio-Rad, using gamma -globulin as standard). Luciferase activity was determined using the Enhanced Luciferase Assay Kit and a Monolight 2010 Luminometer (Analytical Luminescence Laboratory). The amount of CAT was determined using CAT Elisa Kits (5 Prime right-arrow 3 Prime, Inc. or Boehringer Mannheim) and a Titertek Multiskan plate reader with a 405-nm filter.

Transfection Data Analyses

Luciferase activity in relative light units/µg of cell protein was normalized by CAT protein in picograms (from the co-transfected B19CAT construct)/µg of cell protein.

Electrophoretic Mobility Shift Assays

Nuclei were isolated (17) from PAP-HT25 cells maintained in isoosmotic medium (300 mosm/kg H2O) and from cells exposed for 18-24 h to the same medium made hyperosmotic (500 mosm/kg H2O) with NaCl (11). Nuclear protein extracts were prepared after the method of Frain (18) except that buffer D contained 650 mM NaCl. 32P-End-labeled double-stranded oligonucleotides (3-5 × 104 cpm containing 10-20 fmol) were incubated with 4 µg of nuclear protein extract, 0.5 µg of poly(dI-dC), and 0-1.7 pmol (0-100-fold molar excess) unlabeled specific competitor oligonucleotide (AR gene bp -1108/-1092) in binding buffer (19) for 30 min at room temperature. Reactions were electrophoresed on a 4% polyacrylamide gel (80:1, acrylamide:bisacrylamide) in 1 × TAE buffer at 4 °C (19). Autoradiograms were exposed at -80 °C. Oligonucleotides were synthesized directly to produce sequence that corresponds to AR gene bp -1108/-1092 (17 bp).


RESULTS AND DISCUSSION

We first identified a 3221-bp region of DNA (-3429/-209) that contained a putative osmotic response element (as construct ARLuc9 in Ref. 14) (Table I). We have now proceeded to functionally identify within that fragment the smallest sequence that could confer osmotic response on a downstream gene independent of other putative cis-elements that may potentiate the response; that is, a minimal essential osmotic response element. Instead of traditional nested deletions, we increasingly subdivided the -3429/-209 region into discrete pieces and tested them individually. This allowed us to examine all fragments for independent osmotic response as opposed to only those fragments that remain after deletion. All fragments were synthesized either by PCR amplification (>= 146 bp) or directly on a DNA synthesizer and tested for ability to confer osmotic response to a luciferase gene driven by the rabbit aldose reductase promoter (-208/+27) (14, 20) in transient transfection assays (Table I). As shown in Table I in the ARLuc constructs, the most upstream region (-3429/-2686 and -2705/-1152) of the 3221-bp fragment (-3429/-209) did not generate osmotic response. However, the downstream 962 bp (-1170/-209) retained osmotic response. Within this 962-bp fragment, osmotic response was confined to an upstream 679-bp fragment (-1170/-492).

Table I.

Effect of hyperosmolality on reporter gene expression in transient transfectants

Transfected PAP-HT25 cells were maintained in isoosmotic medium (ISO) (300 mosm/kg H2O) or exposed to hyperosmotic medium (HYPER) (500 mosm/kg H2O) for 18-24 h. Values are expressed as the ratio of HYPER divided by ISO. 007Luc is promoterless, ARLuc and ARL contain the rabbit AR promoter (bp -208 to +27), and TKL contains the thymidine kinase (TK) promoter; all promoters are upstream of the luciferase gene. DNA fragments from the rabbit AR gene were inserted upstream of the AR promoter in ARLuc and ARL or upstream of the TK promoter in TKL; these fragments are shown directly below their corresponding promoter. Positions of nucleotides that define the AR gene DNA fragments are numbered with the first nucleotide of exon 1 as +1. Positive numbers indicate nucleotides downstream of +1; negative numbers are nucleotides upstream of +1. For constructs demonstrating hyperosmotic response, the size of the DNA fragment is shown in parentheses. Tandem repeats of selected fragments are indicated (e.g. 3X). Cells were co-transfected with a given luciferase construct and B19CAT. B19CAT contains the B19 promoter upstream of the CAT gene. Luciferase activity in relative light units/µg of cell protein was normalized by CAT protein in picograms/µg cell protein (Luc/CAT). *HYPER/ISO is the ratio of Luc/CAT in hyperosmotic medium divided by Luc/CAT in isoosmotic medium (mean ± standard error). **HYPER/ISO is the ratio of Luc/CAT in hyperosmotic medium divided by Luc/CAT in isoosmotic medium expressed relative to the construct containing the promoter alone (mean ± standard error); these data are shown only for constructs demonstrating hyperosmotic response. n is the number of independent transfections.
Construct *HYPER/ISO (n) **HYPER/ISO relative to promoter

