INTRODUCTION

Methanogenesis from H₂ + CO₂ as catalyzed by the non-marine methanogenic Archaea Methanosarcina barkeri or Methanosarcina mazei Gö1 is obligatorily coupled to the generation of two primary ion gradients at the same time: the reduction of the heterodisulfide of coenzyme M¹ and 7-mercaptoheptanoylthreoninephosphate is coupled to electrogenic translocation of protons across the membrane; in addition the penultimate step of methanogenesis, the transfer of the methyl group from methyltetrahydromethanopterin to coenzyme M as catalyzed by the corrinoid-containing multi-subunit enzyme methyltetrahydromethanopterin:coenzyme M methyltransferase, is coupled to vectorial sodium ion translocation across the membrane (1). M. mazei Gö1 uses both gradients directly as driving force for ATP synthesis but employs two different enzymes for this purpose: an A₁A₀ ATP synthase couples ATP formation to _{H⁺, whereas a F1F0 ATP synthase uses Na⁺ as driving force (2). So far, methanogens are the only organisms known to contain two structurally different ATP synthases.}

The archaeal A₁A₀ ATPase² shares properties with both, bacterial F₁F₀ and eucaryal V₁V₀ ATPases (3, 4). It clearly functions as an ATP synthase, which is in accordance with F₁F₀ but in sharp contrast to V₁V₀ ATPases; the structure of the proteolipid (one of the subunits of the A₀ domain), which is in the range of 6-8 kDa in A₁A₀ and F₁F₀ ATPases but 16 kDa in V₁V₀ ATPases, was suggested to be at least one of the reasons for this difference (5, 6, 7, 8). On the other hand, the primary sequences of the subunits A and B of the catalytic A₁ domain are clearly more closely related to vacuolar V₁V₀ ATPases (9, 10, 11, 12).³ Therefore, the A₁A₀ ATPase is regarded as a chimeric protein in which the membrane domain is closely related to F₁F₀ but the catalytic domain closely to V₁V₀ ATPases.

Although A₁A₀ ATPase activity has been demonstrated in a number of Archaea, the subunit composition of this enzyme is far from being settled. It is generally accepted that the A₁ domain contains at least two large subunits of 62-80 kDa (subunit A) and 49-55 kDa (subunit B) and the A₀ domain contains a least a 7-kDa subunit, the so-called proteolipid. Minor subunits co-purified with the enzyme (5, 8, 13, 14, 15, 16, 17), but it has not been established whether these are genuine constituents of the ATPase. Furthermore, little is known about the genetic organization of the A₁A₀ ATPases. In a first step toward a better understanding of the structure and function of this interesting archaeal enzyme, we purified the A₁A₀ complex from membranes of M. mazei Gö1 and cloned and characterized the 3 end of the A₁A₀ ATPase operon.

EXPERIMENTAL PROCEDURES

All chemicals were reagent grade and were purchased form Merck AG, Darmstadt, Germany. K₂-ATP, DES, N-ethylmaleimide, and NBD-Cl were from Sigma, Deisenhofen, Germany. DCCD was from Aldrich, Steinheim, Germany.

M. mazei Gö1 (DSM 3647) was obtained from the Deutsche Sammlung für Mikroorganismen und Zellkulturen, Braunschweig, Germany, and grown under strictly anaerobic conditions on methanol on the medium described by Hippe et al. (18) with the addition of sodium acetate (1 g/liter). Escherichia coli DH5 (supE44 lacU169(F80lacZM15) hsdr17 recA1 endA1 gyrA96 thi1 relA1; 19) was grown on LB at 37 °C. Plasmids used were pSE420 (20), pGem-7Zf-(+) (Promega Corp., Madison, WI)), pHSG 398, and pHSG399 (21).