ARLuc (-208/+27) 3.5  ± 0.64 (8) 1.0
 -3429/-209 (3221 bp) 33.1  ± 3.83 (8) 9.4  ± 1.09
 -3429/-2686 1.9  ± 0.18 (2)
 -2705/-1152 1.4  ± 0.36 (2)
 -1170/-209 (962 bp) 21.1  ± 0.16 (2) 6.0  ± 0.04
 -510/-209 1.7 (1)
 -1170/-492 (679 bp) 20.2  ± 4.16 (3) 5.7  ± 1.18
 -1170/-894 (277 bp) 9.2  ± 1.52 (3) 2.6  ± 0.43
 -993/-697 3.0  ± 1.05 (3)
 -770/-492 2.9  ± 0.63 (3)
ARL (-208/+27) 2.4  ± 0.09 (27) 1.0
 -1170/-492 (679 bp) 11.5  ± 1.30 (7) 4.8  ± 0.54
 -1170/-894 (277 bp) 12.7  ± 2.46 (2) 5.3  ± 1.26
 -1202/-1057 (146 bp) 8.1  ± 0.54 (15) 3.4  ± 0.22
 -1110/-957 (154 bp) 4.1  ± 0.66 (6) 1.7  ± 0.28
 -1025/-870 1.7  ± 0.37 (3)
 -1170/-1118 1.8  ± 0.20 (3)
 -1117/-1071 (47 bp) 5.3  ± 1.08 (3) 2.2  ± 0.45
 -1070/-1026 1.7  ± 0.02 (3)
 -1144/-1101 1.5  ± 0.12 (3)
 -1100/-1051 2.5  ± 0.18 (3)
 -1120/-1096 2.3  ± 0.47 (4)
 -1095/-1071 2.3  ± 0.10 (3)
 -1108/-1083 (26 bp) 4.5  ± 0.51 (3) 1.9  ± 0.17
 -1108/-1083 2X (26 bp 2X) 15.1  ± 0.55 (3) 6.3  ± 0.23
 -1108/-1092 (17 bp) 4.8  ± 0.22 (16) 2.0  ± 0.09
 -1108/-1092 3X (17 bp 3X) 28.6  ± 2.51 (3) 11.9  ± 1.05
 -1104/-1091 2.7  ± 0.08 (4)
 -1104/-1091 3X 2.9  ± 0.12 (3)
TKL 2.3  ± 0.12 (6)
 -1108/-1092 5.6  ± 0.83 (4) 2.5  ± 0.36
007Luc (promotorless) 2.0  ± 0.28 (8)

Initially, for the ARLuc constructs (Table I), the DNA fragments were cloned into the only available unique restriction enzyme (XhoI) site immediately upstream of the AR promoter. After having narrowed down the ORE to 277 bp (-1170/-894), the construct ARL was produced by adding, to ARLuc, unique restriction enzyme sites that would allow us to subclone directionally (see ``Experimental Procedures''). Since the added bases could affect function, we subcloned into ARL two of the fragments (-1170/-492 and -1170/-894) that had osmotic response in ARLuc. Indeed, these fragments continued to display osmotic response when in the ARL vector (Table I). Osmotic response was sequentially narrowed down to 47 bp (-1117/-1071), 26 bp (-1108/-1083), and then to 17 bp (-1108/-1092). This 17-bp sequence was also able to confer osmotic response to the TK promoter (Table I, TKL construct -1108/-1092).

Osmotic response had been gradually decreasing with the size of the fragment, as seen in the only other sequence identified as containing a eukaryotic osmotic response element (19). To better evaluate osmotic response, we created tandem repeats of the 26- and 17-bp fragments, hypothesizing that this would magnify the response. As shown in Table I, tandem repeats of sequence containing the ORE (-1108/-1083 two times and -1108/-1092 three times) markedly increased osmotic response. In constrast, tandem repeats (-1104/-1091 three times) of a fragment having no osmotic response (-1104/-1091) were unable to evoke the response. We conclude that the sequence -1108/-1092 alone can confer osmotic response. The gradual drop in magnitude with decreasing fragment size suggests the possibility that other cis-elements may potentiate the osmotic response.

By gradually eliminating base pairs from the 17-bp fragment (-1108/-1092) we continued to functionally define the minimal essential osmotic response element. As shown in Fig. 1, upstream bp -1108 to -1106 are unnecessary for osmotic response. However removal of bp -1105 eliminates osmotic response, thereby defining the upstream end of the ORE to be bp -1105. Relative to the downstream end of the element, construct -1108/-1094 retained osmotic response (Fig. 1). In addition, we had observed previously that when we subdivided the 47-bp fragment (-1117/-1071) into two pieces (Table I, ARL constructs -1120/-1096 and -1095/-1071), thereby splitting between bp -1096 and -1095, all osmotic response was lost. We concluded that bp -1095 was essential. If bp -1094, a cytidine (C), is substituted by an adenosine (A), osmotic response is unaffected. However, ARL construct -1108/-1095 showed a Hyper/Iso response equal to 3.5 ± 0.25 (1.5 ± 0.10 relative to ARL, Fig. 1). We conclude that bp -1094 may be necessary, but it need not be a pyrimidine, and that the minimal essential ORE is defined by bp -1105/-1094.


Fig. 1. The aldose reductase minimal essential osmotic response element (ORE). Transfected PAP-HT25 cells were maintained in isoosmotic medium (Iso) (300 mosm/kg H2O) or exposed to hyperosmotic medium (Hyper) (500 mosm/kg H2O) for 18-24 h. Values are expressed as the ratio of Hyper divided by Iso. ARL contains the rabbit AR promoter (bp -208/+27) upstream of the luciferase gene. DNA fragments from the rabbit AR gene were inserted upstream of the AR promoter in ARL. Positions of nucleotides that define the AR gene DNA fragments are numbered with the first nucleotide of exon 1 as +1. Negative numbers are nucleotides upstream of +1. As indicated by an underline, bp -1102 was mutated from an A to a G and bp -1094 was mutated from a C to an A. Cells were co-transfected with a given luciferase construct and B19CAT. B19CAT contains the B19 promoter upstream of the CAT gene. Luciferase activity in relative light units/µg of cell protein was normalized by CAT protein in picograms/µg of cell protein (Luc/CAT). *Hyper/Iso is the ratio of Luc/CAT in hyperosmotic medium divided by Luc/CAT in isoosmotic medium (mean ± standard error). **Hyper/Iso is the ratio of Luc/CAT in hyperosmotic medium divided by Luc/CAT in isoosmotic medium expressed relative to ARL (Hyper/Iso = 2.4 ± 0.09 and Table I) (mean ± standard error); these data are shown only for constructs demonstrating hyperosmotic response. [n] is the number of independent transfections.
[View Larger Version of this Image (36K GIF file)]

We noted, particularly because of the concentration of purines at the 5' end of the ORE, the similarity between a nucleotide (nt) sequence (nt -1104/-1095; GGAAAATCAC) within it and the consensus sequence for the NF-kappa B element (GGG(A/G)NN(C/T)(C/T)(C/A/T)C) (21). However, the sequence -1104/-1095 does not fit the NF-kappa B consensus at nucleotide -1102 where all currently recognized NF-kappa B elements have a guanosine (G) at the corresponding nucleotide (21). To determine whether the ORE would retain osmotic response if its sequence were modified to include an NF-kappa B element consensus, we substituted base -1102, an adenosine (A), by a guanosine (G) (underlined in Fig. 1) as in an NF-kappa B element. Osmotic response was lost (Fig. 1); we conclude that, at least based on cis-element sequence, the ORE does not contain an NF-kappa B element.

The same experiment provided information relative to a putative ORE consensus. As shown below, the ORE shares six consecutive base pairs (-1104/-1099, GGAAAA) in common with TonE, the only other sequence identified as containing a eukaryotic osmotic response element (19). TonE regulates the hyperosmotic response of the dog renal Na+- and Cl--coupled betaine transporter responsible for accumulation of betaine, another organic osmolyte (22, 23, 24). In TonE, when five of the 6 bases (GAAAA) were simultaneously substituted by TCCCC, osmotic response was lost (19).
<AR><R><C>Dog TonE: 5′ TACTTGGTGGAAAAGTCCAG 3′</C></R><R><C>Rabbit AR-ORE:      5′ CGGAAAATCAC(C) 3′</C></R></AR>
By defining the minimal essential osmotic response element in the aldose reductase gene, we have shown that these 6 bases, although conserved, do not suffice to confer the response. However, as referred to above, we have also demonstrated that, substitution of only one of the six nucleotides (nt -1102 in the ORE), an adenosine (A), with another purine, a guanosine (G), eliminates osmotic response. Identification of other osmotic response elements should better define a eukaryotic osmotic response consensus, if there is one.

To test for interaction of the ORE with putative osmotically induced transcription factors, we performed electrophoretic mobility shift assays of the ORE in the presence of nuclear protein extracts prepared either from cells maintained in isoosmotic medium or cells exposed to hyperosmotic medium for 18-24 h. We used bp -1108/-1092 as the probe. This fragment had been shown to confer osmotic response to the luciferase gene in transfection analyses (Table I). A slowly migrating but narrow band (arrow) was observed predominantly with extracts from hyperosmotically treated cells in the presence of 0.5 µg of poly(dI-dC) (Fig. 2, lane 6). As shown in Fig. 2, a 50-fold molar excess of unlabeled (cold) probe reduces and a 100-fold molar excess virtually eliminates the narrow slowly migrating band (lanes 7 and 8, respectively). An additional, faster migrating and very broad band also remains in the presence of poly(dI-dC) but is eliminated by a 100-fold molar excess of the specific competitor (bp -1108/-1092). This band is also present in lanes containing extract from isoosmotically treated cells but to a lesser degree than that seen in lanes containing extract from hyperosmotically treated cells. These mobility shift assays represent exploratory evidence that hyperosmotic stress results in the induction of putative trans-acting factor(s) that associate with the aldose reductase ORE. Isolation of these trans-acting factor(s) and characterization of their interaction with the ORE should elucidate the basic mechanisms for regulation of gene expression by hyperosmotic stress.