Cells were washed once in buffer A (50 mM Tris-HCl, pH 6.9, 10 mM MgSO₄, 40 mM KCl, 5 mM NaN₃, 10% (v/v) glycerol) and disrupted in a French pressure cell at a pressure of 138 MPa. Debris was removed by centrifugation (25,000 × g, 10 min). The membranes were pelleted by ultracentrifugation (120,000 × g, 90 min) and washed twice with buffer A containing 1 µM phenylmethylsulfonyl fluoride. Membranes were resuspended for solubilization in 2 mM sodium pyrophosphate, 20 mM EDTA, and stirred on ice for 10 h. After ultracentrifugation (120,000 × g, 90 min) the supernatant was applied to a DEAE-Sepharose CL-6B column (2.6 × 25 cm), equilibrated with 25 mM Tris-HCl, pH 6.9. Elution was performed with a salt gradient (0-0.6 M NaCl in 25 mM Tris-HCl, pH 6.9), and fractions with ATPase activity were pooled and applied to a DEAE-Sephacel column, equilibrated with 25 mM Tris-HCl, pH 8.0. Fractionation was performed by application of a linear gradient of 0-0.5 M NaCl in 25 mM Tris-HCl, pH 8.0. Finally, a gel filtration was carried out on a Sephacryl S-300 column (1.6 × 80 cm) at a flow rate of 15 ml/h in 50 mM Tris-HCl, pH 6.9. All steps were performed at 4 °C.

Alternatively, purification in small amounts in two days was achieved by EDTA/pyrophosphate treatment, ion exchange chromatography on DEAE-Sephacel, followed by exclusion affinity chromatography on immobilized polyclonal antibodies directed against methyl-CoM-methylreductase of Methanobacterium thermoautotrophicum Marburg. The coupling of the antibodies to activated tresyl-Sepharose was performed as described (22). SDS-PAGE and linear gradient gel electrophoresis were performed following established procedures (23, 24).

Cells were harvested in the mid-log phase, washed and suspended in membrane buffer (Tris-HCl, pH 8.0, 20 mM NaHSO₃, 5 mM MgSO₄, 40 mM KCl, 0.2 mM dithiothreitol, 0.2 mM EGTA, 10% (v/v) glycerol, 1 µM phenylmethylsulfonyl fluoride, 6 mM p-aminobenzamidine) and disrupted in a French pressure cell at a pressure of 138 MPa. Debris was removed by centrifugation (25,000 × g, 10 min). Membranes were pelleted by ultracentrifugation at 134,000 × g for 90 min, washed twice under the same conditions, and solubilized with CHAPS (0.6%) for 20 min under stirring at 35 °C. After ultracentrifugation (120,000 × g, 90 min) the supernatant was applied to a DEAE-Sephacel column, equilibrated with buffer B (25 mM Tris-HCl, pH 8.0, 0.2% CHAPS). Fractionation was performed by application of a linear gradient of 0-0.5 M NaCl in buffer B. Fractions with ATPase activity were pooled and PEG combined, and the ATPase was precipitated by a fractionated PEG 400 precipitation (15% PEG 400 in the first and 30% PEG 400 in the second step). Finally, a saccharose-glycerin gradient centrifugation was performed with 10-30% saccharose and 5-10% glycerin.

The proteolipid was either extracted from the membranes with organic solvents as described or from the A₁A₀ complex by hydrophobic chromatography on Phenyl-Sepharose CL-4B and electroendoosmotic preparative gel electrophoresis using the ELFE system from Genofit.

Subunits A and B were separated by SDS-PAGE, cut out of the gel, and used to immunize mice. Polyclonal antisera were collected after 65 days, and the immunoglobulins were purified by affinity chromatography on Protein G-Sepharose CL-4B.

Western blotting with SDS-polyacrylamide gels was performed as described (25). The nitrocellulose sheets were applied to different antisera and treated with alkaline phosphatase-conjugated goat anti-mouse immunoglobulins in a reaction mixture made up of 0.0075% (w/v) nitro blue tetrazolium chloride and 0.03% (w/v) 5-bromo-4-chloro-3-indolyl phosphate in 100 mM Tris, 100 mM NaCl, and 5 mM MgCl₂, pH 8.8.

Samples containing isolated A₁A₀ ATPase were negatively stained with 4% (w/v) aquaeous uranyl acetate, pH 4.7, as described (26) and depicted at calibrated magnifications by conventional transmission microscopy.

ATPase activity was measured in an assay mixture containing 100 mM MES, pH 5.2, 40 mM KCl, 40 mM NaHSO₃, 10 mM MgSO₄, 10% (v/v) glycerol and enzyme solution. After preincubation at 37 °C, the reaction was started by addition of ATP to a final concentration of 4 mM. Activity was measured by the release of inorganic phosphate as described (27). Inhibitors were dissolved in water, ethanol, or Me₂SO and preincubated with the enzyme for at least 20 min at 37 °C; controls received the solvent only.