Fig. 2. Electrophoretic mobility shift assay of the AR ORE in the presence of specific competitor. A radiolabeled 17-bp oligonucleotide corresponding to bp -1108/-1092 in the aldose reductase gene was used. The oligonucleotide was incubated with 4 µg of nuclear protein extract from PAP-HT25 cells maintained in isoosmotic medium (Iso, lanes 1-4) (300 mosm/kg H2O) or exposed to hyperosmotic medium (Hyper, lanes 5-8) (500 mosm/kg H2O) in the presence (+) (lanes 2-4, 6-8) and absence (-) (lanes 1 and 5) of 500 ng of poly(dI-dC) (dIC). Incubations were also in the presence (lanes 3, 4, 7, 8) or absence (-) (lanes 1, 2, 5, 6) of 50- or 100-fold molar excess of unlabeled specific competitor oligonucleotide (cold -1108/-1092). Lane 9, radiolabeled oligonucleotide (bp -1108/-1092) alone.
[View Larger Version of this Image (43K GIF file)]


FOOTNOTES

*   The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    To whom correspondence should be addressed: National Institutes of Health, Bldg. 10, Rm. 6N307, 10 Center Dr. MSC 1598, Bethesda, MD 20892-1598. Tel.: 301-496-1559; Fax: 301-402-1443; E-mail: jdf{at}helix.nih.gov.
§   On sabbatical leave from Department of Physiology, University of Otago, Dunedin, New Zealand. Dr. Jennifer J. Bedford's sabbatical leave was supported by the Health Research Council of New Zealand and the New Zealand Lottery Grants Board.
1   The abbreviations used are: AR, aldose reductase; ORE, osmotic response element; CAT, chloramphenicol acetyltransferase; bp, base pair(s); nt, nucleotide(s); TK, thymidine kinase; PCR, polymerase chain reaction.

Acknowledgments

We thank Drs. Jarvis Reed and Michael M. Gottesman, National Cancer Institute, for the gift of pSSC-9 and Dr. Mark M. Garner, FMC Bioproducts, and Dr. Hyug-Moo Kwon, Division of Nephrology, The Johns Hopkins University School of Medicine, for valuable advice regarding the electrophoretic mobility shift assays.


REFERENCES

  1. Yancey, P., Clark, M., Hand, S., Bowlus, R., Somero, G. (1982) Science 217, 1214-1222 [Abstract/Free Full Text]
  2. Lucht, J. M., Bremer, E. (1994) FEMS Microbiol. Rev. 14, 3-20 [CrossRef][Medline] [Order article via Infotrieve]
  3. Albertyn, J., Hohmann, S., Thevelein, J. M., Prior, B. A. (1994) Mol. Cell. Biol. 14, 4135-4144 [Abstract/Free Full Text]
  4. Levin, D. E., Errede, B. (1995) Curr. Opin. Cell Biol. 7, 197-202 [CrossRef][Medline] [Order article via Infotrieve]
  5. Garcia-Perez, A., Burg, M. B. (1991) Physiol. Rev. 71, 1081-1115 [Abstract/Free Full Text]
  6. Cowley, B. D., Jr., Ferraris, J. D., Carper, D., Burg, M. B. (1990) Am. J. Physiol. 258, F154-F161 [Abstract/Free Full Text]
  7. Uchida, S., Green, N., Coon, H., Triche, T., Mims, S., Burg, M. (1987) Am. J. Physiol 253, C230-C242 [Abstract/Free Full Text]
  8. Bagnasco, S., Uchida, S., Balaban, R., Kador, P., Burg, M. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 1718-1720 [Abstract/Free Full Text]
  9. Moriyama, T., Garcia-Perez, A., Burg, M. B. (1990) Am. J. Physiol. 259, F847-F858 [Abstract/Free Full Text]
  10. Smardo, F., Burg, M., Garcia-Perez, A. (1992) Am. J. Physiol. 262, C776-C782 [Abstract/Free Full Text]
  11. Garcia-Perez, A., Martin, B., Murphy, H. R., Uchida, S., Murer, H., Cowley, B. D., Handler, J. S., Burg, M. B. (1989) J. Biol. Chem. 264, 16815-16821 [Abstract/Free Full Text]
  12. Moriyama, T., Garcia-Perez, A., Burg, M. B. (1989) J. Biol. Chem. 264, 16810-16814 [Abstract/Free Full Text]
  13. Uchida, S., Garcia-Perez, A., Murphy, H., Burg, M. B. (1989) Am. J. Physiol. 256, C614-C620 [Abstract/Free Full Text]
  14. Ferraris, J. D., Williams, C. K., Martin, B. M., Burg, M. B., Garcia-Perez, A. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 10742-10746 [Abstract/Free Full Text]
  15. Liu, J., Fujii, H., Green, S., Komatsu, N., Young, N., Shimada, T. (1991) Virology 182, 361-364 [CrossRef][Medline] [Order article via Infotrieve]
  16. Chauhan, S. S., Gottesman, M. M. (1992) Gene (Amst.) 120, 281-286 [CrossRef][Medline] [Order article via Infotrieve]
  17. Hagenbuchle, O., Wellauer, P. K. (1992) Nucleic Acids Res. 20, 3555-3559 [Abstract/Free Full Text]
  18. Frain, M., Swart, G., Monaci, P., Nicosia, A., Stampfli, S., Frank, R., Cortese, R. (1989) Cell 59, 145-157 [CrossRef][Medline] [Order article via Infotrieve]
  19. Takenaka, M., Preston, A. S., Kwon, H. M., Handler, J. S. (1994) J. Biol. Chem. 269, 29379-29381 [Abstract/Free Full Text]
  20. Wang, K., Bohren, K., Gabbay, K. (1993) J. Biol. Chem. 268, 16052-16058 [Abstract/Free Full Text]
  21. Baeuerle, P. A. (1991) Biochim. Biophys. Acta 1071, 63-80
  22. Robey, R., Kwon, M., Handler, J., Garcia-Perez, A., Burg, M. (1991) J. Biol. Chem. 266, 10400-10405 [Abstract/Free Full Text]
  23. Yamauchi, A., Uchida, S., Kwon, H., Preston, A., Robey, R., Garcia-Perez, A., Burg, M., Handler, J. (1992) J. Biol. Chem. 267, 649-652 [Abstract/Free Full Text]
  24. Takenaka, M., Bagnasco, S., Preston, A., Uchida, S., Yamauchi, A., Kwon, H., Handler, J. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 1072-1076 [Abstract/Free Full Text]

©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Physiol. Rev.Home page
E. K. Hoffmann, I. H. Lambert, and S. F. Pedersen
Physiology of Cell Volume Regulation in Vertebrates
Physiol Rev, January 1, 2009; 89(1): 193 - 277.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
T. Rodgaard, K. Schou, M. B. Friis, and E. K. Hoffmann
Does the intracellular ionic concentration or the cell water content (cell volume) determine the activity of TonEBP in NIH3T3 cells?
Am J Physiol Cell Physiol, December 1, 2008; 295(6): C1528 - C1534.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
T. Saito, T. Saito, K. Kasono, H. Tamemoto, M. Kawakami, S. Sasaki, and S.-e Ishikawa
Hypotonicity reduces the activity of murine aquaporin-2 promoter induced by dibutyryl cAMP
Exp Physiol, October 1, 2008; 93(10): 1147 - 1156.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
G. Rodriguez-Fuentes, R. Aparicio-Fabre, Q. Li, and D. Schlenk
Osmotic Regulation of a Novel Flavin-Containing Monooxygenase in Primary Cultured Cells from Rainbow Trout (Oncorhynchus mykiss)
Drug Metab. Dispos., July 1, 2008; 36(7): 1212 - 1217.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
F. Klaus, M. Palmada, R. Lindner, J. Laufer, S. Jeyaraj, F. Lang, and C. Boehmer
Up-regulation of hypertonicity-activated myo-inositol transporter SMIT1 by the cell volume-sensitive protein kinase SGK1
J. Physiol., March 15, 2008; 586(6): 1539 - 1547.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. E. Irarrazabal, C. K. Williams, M. A. Ely, M. J. Birrer, A. Garcia-Perez, M. B. Burg, and J. D. Ferraris
Activator Protein-1 Contributes to High NaCl-induced Increase in Tonicity-responsive Enhancer/Osmotic Response Element-binding Protein Transactivating Activity
J. Biol. Chem., February 1, 2008; 283(5): 2554 - 2563.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
M. B. Burg, J. D. Ferraris, and N. I. Dmitrieva
Cellular Response to Hyperosmotic Stresses
Physiol Rev, October 1, 2007; 87(4): 1441 - 1474.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
L. Lopez-Bojorquez, P. Villalobos, C. Garcia-G., A. Orozco, and C. Valverde-R.
Functional identification of an osmotic response element (ORE) in the promoter region of the killifish deiodinase 2 gene (FhDio2)
J. Exp. Biol., September 1, 2007; 210(17): 3126 - 3132.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Gallazzini, J. D. Ferraris, M. Kunin, R. G. Morris, and M. B. Burg
Neuropathy target esterase catalyzes osmoprotective renal synthesis of glycerophosphocholine in response to high NaCl
PNAS, October 10, 2006; 103(41): 15260 - 15265.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. Padda, A. Wamsley-Davis, M. C. Gustin, R. Ross, C. Yu, and D. Sheikh-Hamad
MEKK3-mediated signaling to p38 kinase and TonE in hypertonically stressed kidney cells
Am J Physiol Renal Physiol, October 1, 2006; 291(4): F874 - F881.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
W. Neuhofer and F.-X. Beck
Survival in Hostile Environments: Strategies of Renal Medullary Cells
Physiology, June 1, 2006; 21(3): 171 - 180.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
B. Yang, A. D. Hodgkinson, P. J. Oates, H. M. Kwon, B. A. Millward, and A. G. Demaine
Elevated activity of transcription factor nuclear factor of activated T-cells 5 (NFAT5) and diabetic nephropathy.
Diabetes, May 1, 2006; 55(5): 1450 - 1455.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
U. Hasler, M. Vinciguerra, A. Vandewalle, P.-Y. Martin, and E. Feraille
Dual Effects of Hypertonicity on Aquaporin-2 Expression in Cultured Renal Collecting Duct Principal Cells
J. Am. Soc. Nephrol., June 1, 2005; 16(6): 1571 - 1582.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