Chromosomal DNA of M. mazei Gö1 was isolated as described (28), restricted, size-fractionated by gradient centrifugation and cloned into either pSE420 or pGem-7Zf-(+). All procedures used were standard techniques (19). Oligonucleotides were synthesized on a Gene Assembler Plus apparatus as recommended by the manufacturer (Pharmacia Biotech Inc.). To clone the A₁A₀ ATPase genes, a homologous probe of 800 bp was generated by polymerase chain reaction with oligonucleotides corresponding to amino acids 53-61 (PL1) and 317-325 (PR2), respectively, of subunit B of M. barkeri A₁A₀ ATPase (11). Southern blot analysis of genomic DNA of M. mazei Gö1 restricted with different enzymes revealed a 11-kbp XbaI fragment that hybridized with the homologous probe. This fragment was cloned into pGem-7Zf-(+) and the recombinant plasmid was named pCF1. The XbaI-ClaI fragment of pCF1 was used as a probe to clone the 5 upstream region of pCF1 out of a BglII genomic library of M. mazei Gö1. The isolated plasmid (pEW1) contains a 8-kbp BglII fragment ligated into the BamHI site of pGem-7Zf-(+). DNA sequence was determined by the chain termination method of Sanger and analyzed on a VAX computer using the GCG package (29, 30).

RESULTS

Characterization of the A₁A₀ ATPase in Inverted Membrane Vesicles

Since M. mazei Gö1 was recently shown by determining rates of ATP synthesis under various conditions to contain a Na⁺-translocating F₁F₀ as well as a H⁺-translocating A₁A₀ ATP synthase (2), it was essential to analyze the membrane-bound ATPase activity in more detail. The ATPase activity in washed membranes of M. mazei Gö1 was optimal at pH 5.2. pH values lower than 5.2 decreased the activity very strongly (zero activity at pH 4.5) but at values higher than 5.2 the decrease was less pronounced (22% activity at pH 7.0). The enzyme was stimulated 3-fold by addition of sulfite (40 mM), 1.7-fold by ethanol (18% (v/v)) and 2-fold by glycerol (20% (v/v)). Addition of various divalent cations resulted in different degrees of stimulation. Stimulation by Mg²⁺ was maximal at 10 mM, a value that corresponds to a Mg:ATP ratio of 2:1. Zn²⁺ but not Mn²⁺ stimulated ATPase activity but the degree of stimulation was 1.3 times higher than that measured for Mg²⁺ stimulation. Other divalent cations such as Ca²⁺, Ni²⁺, Cu²⁺, and Fe²⁺ and the monovalent cations Na⁺ and K⁺ had only negligible effects.

The ATPase activity of M. mazei Gö1 membranes was not inhibited by NBD-Cl (1 mM) or by azide (1 mM), typical inhibitors of F₁F₀ ATPases. Nitrate, a typical inhibitor of V₁V₀ ATPases, inhibited the enzyme with an I₅₀ of 30 mM. DCCD and DES both inhibited the enzyme with DES (I₅₀ 100 µM) being a more potent inhibitor than DCCD (I₅₀ 500 µM). Taken together, the catalytic properties and the inhibitor sensitivity of the ATPase activity at membranes of M. mazei Gö1 are in full accord with the action of an A₁A₀ ATPase. Apparently, the F₁F₀ type enzyme does not show ATP hydrolysis activity under these conditions. This is in accordance with our previous notion that the F₁F₀ type enzyme is active only in the presence of an electrochemical potential across the membrane (2).

Purification of the A₁ ATPase

The A₁ ATPase was released from the membranes by incubation in low ionic strength buffer (EDTA-pyrophosphate depletion) and purified by chromatography on DEAE-Sepharose, DEAE-Sephacel, and gel filtration with an enrichment factor of 16.7 and a yield of 6.4% (Table I. The purified A₁ ATPase had a molecular mass of 360 kDa as determined by gel filtration on Superose 6, and of 350 kDa as determined by native gradient gel electrophoresis (data not shown). When this sample was applied to SDS-PAGE, only two bands representing proteins with molecular masses of 65 (subunit A) and 49 kDa (subunit B) were detected. ATP hydrolysis by this preparation occurred with a V_max of 90 milliunits/mg protein and a K_m for ATP of 4 mM (data not shown). Unfortunately, the time-dependent loss of enzyme activity was drastic; this made subsequent biochemical studies very laborious.