K. Kasono, T. Saito, T. Saito, H. Tamemoto, C. Yanagidate, S. Uchida, M. Kawakami, S. Sasaki, and S.-e Ishikawa
Hypertonicity regulates the aquaporin-2 promoter independently of arginine vasopressin
Nephrol. Dial. Transplant., March 1, 2005; 20(3): 509 - 515.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
F. Umenishi, S. Yoshihara, T. Narikiyo, and R. W. Schrier
Modulation of Hypertonicity-Induced Aquaporin-1 by Sodium Chloride, Urea, Betaine, and Heat Shock in Murine Renal Medullary Cells
J. Am. Soc. Nephrol., March 1, 2005; 16(3): 600 - 607.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
D. Sheikh-Hamad and M. C. Gustin
MAP kinases and the adaptive response to hypertonicity: functional preservation from yeast to mammals
Am J Physiol Renal Physiol, December 1, 2004; 287(6): F1102 - F1110.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. K. M. Lam, B. C. B. Ko, S. Tam, R. Morris, J. Y. Yang, S. K. Chung, and S. S. M. Chung
Osmotic Response Element-binding Protein (OREBP) Is an Essential Regulator of the Urine Concentrating Mechanism
J. Biol. Chem., November 12, 2004; 279(46): 48048 - 48054.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
K. V. Ramana, B. Friedrich, S. Srivastava, A. Bhatnagar, and S. K. Srivastava
Activation of Nulcear Factor-{kappa}B by Hyperglycemia in Vascular Smooth Muscle Cells Is Regulated by Aldose Reductase
Diabetes, November 1, 2004; 53(11): 2910 - 2920.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. C. Pingle, S. Mishra, A. Marcuzzi, S. G. Bhat, Y. Sekino, L. P. Rybak, and V. Ramkumar
Osmotic Diuretics Induce Adenosine A1 Receptor Expression and Protect Renal Proximal Tubular Epithelial Cells against Cisplatin-mediated Apoptosis
J. Biol. Chem., October 8, 2004; 279(41): 43157 - 43167.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
J. Steffgen, K. Kampfer, C. Grupp, C. Langenberg, G. A. Muller, and R. W. Grunewald
Osmoregulation of aldose reductase and sorbitol dehydrogenase in cultivated interstitial cells of rat renal inner medulla
Nephrol. Dial. Transplant., November 1, 2003; 18(11): 2255 - 2261.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Umenishi and R. W. Schrier
Hypertonicity-induced Aquaporin-1 (AQP1) Expression Is Mediated by the Activation of MAPK Pathways and Hypertonicity-responsive Element in the AQP1 Gene
J. Biol. Chem., April 25, 2003; 278(18): 15765 - 15770.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. Storm, E. Klussmann, A. Geelhaar, W. Rosenthal, and K. Maric
Osmolality and solute composition are strong regulators of AQP2 expression in renal principal cells
Am J Physiol Renal Physiol, January 1, 2003; 284(1): F189 - F198.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Trama, W. Y. Go, and S. N. Ho
The Osmoprotective Function of the NFAT5 Transcription Factor in T Cell Development and Activation
J. Immunol., November 15, 2002; 169(10): 5477 - 5488.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
D. Chakravarty, Q. Cai, J. D. Ferraris, L. Michea, M. B. Burg, and D. Kultz
Three GADD45 isoforms contribute to hypertonic stress phenotype of murine renal inner medullary cells
Am J Physiol Renal Physiol, November 1, 2002; 283(5): F1020 - F1029.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J.-Y. Jung, Y.-H. Kim, J.-H. Cha, K.-H. Han, M.-K. Kim, K. M. Madsen, and J. Kim
Expression of aldose reductase in developing rat kidney
Am J Physiol Renal Physiol, September 1, 2002; 283(3): F481 - F491.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
D.-Y. Hwang and F. Ismail-Beigi
Stimulation of GLUT-1 glucose transporter expression in response to hyperosmolarity
Am J Physiol Cell Physiol, October 1, 2001; 281(4): C1365 - C1372.
[Abstract] [Full Text] [PDF]


Home page
Integr. Comp. Biol.Home page
J. D. Ferraris and A. Garcia-Perez
Osmotically Responsive Genes: The Mammalian Osmotic Response Element (ORE)
Integr. Comp. Biol., August 1, 2001; 41(4): 734 - 742.
[Abstract] [Full Text] [PDF]


Home page
Integr. Comp. Biol.Home page
D. Kultz
Evolution of Osmosensory MAP Kinase Signaling Pathways
Integr. Comp. Biol., August 1, 2001; 41(4): 743 - 757.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
T. Matsuzaki, T. Suzuki, and K. Takata
Hypertonicity-induced expression of aquaporin 3 in MDCK cells
Am J Physiol Cell Physiol, July 1, 2001; 281(1): C55 - C63.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. C. Dahl, J. S. Handler, and H. M. Kwon
Hypertonicity-induced phosphorylation and nuclear localization of the transcription factor TonEBP
Am J Physiol Cell Physiol, February 1, 2001; 280(2): C248 - C253.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H. T. B. Ho, S. K. Chung, J. W. S. Law, B. C. B. Ko, S. C. F. Tam, H. L. Brooks, M. A. Knepper, and S. S. M. Chung
Aldose Reductase-Deficient Mice Develop Nephrogenic Diabetes Insipidus
Mol. Cell. Biol., August 15, 2000; 20(16): 5840 - 5846.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. K. Woo, S. C. Dahl, J. S. Handler, and H. M. Kwon
Bidirectional regulation of tonicity-responsive enhancer binding protein in response to changes in tonicity
Am J Physiol Renal Physiol, June 1, 2000; 278(6): F1006 - F1012.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
W. van der Houven van Oordt, M. T. Diaz-Meco, J. Lozano, A. R. Krainer, J. Moscat, and J. F. Caceres
The MKK3/6-p38-signaling Cascade Alters the Subcellular Distribution of hnRNP A1 and Modulates Alternative Splicing Regulation
J. Cell Biol., April 17, 2000; 149(2): 307 - 316.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
W. Tian, G. R. Boss, and D. M. Cohen
Ras signaling in the inner medullary cell response to urea and NaCl
Am J Physiol Cell Physiol, February 1, 2000; 278(2): C372 - C380.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C.-F. Hung and T. M. Penning
Members of the Nuclear Factor 1 Transcription Factor Family Regulate Rat 3{alpha}-Hydroxysteroid/Dihydrodiol Dehydrogenase (3{alpha}-HSD/DD AKR1C9) Gene Expression: A Member of the Aldo-keto Reductase Superfamily
Mol. Endocrinol., October 1, 1999; 13(10): 1704 - 1717.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
L. Bai, J. F. Collins, Y. L. Muller, H. Xu, P. R. Kiela, and F. K. Ghishan
Characterization of cis-elements required for osmotic response of rat Na+/H+ exchanger-2 (NHE-2) gene
Am J Physiol Regulatory Integrative Comp Physiol, October 1, 1999; 277(4): R1112 - R1119.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Nadkarni, K. H. Gabbay, K. M. Bohren, and D. Sheikh-Hamad
Osmotic Response Element Enhancer Activity. REGULATION THROUGH p38 KINASE AND MITOGEN-ACTIVATED EXTRACELLULAR SIGNAL-REGULATED KINASE KINASE
J. Biol. Chem., July 16, 1999; 274(29): 20185 - 20190.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
T. Yang, J. B. Schnermann, and J. P. Briggs
Regulation of cyclooxygenase-2 expression in renal medulla by tonicity in vivo and in vitro
Am J Physiol Renal Physiol, July 1, 1999; 277(1): F1 - F9.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
D. N. Henry, J. V. Busik, F. C. Brosius III, and C. W. Heilig
Glucose transporters control gene expression of aldose reductase, PKCalpha , and GLUT1 in mesangial cells in vitro
Am J Physiol Renal Physiol, July 1, 1999; 277(1): F97 - F104.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Iwata, S. Sato, J. Jimenez, M. McGowan, M. Moroni, A. Dey, N. Ibaraki, V. N. Reddy, and D. Carper
Osmotic Response Element Is Required for the Induction of Aldose Reductase by Tumor Necrosis Factor-alpha
J. Biol. Chem., March 19, 1999; 274(12): 7993 - 8001.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Kultz and L. Csonka
What sets the TonE during osmotic stress?
PNAS, March 2, 1999; 96(5): 1814 - 1816.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Miyakawa, S. K. Woo, S. C. Dahl, J. S. Handler, and H. M. Kwon
Tonicity-responsive enhancer binding protein, a Rel-like protein that stimulates transcription in response to hypertonicity
PNAS, March 2, 1999; 96(5): 2538 - 2542.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. D. Ferraris, C. K. Williams, A. Ohtaka, and A. Garcia-Perez
Functional consensus for mammalian osmotic response elements
Am J Physiol Cell Physiol, March 1, 1999; 276(3): C667 - C673.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. Aida, M. Tawata, Y. Ikegishi, and T. Onaya
Induction of Rat Aldose Reductase Gene Transcription Is Mediated through the cis-Element, Osmotic Response Element (ORE): Increased Synthesis and/or Activation by Phosphorylation of ORE-Binding Protein Is a Key Step
Endocrinology, February 1, 1999; 140(2): 609 - 617.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Renal Physiol.Home page
Z. Zhang, H. Avraham, and D. M. Cohen
Urea and NaCl differentially regulate FAK and RAFTK/PYK2 in mIMCD3 renal medullary cells
Am J Physiol Renal Physiol, September 1, 1998; 275(3): F447 - F451.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
B. C. Santos, A. Chevaile, M.-J. Hebert, J. Zagajeski, and S. R. Gullans