Table I. Purification of the AI ATPase of M. mazei Gö1 ATPase was purified and activity was determined as described under ``Experimental Procedures.'' Purification step Protein ATPase activity Specific activity Enrichment Yield mg milliunits milliunits/mg -fold % membranes 3120 105,770 33.9 1.0 100.0 EDTA depletion 960 72,384 75.4 2.2 68.4 DEAE-Sepharose 240 27,840 116.0 3.4 26.3 DEAE-Sephacel 37 16,502 446.4 13.2 15.6 Sephacryl S-300 12 6805 567.1 16.7 6.4

By EDTA-pyrophosphate depletion and DEAE-Sephacel chromatography small amounts of A₁ ATPase could be enriched within 2 days with a yield of 27%. One additional band was detectable in native gels, which was identified immunologically as methyl-CoM-methylreductase. This contaminating protein was removed by affinity exclusion chromatography with immobilized polyclonal antibodies raised against methyl-CoM-methylreductase from M. thermoautotrophicum Marburg. As detected by SDS-PAGE, the A₁ ATPase purified by this approach contained an additional subunit with an apparent molecular mass of 40 kDa (Fig. 1). However, this approach is not suitable for purification of large amounts of ATPase.

Purification of the A₁A₀ ATPase

The A₁A₀ ATPase was solubilized from washed inverted vesicles by treatment with 0.6% (w/v) CHAPS at a protein concentration of 8-10 mg/ml corresponding to a protein:detergent ratio of 1:0.75 to 1:0.6. After ultracentrifugation 78% of the protein and 106% of the ATPase activity were recovered in the supernatant. The recovery of 106% of ATPase activity is due to a stimulation of ATPase activity by the detergent. The enzyme was enriched 11-fold by DEAE-Sephacel chromatogaphy, PEG 400 precipitation and saccharose-glycerin-gradient centrifugation with a yield of 4.1% and a specific activity of 159 milliunits/mg of protein (Table II). When this sample was applied to a SDS-PAGE polypeptides with apparent molecular masses of 65, 49, 40, 36, 28, and 7 kDa were observed (Fig. 2).

Table II. Purification of the AIA0 ATPase of M. mazei Gö1 ATPase was purified and activity was determined as described under ``Experimental Procedures.'' Purification step Protein ATPase activity Specific activity Enrichment Yield mg milliunits milliunits/mg -fold % Membranes 397 5722 14.4 1.0 100.0 CHAPS supernatant 310 6043 19.5 1.35 106.0 DEAE-Sepharose 30 2312 77.4 5.37 41.0 PEG precipitat 7 416 59.4 4.13 7.2 Gradient centrifug. 1.5 239 159.3 11.1 4.1

Purification of the Proteolipid

The proteolipid or subunit c of F₁F₀, V₁V₀, and A₁A₀ ATPases is very hydrophobic and can be isolated by extraction of membranes with organic solvents. After extraction of membranes of M. mazei Gö1 with chloroform:methanol (2:1), the proteolipid was purified to apparent homogeneity by repeated precipitation with diethylether. In a SDS-PAGE, a single subunit with a molecular mass of 7 kDa was detected. This value corresponds well to the molecular mass of subunit c from F₁F₀ ATPases. This 7-kDa polypeptide was also present in the A₁A₀ preparation and could be purified from it by hydrophobic chromatography.

Immunological Relationship to F₁F₀ and V₁V₀ ATPases

To further confirm that the purified enzyme represents the A₁A₀ ATPase of M. mazei Gö1, polyclonal antisera directed against subunit A or B were raised and used as probes in Western blots to test immunological cross-reactivity between various ATPases. Immunological cross-reactivity of subunits A and B was observed with membranes from Methanosarcina frisia, Methanolobus tindarius, and Methanococcus maripaludis but also with vacuolar membranes from sugar beet and Saccharomyces cerevisiae (data not shown). No immunological cross reactivities were detected with the investigated F₁F₀ ATPases of eubacteria such as E. coli, Clostridium thermosaccharolyticum, and Thiosphaera pantotropha or spinach. Furthermore, cross-reaction of the A₁ ATPase was observed with the anti-subunit B-specific antibodies of the A₁A₀ ATPase of S. acidocaldarius but not with the anti-subunit -specific antibodies of the F₁F₀ ATPase of E. coli. These experiments gave further evidence that the ATPase purified from M. mazei Gö1 is of the A₁A₀ type.

Ultrastructure of the A₁A₀ and the A₁ ATPase from M. mazei Gö1 as Revealed by Electron Microscopy

In electron micrographs the A₁A₀ ATPase appeared to be composed of a base, a stalk, and a head part (Fig. 3). Often, several A₁A₀ ATPases were aggregated in opposite orientation, brought about by interaction of their A₀ parts. The isolated A₁ parts of the enzyme showed a rotational symmetry and a size similar to that observed for the mitochondrial F₁ ATPase and the A₁ ATPase from S. acidocaldarius.

Nucleotide Sequence and Structure of the aha Operon Coding for the A₁ ATPase from M. mazei Gö1

Two fragments (pCF1 and pEW1) containing A₁A₀ ATPase genes were cloned (see ``Experimental Procedures''). Biochemical and molecular studies (see below) revealed the presence of the following genes (in that order) in one gene cluster: ahaE, C, F, A, B, D, and G (Fig. 4). The transcriptional analysis, which will be presented in a separate publication, showed that these genes are organized in an operon; this was named aha operon for ``rchaeal ⁺ TPase''. Upstream of ahaE is an AT-rich region, which contains potential archaeal consensus promotor sequences. Immediately downstream of ahaG is a potential rho-independent transcriptional terminator. The intergenic region is thymine-rich and contains seven tandem repeats of a 22-bp sequence (TTTTTCCTGAATTGTGTTATTG), which might function as a transcriptional terminator (Fig. 5). 497 base pairs downstream of the stop codon of ahaG is the start of an open reading frame whose deduced amino acid sequence is 39% identical and 61% homologous to HypF from E. coli, which is involved in maturation and/or assembly of the NiFe-hydrogenase. Therefore, it is assumed that this open reading frame represents the hypF homologous gene of M. mazei Gö1. Characteristic translational features of the sequence are summarized in Table III.

Table III. Ribosomal binding sites, stop and start codons of the aha genes and of hypF Conserved residues are shown in bold, stop codons are underlined, and start codons are shown in italics. Gene Sequence GC content 16 S RNAa CGCTGAGAGGAGGTGCATGGCCGTCG Intergenic regionb 37.0 ahaE ATTTATTTGGAGGTGTGTAAGCATG 41.6 ahaC ATTATACGGGTGTTCGATG 42.1 ahaF GACCAGTTGGTGATTATCATG 46.2 ahaA AACAAGCGGTAGGTGTTGATCTGTGGAAG 48.9 ahaB CAGCCCTGGGAGGTAAAGATG 51.0 ahaD CAGAAAGGCTAAGTTGCCATG 44.6 ahaG GAGAGATGTTTGATTTGAACATG 41.2 Intergenic regionc 31.1 hypFd TAATGACAAACGGTAATCTTTGCATAAATG 47.8 a  Data are taken from Ref. 31. b  211 base pairs upstream of ahaE. c  Intergenic region between ahaG and hypF. d  Partial coding sequence.

Identification of aha Genes

The program TESTCODE categorized the region from ahaE through G as a coding sequence above the 95% confidence level. The program CODONPREFERENCE also recognized all designated genes as authentic genes. Furthermore, the apparent molecular masses of the 65-, 49-, 40-, and 25-kDa subunit of the purified enzyme correspond well to the deduced molecular masses of AhaA, B, C, and D.

Properties of the Gene Products and Similarity to Polypeptides of V₁V₀ and F₁F₀ ATPases

The properties of the aha gene products are summarized in Table IV. Generally, ahaE through G code for hydrophilic polypeptides. Data base searches, primary sequence alignments, secondary structure predictions, and comparisons of the molecular masses and isolelectric points were used to identify homologous subunits in V₁V₀ and F₁F₀ ATPases.

Table IV. Properties of the deduced gene products of the aha operon Polypeptide Residues Mra pI AhaA 579 63,973 4.73 AhaB 460 50,622 6.82 AhaC 361 41,486 7.81 AhaD 209 23,900 10.27 AhaE 183 20,399 5.54 AhaF 102 10,893 5.21 AhaG 55 6135 9.52 a  Deduced from the DNA sequence.

The deduced molecular mass of AhaD (66.106 kDa) corresponds well to the experimentally derived molecular weight of 65,000 of subunit A of the purified enzyme. The deduced gene product is 86% identical to the corresponding subunit from M. barkeri (11) and 63 and 52% of the residues are identical to subunit A of the A₁A₀ ATPase from Haloferax volcanii (32) and S. acidocaldarius (9), respectively (Fig. 6). Still 50-55% of the residues are identical to subunit A of the V₁V₀ ATPase of Enterococcus hirae (33), Vma1p of S. cerevisiae (34), and subunit A of bovine (35) and human (36) V₁V₀ ATPase. On the other hand, only 27% of the residues are identical to subunit  of the F₁F₀ ATPase of E. coli (37). AhaA contains the Walker motifs A and B (38), which are part of the nucleotide binding domain, indicating that it represents the catalytic subunit. This is in agreement with the finding that anti-subunit A specific-antibodies were 4 times more effective in inhibiting ATPase activity of the purified enzyme from M. mazei Gö1 than anti-subunit B-specific antibodies. From the multiple alignment, it is evident that all of the residues involved in nucleotide binding in the mitochondrial F₁F₀ ATPase (39) are conserved in the M. mazei Gö1 A₁A₀ ATPase, and therefore this general scheme seems also valid for nucleotide binding in subunits B and A of A₁A₀ and V₁V₀ ATPases.

), and with subunit  of F

ahaB codes for a polypeptide with a molecular mass of 50.348 kDa, which corresponds well to the experimentally derived value of 49 kDa for subunit B of the purified enzyme. 90, 67, and 56% of the residues are identical to subunit B of the A₁A₀ ATPase from M. barkeri (11), H. volcanii (32), and S. acidocaldarius (10), respectively (Fig. 7). The degree of identity is lower to subunit B or Vma2p from V₁V₀ ATPases such as E. hirae (58%) (33), S. cerevisiae (56%) (40), bovine (56%) (41), and human (53%) (41), and to subunit  from the F₁F₀ ATPase of E. coli (24%) (37).

, and with subunit  of F

ahaC codes for a polypeptide with a molecular mass of 41.486 kDa, which corresponds well to the experimentally derived value of 40 kDa of subunit C of the purified enzyme. By data base searches, NtpC of E. hirae V₁V₀ ATPase (22% identity; 49% homology) (42) and AtpC of H. volcanii A₁A₀ ATPase (GenBank accession no. X79516[GenBank]) (35% identity, 58% homology) were found to be homologous. A multiple alignment of these polypeptides to the 39-kDa accessory protein (Vma6p) of V₁V₀ ATPases (43, 44) revealed a number of homologous residues indicating that these proteins are homologous (Fig. 8). Nine residues seem to be invariant, five of these are located in the C-terminal region, which in addition has several conserved substitutions. Of these five residues, three are charged and positioned in a predicted -sheet structure. Apparently, there is no homologous polypeptide in F₁F₀ ATPases.

Data base searches revealed the following proteins to be homologous to AhaD (23.900 kDa): NtpD of E. hirae V₁V₀ ATPase (37% identity) (42), AtpG of S. acidocaldarius A₁A₀ ATPase (28% identity) (45), the 34-kDa subunit of bovine (26% identity) (46), Vma8p of yeast (28% identity) (46) V₁V₀ ATPase, and a deduced polypeptide from Caenorhabditis elegans (YMF2; GenBank accession no. Z27080[GenBank]; Ref. 47). 21 and 26% of its residues are identical to subunit  of F₁F₀ ATPases. Multiple alignments revealed that the N and C termini are well conserved (Fig. 9). Secondary structure analysis predicts that these regions are -helical, which is a striking homology to subunit  of F₁F₀ ATPases (37, 48). Thus, we suggest that AhaD and the corresponding subunits in V₁V₀ and A₁A₀ ATPases are the homologues of subunit  of F₁F₀ ATPases. However, there are no conserved residues in these polypeptides.

, and subunit  of F

AtpD (21.981 kDa) of H. volcanii A₁A₀ (33% identity) (GenBank accession no. X79516[GenBank]), NtpE (22.900 kDa) of E. hirae V₁V₀ ATPase (17% identity) (42), AtpD of S. acidocaldarius A₁A₀ (which is only 13 kDa), and Vma4p and the homologous 31-kDa subunit of V₁V₀ ATPases of various organisms (49, 50) were identified by BLAST as the homologues of AhaE. Secondary structure analysis predicts that AhaE and its homologues are largely -helical. A multiple alignment shows that the region Gly-145 to Leu-149 is well conserved between prokaryotic and eukaryotic subunits (Fig. 10). According to its size, AhaE could be the homologue of subunit  of F₁F₀ ATPases. This is in agreement with the observation that the aforementioned residues are also conserved in subunit  of E. coli F₁F₀ (37).

, and with subunit  of

Data base searches identified only AtpE of H. volcanii A₁A₀ ATPase (GenBank accession no. X79516[GenBank]) to be homologous (11.582 kDa; 50% identity). However, its physical location within the operon and its size suggest that AhaF is the homologue of NtpG of E. hirae V₁V₀ (42), the 14-kDa subunit of V₁V₀ ATPases of tobacco hornworm (51), Drosophila melanogaster (Genbank accession no. Z26918[GenBank]), Vma7p of S. cerevisiae (52), and subunit  of F₁F₀ ATPases (37). Multiple alignments showed that the N terminus is fairly well conserved (Fig. 11), and the polypeptide is predicted to have a small -helical region at its N terminus and a -sheet region at its C terminus.

, and with subunit  of

Of the polypeptides tested, AhaG is the only one which did not reveal a homologous polypeptide by data base search. However, according to its size (6135 kDa) and its location within the operon we suggest that AhaG, NtpH of E. hirae V₁V₀ (7.138 kDa; 12% identity, 40% homology) (42) and AtpE of S. acidocaldarius A₁A₀ ATPase (7.038 kDa; 17% identity, 41% homology) (45) are homologous. A multiple alignment of AhaG, NtpH of E. hirae V₁V₀, and AtpE of S. acidocaldarius A₁A₀ ATPase (Fig. 12) revealed only one conserved residue (Val-5). No homologue was found in eucaryotic V₁V₀ ATPases.

DISCUSSION

It is apparent from the electron micrographs that the A₁A₀ ATPase consists, like the F₁F₀ and the V₁V₀ ATPase, of a hydrophilic (A₁) and a hydrophobic domain (A₀), which are connected by a stalk. From the combined biochemical and molecular results, we suggest that this structure is built up by at least 9 non-identical subunits used in different stoichiometry (Fig. 13). In view of the apparent similarities, the discussion of the structure/function prediction of individual subunits of the A₁A₀ ATPase will be done on the basis of the known features of F₁F₀ and V₁V₀ ATPases (53, 54, 55, 56). Subunits A and B were both present in the purified enzyme; they share extensive homologies with Vma1p/subunit A and Vma2p/subunit B of V₁V₀ ATPases and with  and  of F₁F₀ ATPases. According to the apparent homology, it is suggested that subunits A and B of the A₁A₀ ATPase are present in triplicate each and are arranged alternately in an orange-like structure. This is supported by the rotational symmetry determined in the electron micrographs. AhaA carries the catalytic nucleotide binding sites, whereas the non-catalytic sites are located on AhaB. All of the residues important for nucleotide binding in  and  of F₁F₀ (39) are conserved in A and B of A₁A_O³. The proline-rich hydrophobic sleeves suggested to be involved in - interaction in F₁F₀ are also conserved in AhaA (residues 344-351) and B (residues 265-273). The catalytic subunit A and the regulatory subunit B are more closely related to the corresponding subunits of V₁V₀ than F₁F₀ ATPases. This has been observed before with the corresponding subunits from A₁A₀ ATPases of other organisms (9, 10, 11, 12). However, the degree of identity was higher to the corresponding subunits from the halophilic Archaea H. salinarium and H. volcanii than to the thermoacidophile S. acidocaldarius.

AhaD is identical to the 28-kDa subunit of the purified protein; it is homologous to subunit  of F₁F₀ ATPases, which plays a crucial role in transmitting energy from the F₀ to the F₁ domain (57). The x-ray structure revealed that subunit  is highly -helical at its N and C termini, which both protrude in the orange-like head assembly of the catalytic and non-catalytic subunits (39). A secondary structure analysis strongly predicts -helical N and C termini also in AhaD. A multiple alignment did not reveal conserved residues (Fig. 10). Furthermore, the region including Gln-270, Thr-274, Glu-276, and Glu-279, which were shown by mutagenesis studies to be important for function in E. coli F₁F₀  (58) is not present in the counterpart of prokaryotic V₁V₀ and A₁A₀ ATPases, indicating that not particular residues but rather a secondary structure is important for function. The fact that this subunit is only present in the A₁A₀ rather than in the A₁ preparation might suggest a structural (and functional?) interaction also with the membrane domain. On the other hand, it is conceivable that its non-appearance in the A₁ preparation might be due to preparation artifacts. However, the available data indicate that the general structure and function of subunits A, B, and D of A₁A₀ and V₁V₀ ATPases are comparable to subunits , , and  of F₁F₀ ATPases.

AhaC is identical to the 40-kDa subunit of the purified enzyme; apparently it has no counterpart in F₁F₀ ATPases. The eukaryotic homologue of AhaC (Vma6p or the 39-kDa accessory protein) is hydrophilic as is AhaC. However, since Vma6p copurifies with the V₀ domain, it is assumed to bind to the membrane via interaction with a membrane-bound subunit (44) and probably is part of the stalk. Since AhaC was found in the A₁ prepaparation detached from membranes of M. mazei Gö1, we regard this subunit as part of the A₁ domain or the stalk.

AhaE through G were apparently not present in the purified A₁A₀ ATPase, although it cannot be excluded that they did not stain well. From the multiple alignment, it is suggested that AhaE is the homologue of Vma4p or the 31-kDa subunit of eukaryotic V₁V₀ and subunit  of F₁F₀ ATPases, and AhaF and its homologues are suggested to be the homologues of subunit  of F₁F₀ ATPases. However, in both cases the structure and function of the subunits are not well understood. Whether AhaG plays a structural role in the A₁A₀ ATPase remains to be established. AhaG has no counterpart in eukaryotic V₁V₀ ATPases. In this context it is interesting to note that there is a small gene (uncI) as the first gene in the unc operon, which codes for the F₁F₀ ATPase. The function of the gene product is obscure but it is not essential for an active F₁F₀ ATP synthase complex. Based on size, AhaG and its bacterial homologues could very well be the homologues of the uncI gene product.

The fact that the 36-kDa subunit co-purifies with the complex only after solubilization of the membrane is indicative for its membrane localization. Therefore, we suggest that the A₀ domain consists of at least two subunits of M_r 7,000 (the proteolipid) and 36,000. In yeast V₁V₀ three subunits (excluding Vma6p) are present in the membrane domain: the 16-kDa proteolipid (59), a recently described 13-kDa protein with homologies to subunit b of F₁F₀ ATPases (60), and a 115-kDa protein (61).

There is a striking homology between the aha operon of M. mazei Gö1, the ntp operon of E. hirae (42) and the atp operon of S. acidocaldarius (45) and H. volcanii (GenBank accession no. X79516[GenBank]) (Fig. 14). Regarding the hydrophilic subunits, the arrangement of ahaE through G of M. mazei Gö1 is identical to the corresponding genes in the eubacterium E. hirae and the homologues of ahaE through B are also conserved in the same order in H. volcanii. However, the organization of the genes coding for the hydrophobic subunits is different. A NtpJ homologue is not present in M. mazei Gö1. This is expected since the ATPase of E. hirae is believed to function as a K⁺/H⁺ antiporter (62) and NtpJ is believed by sequence similarities to play a role in this exchange (42). There is no more aha gene downstream of ahaG, but preliminary expression studies indicate that there are more genes in the aha operon upstream of ahaE; sequencing of this region is currently under way.