A combination of NaCl and urea enhances survival of IMCD cells to hyperosmolality
Am J Physiol Renal Physiol, June 1, 1998; 274(6): F1167 - F1173.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Kultz, S. Madhany, and M. B. Burg
Hyperosmolality Causes Growth Arrest of Murine Kidney Cells. INDUCTION OF GADD45 AND GADD153 BY OSMOSENSING VIA STRESS-ACTIVATED PROTEIN KINASE 2
J. Biol. Chem., May 29, 1998; 273(22): 13645 - 13651.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
H. Miyakawa, S. K. Woo, C.-P. Chen, S. C. Dahl, J. S. Handler, and H. M. Kwon
Cis- and trans-acting factors regulating transcription of the BGT1 gene in response to hypertonicity
Am J Physiol Renal Physiol, April 1, 1998; 274(4): F753 - F761.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
C. Yabe-Nishimura
Aldose Reductase in Glucose Toxicity: A Potential Target for the Prevention of Diabetic Complications
Pharmacol. Rev., March 1, 1998; 50(1): 21 - 34.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. Uchida, T. Rai, H. Yatsushige, Y. Matsumura, M. Kawasaki, S. Sasaki, and F. Marumo
Isolation and characterization of kidney-specific ClC-K1 chloride channel gene promoter
Am J Physiol Renal Physiol, March 1, 1998; 274(3): F602 - F610.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. A. Wojtaszek, L. E. Heasley, G. Siriwardana, and T. Berl
Dominant-Negative c-Jun NH2-terminal Kinase 2 Sensitizes Renal Inner Medullary Collecting Duct Cells to Hypertonicity-induced Lethality Independent of Organic Osmolyte Transport
J. Biol. Chem., January 9, 1998; 273(2): 800 - 804.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
F. LANG, G. L. BUSCH, M. RITTER, H. VOLKL, S. WALDEGGER, E. GULBINS, and D. HAUSSINGER
Functional Significance of Cell Volume Regulatory Mechanisms
Physiol Rev, January 1, 1998; 78(1): 247 - 306.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. A. Yorek, J. A. Dunlap, M. J. Thomas, P. R. Cammarata, C. Zhou, and W. L. Lowe Jr.
Effect of TNF-alpha on SMIT mRNA levels and myo-inositol accumulation in cultured endothelial cells
Am J Physiol Cell Physiol, January 1, 1998; 274(1): C58 - C71.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Z. Zhang and D. M. Cohen
Urea activates ribosomal S6 kinase (RSK) in a MEK-dependent fashion in renal mIMCD3 cells
Am J Physiol Renal Physiol, January 1, 1998; 274(1): F73 - F78.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Iwata, S. Minucci, M. McGowan, and D. Carper
Identification of a Novel cis-Element Required for the Constitutive Activity and Osmotic Response of the Rat Aldose Reductase Promoter
J. Biol. Chem., December 19, 1997; 272(51): 32500 - 32506.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Venkatesh, S. L. Si-Hoe, D. Murphy, and S. Brenner
Transgenic rats reveal functional conservation of regulatory controls between the Fugu isotocin and rat oxytocin genes
PNAS, November 11, 1997; 94(23): 12462 - 12466.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. W. Lundgren, R. M. Moore, P. L. Collins, and J. J. Moore
Hypotonic Stress Increases Cyclooxygenase-2 Expression and Prostaglandin Release from Amnion-derived WISH Cells
J. Biol. Chem., August 8, 1997; 272(32): 20118 - 20124.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. C. B. Ko, B. Ruepp, K. M. Bohren, K. H. Gabbay, and S. S. M. Chung
Identification and Characterization of Multiple Osmotic Response Sequences in the Human Aldose Reductase Gene
J. Biol. Chem., June 27, 1997; 272(26): 16431 - 16437.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Kultz, A. Garcia-Perez, J. D. Ferraris, and M. B. Burg
Distinct Regulation of Osmoprotective Genes in Yeast and Mammals. ALDOSE REDUCTASE OSMOTIC RESPONSE ELEMENT IS INDUCED INDEPENDENT OF p38 AND STRESS-ACTIVATED PROTEIN KINASE/Jun N-TERMINAL KINASE IN RABBIT KIDNEY CELLS
J. Biol. Chem., May 16, 1997; 272(20): 13165 - 13170.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. J. Hyndman, R. Takenoshita, N. L. Vera, S. C. Pang, and T. G. Flynn
Cloning, Sequencing, and Enzymatic Activity of an Inducible Aldo-Keto Reductase from Chinese Hamster Ovary Cells
J. Biol. Chem., May 16, 1997; 272(20): 13286 - 13291.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Dmitrieva, D. Kultz, L. Michea, J. Ferraris, and M. Burg
Protection of Renal Inner Medullary Epithelial Cells from Apoptosis by Hypertonic Stress-induced p53 Activation
J. Biol. Chem., June 9, 2000; 275(24): 18243 - 18247.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Nakayama, T. Peng, J. M. Sands, and S. M. Bagnasco
The TonE/TonEBP Pathway Mediates Tonicity-responsive Regulation of UT-A Urea Transporter Expression
J. Biol. Chem., December 1, 2000; 275(49): 38275 - 38280.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. A. Fenton, C. A. Cottingham, G. S. Stewart, A. Howorth, J. A. Hewitt, and C. P. Smith
Structure and characterization of the mouse UT-A gene (Slc14a2)
Am J Physiol Renal Physiol, April 1, 2002; 282(4): F630 - F638.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ferraris, J. D.
Right arrow Articles by García-Pérez, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ferraris, J. D.
Right arrow Articles by García-Pérez, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1996 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement