Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kamiya, K.-i.
Right arrow Articles by Plunkett, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kamiya, K.-i.
Right arrow Articles by Plunkett, W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 271, Number 32, Issue of August 9, 1996 pp. 19428-19435
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

Inhibition of the 3' right-arrow  5' Exonuclease of Human DNA Polymerase epsilon  by Fludarabine-terminated DNA*

(Received for publication, December 18, 1995, and in revised form, April 24, 1996)

Ken-ichi Kamiya , Peng Huang and William Plunkett Dagger

From the Section of Cellular and Molecular Pharmacology, Department of Clinical Investigation, The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES


ABSTRACT

Incorporation of the anticancer drug fludarabine (9-beta -D-arabinofuranosyl-2-fluoroadenine 5'-monophosphate; F-ara-AMP) into the 3'-end of DNA during replication causes termination of DNA strand elongation and is strongly correlated with loss of clonogenicity. Because the proofreading mechanisms that remove 3'-F-ara-AMP from DNA represent a possible means of resistance to the drug, the present study investigated the excision of incorporated F-ara-AMP from DNA by the 3' right-arrow 5'-exonuclease activity of DNA polymerase epsilon  from human leukemia CEM cells. Using the drug-containing and normal deoxynucleotide oligomers (21-base) annealed to M13mp18(+) DNA as the excision substrates, we demonstrated that DNA polymerase epsilon  was unable to effectively remove F-ara-AMP from the 3'-end of the oligomer. However, 3'-terminal dAMP and subsequently other deoxynucleotides were readily excised from DNA in a distributive fashion. Kinetic evaluation demonstrated that although DNA polymerase epsilon  has a higher affinity for F-ara-AMP-terminated DNA (Km = 7.1 pM) than for dAMP-terminated DNA of otherwise identical sequence (Km = 265 pM), excision of F-ara-AMP proceeded at a substantially slower rate (Vmax = 0.053 pmol/min/mg) than for 3'-terminal dAMP (Vmax = 1.96 pmol/min/mg). When the 3'-5' phosphodiester bond between F-ara-AMP at the 3'-terminus and the adjacent normal deoxynucleotide was cleaved by DNA polymerase epsilon , the reaction products appeared to remain associated with the enzyme but without the formation of a covalent bond. No further excision of the remaining oligomers was observed after the addition of fresh DNA polymerase epsilon  to the reaction. Furthermore, the addition of DNA polymerase alpha  and deoxynucleoside triphosphates to the excision reaction failed to extend the oligomers. After DNA polymerase epsilon  had been incubated with 3'-F-ara-AMP-21-mer for 10 min, the enzyme was no longer able to excise 3'-terminal dAMP from a freshly added normal 21-mer annealed to M13mp18(+) template. We conclude that the 3' right-arrow 5' exonuclease of human DNA polymerase epsilon  can remove 3'-terminal F-ara-AMP from DNA with difficulty and that this excision results in a mechanism-mediated formation of ``dead end complex.''


INTRODUCTION

Fludarabine (9-beta -D-arabinofuranosyl-2-fluoroadenine 5'-phosphate; F-ara-AMP)1 is a major new drug in the treatment of hematologic malignancies (1, 2, 3). The action of fludarabine, mediated by its 5'-triphosphate metabolite F-ara-ATP, is characterized by its inhibitory effect on DNA metabolism (4, 5). Previous studies revealed that several mechanisms may be involved in the drug-induced cytotoxicity. F-ara-ATP competes with dATP for incorporation into DNA by several DNA polymerases (6, 7, 8, 9, 10), including DNA polymerase epsilon  (pol epsilon ) (10), which possesses 3' right-arrow 5' exonuclease activity (11, 12). Because F-ara-ATP also inhibits ribonucleotide reductase (6, 7, 8) and decreases dNTP pools (13), the incorporation of F-ara-ATP into DNA may be increased as a result of raising the ratio of F-ara-ATP to dATP in cells. The incorporated F-ara-AMP, found predominantly at the 3'-termini, impairs the function of DNA polymerases by effectively terminating DNA strand elongation (10). Acting at an additional process in DNA synthesis, F-ara-ATP inhibits primer RNA synthesis by DNA primase and thus may affect lagging strand initiation (14, 15). Finally, the 3'-terminal F-ara-AMP in DNA is a poor substrate for human DNA ligase I (16). F-ara-ATP also interacts directly with DNA ligase I to inhibit the enzyme (16). In whole cells, F-ara-ATP incorporation in DNA is associated with the loss of large fragments of DNA from surviving cells (17) and is required for drug-induced DNA fragmentation in cells undergoing apoptosis (18, 19, 20). The amount of F-ara-AMP incorporated into cellular DNA is linearly correlated with the loss of clonogenicity (10, 21). It is therefore likely that this is essential for drug-induced lethality.

The 3' right-arrow 5' exonuclease activities associated with prokaryotic and eukaryotic DNA polymerases that remove terminal mismatched nucleotides increase the fidelity of DNA replication (22, 23, 24, 25, 26, 27). Conditions that inhibit exonucleolytic proofreading decrease the fidelity of DNA polymerization (27, 28), and cells lacking this activity exhibit higher mutation rates than those that express the wild type enzymes (29, 30, 31). Because the toxicity of many anticancer and antiviral nucleotide analogues is expressed only after their incorporation into nascent DNA chains, such analogues may also be recognized as substrates for 3' right-arrow 5' exonucleases. Thus, the ability of exonucleases to excise antimetabolites may serve as a drug resistance mechanism. As a corollary, incorporated analogues that resist excision removal are predicted to be highly cytotoxic.

Inasmuch as most of the incorporated F-ara-AMP residues are located at the 3'-termini of the DNA strands (10), 3'-terminal F-ara-AMP might well be excised by the 3' right-arrow 5' exonuclease activities associated with DNA polymerases. Indeed, preliminary studies indicated limited excision of 3'-terminal F-ara-AMP by pol epsilon  (10). In the present study, we used an in vitro DNA excision assay to quantitatively investigate the ability of 3' right-arrow 5' exonuclease activity of human DNA pol epsilon  to remove F-ara-AMP from the 3'-end of DNA. For comparison, excision of normal nucleotides was also evaluated. Our results demonstrated that DNA pol epsilon  bound to F-ara-AMP-terminated DNA with high affinity but excised the analogue from DNA at a low velocity. Once the phosphodiester bond between the 3'-F-ara-AMP and its adjacent nucleotide was cleaved by pol epsilon , the excision products appeared to remain associated with the enzyme, inactivating the exonuclease and preventing further exonucleolytic degradation or polymerization of the DNA products.


EXPERIMENTAL PROCEDURES

Materials

F-ara-A was kindly provided by Dr. V. L. Narayanan (Drug Synthesis and Chemistry Branch, Division of Cancer Treatment, NCI, National Institutes of Health). F-ara-ATP was synthesized as described previously (32). The M13mp18(+) single-stranded DNA and the 17-mer M13 universal sequencing primer (5'-GTAAAACGACGGCCAGT-3'), complementary to sites 6290-6306 of M13mp18(+) DNA, were obtained from Pharmacia Biotech Inc. Synthetic oligonucleotide 21-mer (5'-GTAAAACGACGGCCAGTGCCA-3'), complementary to sites 6286-6306 of M13mp18(+) DNA, was purchased from Genosys (Woodlands, TX). [gamma -32P]ATP (specific activity, 4500 Ci/mmol) was purchased from ICN Radiochemicals, Inc. (Irvine, CA). T4 polynucleotide kinase, polyacrylamide, and bis-methyl-acrylamide were from U. S. Biochemical Corp. All other reagents were obtained from Sigma. Human DNA polymerase alpha  (pol alpha ), and DNA pol epsilon  were prepared from human CCRF-CEM cells as described previously (10). The specific activities of pol alpha  and pol epsilon  were 11,936 and 2,440 units/mg, respectively. One unit is the amount of enzyme required to catalyze the incorporation of 1 nmol of dTTP into acid-insoluble material in 1 h at 37 °C.

Preparation of 3'-F-ara-AMP-21-mer

The 17-mer M13 sequencing primer was labeled at its 5'-terminus with [gamma -32P]ATP by T4 polynucleotide kinase and annealed to the complementary site of the M13mp18(+) single-stranded DNA template as described previously (10). The labeled 17-mer primer/M13mp18 template was incubated with pol alpha  and 100 µM each of dCTP, dGTP, and 10 µM F-ara-ATP at 37 °C for 30 min in a reaction mixture containing 20 mM Tris-HCl, pH 7.5, 8 mM MgCl2, 0.5 mM dithiothreitol, and 10 mM NaCl. F-ara-ATP was incorporated into the primer at site 21 opposite the T site of the M13mp18 template. The reaction products were separated by electrophoresis through a 15% polyacrylamide sequencing gel. The 21-mer band containing 3'-F-ara-AMP-21-mer was excised from the gel and recovered from the gel slice as described previously (10). The purified 3'-F-ara-AMP-21-mer was annealed to M13mp18(+) DNA to generate the following DNA hybrid,
21-mer <AR><R><C>5′ [<SUP>32</SUP>P]GTAAAACGACGGCCAGTGCC<B>F</B></C></R><R><C>3′-------CATTTTGCTGCCGGTCACGGTTCGAACGTACGGA--</C></R></AR>
<SC>Sequence 1</SC>
where Findicates the incorporated F-ara-AMP at the 3'-end of the 21-mer. To assure that all 32P-labeled oligomers were hybridized to the complementary M13mp18(+) DNA strands, a ratio of 1 oligomer to 10 copies of M13 DNA was used (see below).

Preparation of Normal DNA Substrate for Excision by pol epsilon

A 21-base oligomer with nucleotide sequence identical to the 3'-F-ara-AMP-21-mer except that dAMP was substituted for 3'-F-ara-AMP was chemically synthesized by Genosys. The normal 21-mer and the 17-mer M13 sequencing primer were separately labeled at the 5'-ends with [gamma -32P]ATP and purified by polyacrylamide sequencing gels as described above. The 32P-labeled normal oligomers were annealed to the M13mp18(+) DNA to produce the following DNA hybrid substrates for excision assay by pol epsilon .
21-mer <AR><R><C>5′ [<SUP>32</SUP>P]GTAAAACGACGGCCAGTGCC<B>A</B></C></R><R><C>3′     CATTTTGCTGCCGGTCACGGTTCGAACGTACGGA--</C></R></AR>
<SC>Sequence 2</SC>
17-mer <AR><R><C>5′ [<SUP>32</SUP>P]GTAAAACGACGGCCAGT</C></R><R><C>3′     CATTTTGCTGCCGGTCACGGTTCGAACGTACGGA--</C></R></AR>
<SC>Sequence 3</SC>
To assure that all 32P-labeled oligomers were hybridized to the complementary M13mp18(+) DNA strands, a ratio of 1 oligomer to 10 copies of M13 DNA was used. Under these conditions, no single-stranded 32P-labeled oligomer was present in the mixture as evidenced by a complete conversion of all primers to high molecular weight DNA products when the mixtures were incubated with DNA pol alpha  in the presence of the four dNTPs.

DNA Primer Excision Assay

The normal and F-ara-AMP-terminated DNA hybrids described above were used as the substrates for excision by pol epsilon . The reaction mixtures contained 20 mM Tris-HCl, pH 7.5, 8 mM MgCl2, 0.5 mM dithiothreitol, 10 mM NaCl, 0.2 unit of DNA polymerase epsilon , and the indicated concentration of DNA substrates. The reactions were carried out at 37 °C for the indicated times up to 40 min. The reaction products were analyzed by electrophoresis through 10 or 15% polyacrylamide sequencing gels. After autoradiography, the radioactivity associated with each DNA band in the gels was quantitated by a Betascope 603 blot analyzer under conditions recommended by the manufacturer (Betagen Corporation, Waltham, MA).

DNA Polymerization Assay

The normal and F-ara-AMP-terminated DNA hybrids described above were used as the substrates for polymerization by pol epsilon  or pol alpha . The reaction mixtures contained 20 mM Tris-HCl, pH 7.5, 8 mM MgCl2, 0.5 mM dithiothreitol, 10 mM NaCl, 20 µg/ml bovine serum albumin, 100 µM each of 4 dATP, dCTP, and dGTP, the indicated concentration of DNA substrates, pol epsilon , and/or pol alpha . The reactions were carried out at 37 °C for the indicated times, and analyzed by electrophoresis through a 15% polyacrylamide sequencing gel. After autoradiography, the radioactivity in the gels was quantitated by a blot analyzer as described above.

Kinetic Analysis

To determine the apparent Km and Vmax values for the excision of normal and F-ara-AMP-3'-terminated DNA by pol epsilon , various concentrations of the respective DNA constructs were incubated with pol epsilon  in 10-µl excision reaction mixtures (see above) at 37 °C for 10 min. Under these conditions, the reaction rate remained linear for at least 15 min. The reaction products were then analyzed and quantitated as described above. The sum of radioactivity associated with all excision products (20-mer and less) in each lane was used to calculate the reaction rate and then plotted against the respective DNA substrate concentrations. The apparent Km and Vmax values were calculated by the Michaelis-Menten equation with a computer-assisted program (33). To determine the Ki value of 3'-F-ara-AMP-21-mer/M13mp18 DNA in inhibiting the excision of normal oligomer/M13mp18 DNA by pol epsilon , various concentrations of normal 32P-labeled DNA substrates were incubated with pol epsilon  for 15 min in the presence of different fixed concentrations of nonradioactive 3'-F-ara-AMP-21-mer/M13mp18 DNA. Nonradioactive normal 21-mer/M13mp18 DNA were used in parallel as controls. The reaction products were analyzed and quantitated as described above, and the Ki value was calculated by the Michaelis-Menten equation with a computer-assisted program (33).

Gel Retardation Assay

The following normal or F-ara-AMP-containing oligomers were used as the substrates for binding to pol epsilon .
Normal <AR><R><C>5′ [<SUP>32</SUP>P]GTAAAACGACGGCCAGTGTGTGT<B>A</B></C></R><R><C>3′     CATTTTGCTGCCGGTCACACACATGCACACA--</C></R></AR>
<SC>Sequence 4</SC>
F-ara-A <AR><R><C>5′ [<SUP>32</SUP>P]GTAAAACGACGGCCAGTGTGTGT<B>F</B></C></R><R><C>3′     CATTTTGCTGCCGGTCACACACATGCACACA--</C></R></AR>
<SC>Sequence 5</SC>
The oligomers (50 pg/20-µl reaction mixture) were separately incubated with pol epsilon  for 10 min at 37 °C and then an additional 10 min at room temperature in the presence or absence of 5-fold competing DNA (nonradioactive normal oligomer, 250 pg/20 µl). The reaction products were then separated by electrophoresis through a 4.5% nondenaturing polyacrylamide gel at constant power of 25 W for 100 min. Autoradiography and Betascope analysis of the radioactivity were carried out after the gels were dried under vacuum at 60 °C.


RESULTS

An in vitro DNA excision assay was used to investigate the ability of 3' right-arrow 5' exonuclease activity associated with DNA polymerase epsilon  to remove the incorporated F-ara-AMP residues from the 3'-ends of DNA. A 21-base oligomer with F-ara-AMP at its 3'-end annealed to the complementary region of M13mp18(+) DNA was used as the substrate for excision by pol epsilon . The same amount of normal 21-mer/M13mp18 DNA hybrid of identical sequence with dAMP at the 3'-end of the oligomer was used for comparison. As illustrated in Fig. 1 (top panel), pol epsilon  was able to excise normal nucleotides from the 3'-end of the normal 21-mer in a nonprocessive manner. More than 10 bands of excision products with different lengths (20-mer and less) were revealed (lanes 9-14). The excision was time-dependent, and a substantial amount of final excision products (mononucleotides at the bottom of the gel) accumulated during a 25-40-min incubation (lanes 13 and 14). When a normal 17-mer/M13mp18 DNA was the substrate for pol epsilon , the excision pattern was similar to that of the normal 21-mer/M13mp18 hybrid (data not shown). However, when the 3'-F-ara-AMP-21-mer DNA hybrid was the substrate, pol epsilon  was much less effective in removing F-ara-AMP from the 3'-end of the oligomer (Fig. 1, lanes 2-7). Less than 10% of the 3'-terminal F-ara-AMP was removed during a 40-min incubation. After removal of 3'-F-ara-AMP from site 21, no significant amount of further excision of the 20-mer product was evident. When the incubation time was prolonged to 25-40 min, a barely visible faint band appeared at the 19-mer position (lanes 6 and 7). No mononucleotide was produced even at the longest incubation time (lane 7).


Fig. 1. Excision of nucleotides from normal and F-ara-AMP-terminated DNA by 3' right-arrow 5' exonuclease of pol epsilon . The 32P-5'-end-labeled 3'-F-ara-AMP-21-mer and the normal 21-mer (162 pM each) separately annealed to M13mp18 templates were incubated with 0.2 unit pol epsilon  for the indicated times. The reaction products were analyzed by a 15% polyacrylamide sequencing gel and visualized by autoradiography as described under ``Experimental Procedures.'' A, autoradiograph of the sequencing gel. Lane 1, 3'-F-ara-AMP-21-mer/M13mp18 DNA incubated without pol epsilon  and without dNTPs; lanes 2-7, 3'-F-ara-AMP-21-mer/M13mp18 DNA incubated with pol epsilon  and without dNTPs for 3, 5, 10, 15, 25, and 40 min, respectively; lane 8, normal 21-mer/M13mp18 DNA incubated without pol epsilon  and without dNTPs; lanes 9-14, normal 21-mer/M13mp18 DNA incubated with pol epsilon  and without dNTPs for 3, 5, 10, 15, 25, and 40 min, respectively. B, the radioactivity associated with the excision products in each lane was quantitated by a Betascope blot analyzer and expressed as percentage of total radioactivity input. bullet , normal 21-mer/M13mp18 DNA; open circle , F-ara-AMP-21-mer/M13mp18 DNA. Each point represents the mean ± S.E. from four experiments.
[View Larger Version of this Image (28K GIF file)]

The radioactivity associated with each DNA band was then quantitated as described under ``Experimental Procedures.'' Determination of the excision velocity indicated that the rate of 3'-terminal dAMP removal by pol epsilon  was much greater than that of excising 3'-F-ara-AMP (Fig. 1, bottom panel). For example, 0.2 unit of pol epsilon  removed more than 30% of the deoxynucleotides in 5 min, whereas less than 5% of the terminal F-ara-AMP was excised during the same period.

To determine the excision kinetics of normal nucleotides and F-ara-AMP from DNA by pol epsilon , various concentrations of 3'-F-ara-AMP-21-mer/M13mp18(+) or normal 21-mer/M13mp18(+) DNA were incubated with pol epsilon  for 10 min, during which period the excision rates remained linear. The reaction products were quantitated, and the apparent Km and Vmax values were determined as described under ``Experimental Procedures.'' As summarized in Table I, the apparent Km of pol epsilon  for F-ara-AMP-21-mer/M13mp18 DNA was approximately 37-fold less than that for the normal 21-mer/M13mp18 DNA hybrid, indicating that pol epsilon  has a higher binding affinity to F-ara-AMP-containing DNA than to normal DNA. However, the Vmax of F-ara-AMP excision was substantially less than the Vmax of the enzyme for oligonucleotides terminated by dAMP, indicating that catalysis of excision was the rate-limiting step in removal of F-ara-AMP from the 3'-end of the oligomer. The kinetic parameters for a normal 17-base oligomer/M13mp18 DNA were similar to that of the normal 21-mer/M13mp18 DNA (Table I).

Table I.

Kinetics of 3'-terminal F-ara-AMP and dAMP excision by 3' right-arrow 5' exonuclease associated with pol varepsilon  

Various concentrations of the 32P-labeled 3'-F-ara-AMP-21-mer/M13mp18 DNA or 3'-dAMP-21-mer/M13mp18 DNA were incubated with DNA polymerase varepsilon  at 37 °C for 10 min, during which time the reaction rate remained linear. The total DNA excision products and the remaining substrates were quantitated by a blot analyzer, and the apparent Km and Vmax values were calculated as described under ``Experimental Procedures.'' Each value represents the mean ± S.E. of four experiments, each comprised of three to four separate gel determinations.
DNA substrate Km Vmax

pM pmol/min/mg
F-ara-AMP-21-mer 7  ± 2 0.053  ± 0.01
Normal 21-mer 265  ± 32 1.96  ± 0.16
Normal 17-mer 242  ± 27 0.79  ± 0.09

In addition to the difference in the reaction kinetics, the excision pattern of the 3'-F-ara-AMP-21-mer by pol epsilon  was different from that of the normal oligomer. When 3'-F-ara-AMP-21-mer/M13mp18 DNA was used as the excision substrate, a band at the 20-nucleotide position was the predominant reaction product (Fig. 1, lanes 2-7). No significant amount of further excision products were detected below the 20-nucleotide band. This indicates that after pol epsilon  removed F-ara-AMP at the 3'-end of the oligomer, the enzyme was not able to further excise normal nucleotides from the 20-base oligomer and, perhaps, protected the 20-mer product from further exonucleolytic degradation. As the incubation time was prolonged, only a barely visible band at the 19-mer position was revealed (Fig. 1, lanes 6 and 7). In contrast, pol epsilon  removed nucleotides consecutively from the normal oligomer (Fig. 1A, lanes 9-14). These observations were further confirmed by scanning the radioactivity profiles associated with each DNA band by a Betascope blot analyzer. In the 25-min reaction, at least 12 excision products, with sizes decreasing in increments of a single nucleotide, were revealed from the normal 21-mer/M13mp18 substrate (data not shown). When 3'-F-ara-AMP-21-mer/M13mp18 DNA was incubated with pol epsilon  for the same time, only a relatively small excision product peak corresponding to 20-mer was detected, which reflected the slow cleavage of the phosphodiester bond between 3'-F-ara-AMP and the adjacent nucleotide at position 20. A much smaller but identifiable 19-mer peak was also revealed. Thereafter, no peaks of smaller sizes were detected. Thus, it appears that after F-ara-AMP was excised, the 3' right-arrow 5' exonuclease activity of pol epsilon  was greatly decreased relative to its utilization of the 20-mer/M13mp18 oligomer.

Further experiments were designed to investigate the mechanism by which the 3' right-arrow 5' exonuclease activity of pol epsilon  was inactivated after removal of F-ara-AMP from the 3'-end of the DNA. In sequential reaction experiments, pol epsilon  was first incubated with nonradioactive F-ara-AMP-21-mer/M13mp18 DNA for 10 min, and then the 32P-labeled normal 21-mer/M13mp18 DNA was added to the reaction for an additional 20 min. Preincubation of pol epsilon  with 81 pM or 162 pM of the nonradioactive 3'-F-ara-AMP-21-mer/M13mp18 DNA resulted in a decrease in exonuclease activity by 69 and 78%, respectively, against the 32P-labeled normal substrate (Fig. 2, lanes 3 and 4). In contrast, preincubation of pol epsilon  with the same concentrations of nonradioactive normal 21-mer/M13mp18 DNA did not significantly diminish the exonuclease activity against labeled normal substrate (Fig. 2, lanes 5 and 6).


Fig. 2. Effects of 3'-F-ara-AMP-DNA on the 3' right-arrow 5' exonuclease of pol epsilon . DNA polymerase epsilon  (0.1 unit) was preincubated with nonradioactive 3'-F-ara-AMP-21-mer/M13mp18DNA (81 pM (+) or 162 pM (++)) or normal 21-mer/M13mp18DNA (81 pM (+) or 162 pM (++)) at 37 °C for 10 min. Then 32P-labeled normal 21-mer/M13mp18 DNA (1400 pM) was added to each reaction and incubated for an additional 20 min. The reaction products were separated and quantitated as described in the legends to Fig. 1. Each column and bar represents data from four experiments, mean ± S.E.
[View Larger Version of this Image (20K GIF file)]

To determine the kinetics of inhibition by 3'-F-ara-AMP-21-mer/M13mp18 DNA, various concentrations of 32P-labeled normal 21-mer/M13mp18 DNA substrates were incubated with pol epsilon  in the presence of different fixed concentrations of nonradioactive analogue-terminated or normal DNA hybrids. The dose effect of the two DNA hybrids on the 3' right-arrow 5' exonuclease activity of pol epsilon  is illustrated in Fig. 3A. Only the F-ara-AMP-containing DNA showed inhibitory activity. When the velocity of the reaction was plotted as the function of substrate (32P-labeled normal 21-mer/M13mp18 DNA) concentrations in a double reciprocal plot (Fig. 3B), the lines representing reactions without and with different fixed concentrations of the inhibitor (nonradioactive 3'-F-ara-AMP-21-mer/M13mp18) converged at the ordinate, indicating that the nature of this inhibition was most likely competitive. In fact, computer analysis (33) of the plots revealed a competitive inhibition with a Ki value of 7.5 pM. This is consistent with the high affinity of pol epsilon  for F-ara-AMP-21-mer/M13mp18 DNA as evidenced by its low Km for excision (7 pM, Table I).


Fig. 3. Inhibition of the 3' right-arrow 5' exonuclease of pol epsilon  by 3'-F-ara-AMP-DNA. A, DNA polymerase epsilon  was preincubated with the indicated concentration of either nonradioactive 3'-F-ara-AMP-21-mer/M13mp18 (black-triangle) or normal 21-mer/M13mp18 (black-square) at 37 °C for 10 min. Then 32P-labeled normal 21-mer/M13mp18 DNA (1400 pM) was added and incubated for an additional 20 min. The reaction products were analyzed by 15% polyacrylamide gel and quantitated by Betascope. Each point represents data of four to eight determinations of separate gels, mean ± S.E. B, kinetics of inhibition of pol epsilon  3' right-arrow 5' exonuclease by 3'-F-ara-AMP-21-mer/M13mp18 DNA. The indicated concentrations (nM-1, 1/S) of normal 32P-labeled DNA substrates were incubated with pol epsilon  for 15 min in the presence of different fixed concentrations of the inhibitor (nonradioactive 3'-F-ara-AMP-21-mer/M13mp18 DNA). The reaction products were quantitated, and the apparent Ki value was calculated as described under ``Experimental Procedures.'' Inhibitor concentrations were as follows: 0 pM (black-square), 10 pM (black-triangle), 20 pM (black-down-triangle ), 40 pM (black-diamond ), and 80 pM (bullet ). V, initial velocity.
[View Larger Version of this Image (16K GIF file)]

Because the nonradioactive normal DNA (3-162 pM) did not inhibit the enzyme activity, the loss of excision activity observed in samples preincubated with F-ara-AMP-terminated DNA was not simply due to competition between the nonradioactive DNA (3-162 pM) and the 32P-labeled DNA substrate (1400 pM). Rather, we postulated that when pol epsilon  was preincubated with 3'-F-ara-AMP-21-mer/M13mp18 DNA, the enzyme remained associated with the F-ara-AMP-terminated DNA with high affinity and was effectively trapped by the reaction products after the phosphodiester bond between 3'-F-ara-AMP and the adjacent nucleotide (position 20) was cleaved. This hypothesis predicts that the 3'-end of the oligomer (20-mer) would be blocked by pol epsilon  after cleavage of F-ara-AMP. Two different approaches were taken to test this postulate.

In the first experiment, pol epsilon  was incubated with 32P-labeled F-ara-AMP-21-mer/M13mp18 DNA for 15 min to generate the 20-base excision product. Our hypothesis predicts that if the enzyme remained bound to DNA, the 3'-end of the 20-mer would not be accessible for further excision by freshly added pol epsilon . Indeed, the further addition of pol epsilon  to reactions containing F-ara-AMP-terminated DNA preincubated with pol epsilon  led to the accumulation of more 20-base excision product but did not result in significant removal of nucleotide from the 20-mer (Fig. 4, lanes 3-6). This is consistent with the conclusion that the 3'-end of the oligomer was protected or blocked by the enzyme. When the amount of pol epsilon  was increased to a total of 5 µl (0.1 unit/µl), a light band was visible at the 19-mer position (lane 6), suggesting that the binding of the preincubated pol epsilon  to the 20-mer/M13mp18 DNA was tight but still reversible. No mobility shift of the 20-mer was observed on denaturing polyacrylamide gels, indicating that pol epsilon  dissociated from the DNA under denaturation conditions (95 °C, 50% formamide, and 8 M urea). Therefore, the binding between pol epsilon  and DNA did not appear to involve the formation of a covalent bond. In contrast, the addition of pol epsilon  to reactions preincubated with pol epsilon  and normal DNA led to almost complete digestion of the normal 21-mer (Fig. 4, lanes 9 and 10).


Fig. 4. Blockage of DNA substrate by inactivated pol epsilon . DNA polymerase epsilon  was incubated with 32P-5'-end-labeled 3'-F-ara-AMP-21-mer/M13mp18 DNA or 32P-5'-end-labeled normal 21-mer/M13mp18 DNA at 37 °C. After 15 min, fresh pol epsilon  was added to the reactions as indicated and incubated for additional 15 min. The numbers indicate the amount of pol epsilon  added in µl (0.1 unit/µl). epsilon , pol epsilon .
[View Larger Version of this Image (66K GIF file)]

In the second approach to investigating the consequences of 3'-terminal F-ara-AMP excision, we reasoned that if pol epsilon  was not tightly associated to the initial excision products, the 3'-end of the 20-mer should be available for polymerization by DNA pol alpha  in the presence of normal dNTPs. Fig. 5 demonstrates that when F-ara-AMP-21-mer was incubated with pol alpha  and normal dNTPs after preincubation with pol epsilon  for 15 min, no polymerization products appeared (lane 5). Quantitation of the radioactivity by Betascope revealed 6.6 ± 1.0%, and 6.9 ± 1.5% (mean ± S.D., n = 12) of the total input radioactivity associated with the excision product band (20-mer) in the reaction containing pol epsilon  alone (lane 3) and the reaction containing pol epsilon  and pol alpha  in the presence of normal dNTPs (lane 5), respectively. The same amount of excision product (20-mer) in lane 3 (no pol alpha ) and lane 5 (with pol alpha ) indicates that after F-ara-AMP was excised from the 3'-end of the 21-mer by pol epsilon , the excision product (20-mer) was not extended by pol alpha . In contrast, when the normal 21-mer/M13mp18 DNA was preincubated with pol epsilon  for 15 min and then with pol alpha  in the presence of dATP, dCTP, and dGTP, both polymerization and excision products were generated (lane 6). The polymerization products appeared as a single band at the 24-mer position, due to the absence of dTTP on the reaction mixture (the M13mp18(+) template directs that dTTP be incorporated at sites 25 and 26; see the DNA sequence under ``Experimental Procedures''). The intensity of the DNA band at site 24 is visible but weak, probably due to the presence of exonuclease activity of pol epsilon . Quantitation of the radioactivity by Betascope analysis revealed 4320 counts associated with this band, which represented 4.3% of the total input radioactivity. No radioactivity was detected at the same site (site 24) in lane 5, confirming that the cleaved F-ara-AMP-DNA could not be extended by pol alpha . When normal DNA was used as the substrate, high molecular weight DNA products were synthesized if all four dNTPs were added (data not shown). In the absence of pol alpha  and dNTPs, pol epsilon  generated only excision products (lane 4). Together, these results support the hypothesis that pol epsilon  remained bound to the 3'-end of the 20-mer DNA product after excision of F-ara-AMP.


Fig. 5. Inactivated pol epsilon  blocks polymerization of the DNA substrate by pol alpha . The excision assay was followed by the polymerization assay as described under ``Experimental Procedures.'' DNA polymerase epsilon  (0.2 unit) was preincubated with radioactive 3'-F-ara-AMP-21-mer/M13mp18 DNA (1.4 nM) or normal 21-mer/M13mp18 DNA (1.4 nM) at 37 °C for 15 min. Then 0.1 unit of pol alpha  and 100 µM each of dATP, dCTP, and dGTP were added and incubated for an additional 15 min.
[View Larger Version of this Image (26K GIF file)]

The physical association of pol epsilon  with F-ara-AMP-DNA was revealed using a gel retardation assay. As demonstrated in Fig. 6, incubation of DNA pol epsilon  with 3'-F-ara-AMP-DNA oligomer (labeled with 32P at the 5'-end) caused a mobility retardation of the oligomer (lane 2). Due to the high molecular mass of pol epsilon , the retarded band appeared near the well position. When a 5-fold concentration of competing DNA oligomer of identical DNA sequence (except that dAMP was at the 3'-end instead of F-ara-AMP) was added to the reaction, the intensity of the retarded band was not significantly reduced (lane 3), indicating that pol epsilon  bound to the F-ara-AMP-DNA oligomer with high affinity. In contrast, when normal 5'-32P-DNA oligomers were incubated with pol epsilon , substantial amounts of excision products were generated. No evidence of normal oligomer retardation was discerned in the absence (lane 5) or the presence (lane 6) of competing DNA, suggesting only a loose association of pol epsilon  with the normal DNA substrate.


Fig. 6. Mobility retardation assay of pol epsilon /DNA complex. The 32P-5'-end-labeled normal or F-ara-AMP-DNA oligomers (50 pg/20 µl reaction mixture) were separately incubated with pol epsilon  for 10 min at 37 °C, and then 250 pg/20 µl of competing DNA (nonradioactive normal oligomer) was added to the indicated reactions and incubated for an additional 10 min at room temperature. The reaction products were separated in a nondenaturing polyacrylamide gel, and an autoradiograph was made as described under ``Experimental Procedures.'' Lanes 1, 2, and 3, F-ara-AMP-oligomer incubated without pol epsilon , with pol epsilon , and with pol epsilon  plus competing DNA, respectively; lanes 4, 5, and 6, normal oligomer incubated without pol epsilon , with pol epsilon , and with pol epsilon  plus competing DNA, respectively. CO, enzyme-DNA oligomer complex; FD, free DNA oligomer; EX, excision products.
[View Larger Version of this Image (33K GIF file)]

Because F-ara-AMP was generated when the phosphodiester bond between 3'-F-ara-AMP at position 21 and the adjacent nucleotide (position 20) was cleaved by pol epsilon , it is possible that the F-ara-AMP molecules might inactivate the exonuclease associated with pol epsilon . To investigate this possibility, various concentrations of free F-ara-AMP were added to the excision reactions containing pol epsilon  and normal 32P-21-mer/M13mp18 substrate (Fig. 7). Free F-ara-AMP, at concentrations as great as 100 µM, did not affect the excision activity of pol epsilon . Inhibition was observed only when the concentration of F-ara-AMP was increased to 1 mM. In contrast, pol epsilon  was inactivated by 10-30 pM 3'-F-ara-AMP-21-mer/M13mp18 DNA (Figs. 2 and 3). These results are consistent with a mechanism-based inactivation of pol epsilon  by the analogue-containing DNA.


Fig. 7. Effect of free F-ara-AMP on pol epsilon  3' right-arrow 5' exonuclease activity. DNA polymerase epsilon  (0.1 unit) was incubated with 32P-labeled normal 21-mer/M13mp18 DNA (162 pM) in the presence of the indicated concentrations of free F-ara-AMP at 37 °C for 20 min. The reaction products were analyzed by 15% polyacrylamide gel electrophoresis and quantitated by Betascope. The control value of relative excision was 22.6 ± 0.6% (mean ± S.E.). Each point represents data of five separate gels, mean ± S.E.
[View Larger Version of this Image (19K GIF file)]

GMP, an inhibitor of the 3' right-arrow 5' exonuclease activities (34, 35, 36), was used to evaluate the excision of F-ara-AMP from the 3'-end of DNA by pol epsilon  in comparison with that of normal nucleotides. The addition of GMP to reaction mixtures inhibited the 3' right-arrow 5' exonuclease activity of pol epsilon  to the same extent when either F-ara-AMP-terminated DNA or normal DNA was used as substrate (data not shown). This inhibition was concentration-dependent between 30 and 1000 µM GMP. For example, excision of terminal F-ara-AMP and normal deoxynucleotides was inhibited by 51 and 55%, respectively, by 300 µM GMP. These results indicate that the presence of F-ara-AMP at the 3'-end of DNA did not affect the inhibitory activity of GMP on pol epsilon , suggesting that the site in pol epsilon  for GMP action may be separate from the exonuclease catalytic site. Earlier studies (34) demonstrated that the 5'-monophosphate of arabinosyladenine also failed to inhibit the 3' right-arrow 5' exonuclease of what is now recognized as pol epsilon  from rabbit bone marrow (35). Taken together, these result suggest that inhibition of pol epsilon  3' right-arrow 5' exonuclease by F-ara-AMP is likely to be a mechanism-based process. On the other hand, reduction of pol epsilon  3' right-arrow 5' exonuclease activity by relative high concentrations (1 mM) of free F-ara-AMP may be mediated by a separate mechanism, perhaps similar to that of inhibition by 5'-GMP.


DISCUSSION

The present study demonstrated that DNA polymerase epsilon  recognized and bound to F-ara-AMP-terminated DNA in preference to normal DNA. Excision of the analogue from the 3'-terminus of DNA, however, proceeded at a much slower rate than did removal of 3'-dAMP. Previous studies demonstrated that mismatched deoxynucleotides at the 3'-terminus of DNA caused an induced fit conformational change of T7 DNA polymerase (36, 37). This change slowed the polymerization step and allowed sufficient time for the intramolecular transfer of the 3'-mismatched nucleotide from the polymerase site to the exonuclease site. The kinetic partitioning between exonuclease and polymerase sites favored error correction during DNA replication when a DNA polymerase encountered the 3'-terminal mismatched nucleotide. This was associated with a reduced rate of polymerization (37, 38). A similar interpretation may be applied to the case of an incorporated nucleotide analogue such as F-ara-AMP, which effectively inhibits the polymerization activity of pol epsilon  (10). As was seen with the mismatched terminal nucleotide-induced intramolecular transfer of T7 DNA polymerase, it is likely that when pol epsilon  encounters the 3'-terminal F-ara-AMP, which it cannot readily extend, a similar transfer of the 3'-terminal F-ara-AMP from the polymerase site to the exonuclease site might occur.

The present study showed that the 3' right-arrow 5' exonuclease of pol epsilon  bound to 3'-F-ara-AMP-DNA with high affinity (Km = 7 pM). This was in contrast with substrates with 3'-terminal dAMP, for which the 3' right-arrow 5' exonuclease of pol epsilon  exhibited 37-fold less affinity. However, the 3'-terminal F-ara-AMP was a poor substrate for the exonucleolytic activity of pol epsilon ; excision proceeded at a substantially slower rate than it did for 3'-terminal dAMP. Furthermore, the 3' right-arrow 5' exonuclease of pol epsilon  became inactive after the 3'-terminal F-ara-AMP had been excised. Because it seems likely that the enzyme activity would be restored if the excision products were released, we postulate that one or both of the products remained associated with the enzyme after the cleavage of the phosphodiester bond. This hypothesis is supported by the unique excision patterns shown in Fig. 1, in which it is seen that after the phosphodiester bond between the 3'-terminal F-ara-AMP and the penultimate nucleotide was cleaved, pol epsilon  failed to excise the subsequent deoxynucleotides. The mobility retardation experiment (Fig. 6) provided evidence that pol epsilon  was physically associated with F-ara-AMP-DNA. We also attempted to test directly the hypothesis that F-ara-AMP remained associated with the enzyme after cleavage by using [2-3H]F-ara-ATP to label the 3'-terminal F-ara-AMP on the primer. Unfortunately, these experiments were not conclusive because the specific activity of the incorporated [3H]F-ara-AMP at the 3'-termini of DNA was not adequate to detect the small amount of F-ara-AMP excised.

Additional evidence indicates that after excision of F-ara-AMP, the 20-mer/M13mp18 DNA product remained in contact with pol epsilon . This interpretation is supported by the finding that after incubation of 3'-F-ara-AMP-21-mer/M13mp18 with pol epsilon , the DNA product was not a substrate for further excision upon the addition of fresh pol epsilon  (Fig. 4, lanes 3-6). Furthermore, after removal of 3'-F-ara-AMP, the inability of newly added pol alpha  and dNTPs to polymerize the 20-mer/M13mp18 DNA product (Fig. 5) is also consistent with the likelihood that one or both excision products remained associated with the enzyme. This association may have contributed to the sustained inhibition of both the exonuclease and polymerase functions. Because no mobility shift of the 20-mer product was observed in denaturing polyacrylamide gels, it is unlikely that pol epsilon  bound to the DNA excision product (20-mer/M13mp18 DNA) by forming a covalent bond.

Inactivation of DNA polymerization by formation of a 3'-analogue DNA-enzyme complex was also observed by Reardon and Spector (39, 40). They demonstrated that when acyclovir triphosphate was incorporated into the 3'-end of DNA primer by herpes simplex virus (type 1) DNA polymerase, upon binding of the next nucleotide as directed by the template, the viral enzyme and the analogue-containing DNA formed a ``dead end complex.'' A similar mechanism was postulated for the inhibition of mammalian DNA polymerase alpha  by 2',3'-dideoxycytidine triphosphate (41). In a different mechanism, aphidicolin inhibited both DNA polymerization and the 3' right-arrow 5' exonuclease activity of pol epsilon  simultaneously (42, 43, 44) by sequestering the enzyme to the mismatched DNA region (43).

Incorporated arabinosyl nucleotide analogues are known to alter the configuration of duplex DNA in a specific manner (45). We speculate that although pol epsilon  readily recognizes and adapts its shape to bind to the 3'-terminal F-ara-AMP, cleavage of the phosphodiester bond is achieved with relative difficulty. It is likely that the conformational changes in pol epsilon  that are required to conduct this reaction are so extensive that the enzyme is unable to release the reaction products. If so, the change in enzyme conformation induced by excision of F-ara-AMP may be a key event responsible for the failure to release the excision products and for the ensuing inactivation of the exonuclease activity. This proposed mechanism of reaction-induced inactivation of pol epsilon  may provide an explanation for the inability of free F-ara-AMP to inhibit the enzyme in the presence of normal DNA (Fig. 7). Because the binding of pol epsilon  to normal DNA did not abnormally change the enzyme conformation, the presence of free F-ara-AMP should not lead to sequestering of the enzyme to its normal DNA substrate. Recent studies using genetic approaches indicated that pol epsilon , in addition to its polymerization and excision functions, may serve as a sensor involved in S phase checkpoint signaling in yeast (46). Thus, it will be important to investigate the biological consequences of the sequestering of pol epsilon  by F-ara-AMP-DNA in whole cells.

The data presented in Table I and Fig. 3 suggest that the inhibition of pol epsilon  excision of normal DNA by F-ara-AMP-DNA is probably competitive in nature. This may reflect the initial competitive binding of the two DNA species to the enzyme. It is possible that the fraction of pol epsilon  molecules that bound to F-ara-AMP-DNA might have reacted differentially to produce two possible consequences. A small portion of the enzyme molecules cleaved F-ara-AMP at a slow rate and thereby become sequestered in the dead end complex. Most of the enzyme, however, was unable to cleave the analog and eventually detached from the uncleaved DNA. This portion of pol epsilon  could have been recycled in the reaction, free to enter a second phase of competitive distribution between normal DNA and F-ara-AMP-DNA. This nonproductive binding of pol epsilon  to F-ara-AMP-DNA slowed the excision of normal DNA in a competitive manner. Nevertheless, because a small portion of the enzyme was sequestered in the dead end complex and was unable to recycle, the overall reaction is most likely a mixed-type competitive inhibition.

Although relatively few investigations of the ability of proofreading exonucleases associated with DNA polymerases to remove nucleotide analogues have been reported, a review of the field suggests that our findings with F-ara-AMP-terminated DNA may not be generalized to other arabinosyl nucleosides or to nucleoside analogues with different nonphysiological carbohydrates that result in either relative or absolute inhibition of DNA elongation. For instance, 2',2'-difluorodeoxycytidine monophosphate, the active form of the new anticancer drug gemcitabine was resistant to excision by DNA pol epsilon  (47) when placed at either the 3'-terminus or in the penultimate position. With respect to antiviral drugs, the incorporated 3'-azidothymidine monophosphate was removed by human pol epsilon  with relative difficulty (48, 49), whereas 2',3'-didehydro-2',3'-dideoxyadenosine was not a substrate for the same enzyme (48). The resistance to exonucleolytic action of 3'-terminal nucleotides with phosphorothioate linkages makes them substrates of choice for PCR primers when using thermostable DNA polymerases that possess 3' right-arrow 5' exonucleases (50). In contrast, 3'-terminal arabinosylcytosine monophosphate was shown to be a relatively good substrate for excision by the 3' right-arrow 5' exonuclease of E. coli Klenow fragment (51) and human DNA pol epsilon  (47). Following excision of the analogue, the appearance of excision products of intermediate length indicates that removal of subsequent nucleotides proceeded in a nonprocessive fashion. Comparative studies with DNA terminated by the monophosphates of arabinosyladenine and 2-fluoro-2'-deoxyadenosine will help determine the relative importance of the fluorine on the 2-carbon and the arabinosyl hydroxyl to the activity of pol epsilon  against F-ara-AMP.

After incubation of cells with radioactive F-ara-A, more than 94% of the incorporated drug in DNA was located at 3'-termini (10). This is strongly correlated with loss of viability, suggesting that such terminal incorporation of F-ara-A nucleotide is a critical mechanism of drug action (10, 19, 21). Further strand elongation by DNA polymerases is greatly impeded (10), and ligation of DNA strands by DNA ligase I (16) is inhibited by 3'-terminal F-ara-AMP in DNA, thus interfering with DNA replication and probably with DNA repair. Because efficient excision of 3'-terminal F-ara-AMP from DNA could constitute a resistance mechanism by which cells may circumvent these inhibitory actions, it will be important to evaluate whether cells possess other enzymes that may be more capable than pol epsilon  of removing the incorporated analogue. For instance, the amino acid sequence of the active site region of 3' right-arrow 5' exonucleases of aphidicolin-sensitive DNA polymerases is highly conserved (30). It will be interesting to determine whether 3'-terminal F-ara-AMP poses a similar problem for the 3' right-arrow 5' exonucleases of DNA polymerases other than pol epsilon . In addition, proteins with 3' right-arrow 5' exonucleases that either lack DNA polymerase activity (52, 53, 54, 55, 56, 57, 58) or have cryptic polymerizing activities (59) have been identified. The possibility that these may be accessory proteins that provide a proofreading function for DNA polymerases such as pol alpha  that lack inherent exonuclease activity provides a compelling rationale for characterizing their activities against DNA terminated by therapeutically relevant nucleotide analogues.


FOOTNOTES

*   This work was supported in part by NCI, National Institutes of Health, Grant CA28596 and by American Cancer Society Grant DHP-1. The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    To whom correspondence should be addressed: Section of Cellular and Molecular Pharmacology, Box 71, The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030. Tel.: 713-792-3335; Fax: 713-794-4316.
1   The abbreviations used are: F-ara-AMP, 9-beta -D-arabinofuranosyl-2-fluoroadenine 5'-monophosphate (fludarabine); F-ara-ATP, 9-beta -D-arabinofuranosyl-2-fluoroadenine 5'-triphosphate; pol epsilon  and pol alpha , DNA polymerase epsilon  and alpha , respectively.

REFERENCES

  1. Hochter, H. S., Kim, K., Green, M. D., Mann, R. B., Neiman, R. S., Oken, M. M., Cassileth, P. A., Stott, P., Ritch, P., O'Connell, M. J. (1992) J. Clin. Oncol. 10, 28-32 [Abstract]
  2. Redman, J. R., Cabanillas, F., Velasquez, W. S., McLaughlin, P., Hagemeister, F. B., Swan, F., Jr., Rodriguez, M. A., Plunkett, W., Keating, M. J. (1992) J. Clin. Oncol. 10, 790-794 [Abstract/Free Full Text]
  3. Keating, M. J., O'Brien, S., Kantarjian, H., Plunkett, W., Estey, E., Koller, C., Beran, M., Freireich, E. J. (1993) Blood 81, 2878-2884 [Abstract/Free Full Text]
  4. Brockman, R. W., Schabel, F. M., Jr., Montgomery, J. A. (1977) Biochem. Pharmacol. 26, 2193-2196 [CrossRef][Medline] [Order article via Infotrieve]
  5. Plunkett, W., Chubb, S., Alexander, L., Montgomery, J. A. (1980) Cancer Res. 40, 2349-2355 [Abstract/Free Full Text]
  6. Tseng, W.-C., Derse, D., Cheng, Y.-C., Brockman, R. W., Bennett, L. L., Jr. (1982) Mol. Pharmacol. 21, 474-477 [Abstract]
  7. White, E. L., Shaddix, S. C., Brockman, R. W., Bennett, L. L., Jr. (1982) Cancer Res. 42, 2260-2264 [Abstract/Free Full Text]
  8. Parker, W. B., Bapat, A. R., Shen, J.-X., Townsend, A. J., Cheng, Y. (1988) Mol. Pharmacol. 34, 485-491 [Abstract]
  9. Plunkett, W., Gandhi, V., and Huang, P. (1990) Semin. Oncol. 17, Suppl. 8, 3-20
  10. Huang, P., Chubb, S., Plunkett, W. (1990) J. Biol. Chem. 265, 16617-16625 [Abstract/Free Full Text]
  11. Burgers, P. M. J., Bambara, R. A., Campbell, J. L., Chang, L. M. S., Downey, K., Hubscher, U., Lee, M. Y. W. T., Linn, S., So, A. G., Spadari, S. (1990) Eur. J. Biochem. 191, 617-618 [Medline] [Order article via Infotrieve]
  12. Bambara, R. A., Jessee, C. B. (1991) Biochim. Biophys. Acta 1088, 11-24 [Medline] [Order article via Infotrieve]
  13. Gandhi, V., Plunkett, W. (1988) Cancer Res. 48, 329-334 [Abstract/Free Full Text]
  14. Parker, W., Cheng, Y. (1987) Mol. Pharmacol. 31, 146-151 [Abstract]
  15. Catapano, C. V., Perrino, F. W., Fernandes, D. J. (1993) J. Biol. Chem. 268, 7179-7185 [Abstract/Free Full Text]
  16. Yang, S.-W., Huang, P., Plunkett, W., Becker, F. F., Chan, J. Y. H. (1992) J. Biol. Chem. 267, 2345-2349 [Abstract/Free Full Text]
  17. Huang, P., Siciliano, M. J., Plunkett, W. (1989) Mutat. Res. 210, 291-301 [CrossRef][Medline] [Order article via Infotrieve]
  18. Robertson, L. E., Chubb, S., Meyn, R. E., Story, M., Ford, R., Hittelman, W. N., Plunkett, W. (1993) Blood 81, 143-150 [Abstract/Free Full Text]
  19. Huang, P., Plunkett, W. (1995) Cancer Chemother. Pharmacol. 36, 181-188 [Medline] [Order article via Infotrieve]
  20. Huang, P., Robertson, L. E., Wright, S., Plunkett, W. (1995) Clin. Cancer Res. 1, 1005-1013 [Abstract]
  21. Spriggs, D., Robbins, G., Mitchell, T., Kufe, D. (1986) Biochem. Pharmacol. 35, 247-252 [CrossRef][Medline] [Order article via Infotrieve]
  22. Kunkel, T. A., Sabatino, R. D., Bambara, R. A. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 4865-4869 [Abstract/Free Full Text]
  23. Cotterill, S. M., Reyland, M. E., Loeb, L. A., Lehman, I. R. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 5635-5639 [Abstract/Free Full Text]
  24. Kunkel, T. A., Soni, A. (1988) J. Biol. Chem. 263, 4450-4459 [Abstract/Free Full Text]
  25. Nishida, C., Reinhard, P., Linn, S. (1988) J. Biol. Chem. 263, 501-510 [Abstract/Free Full Text]
  26. Yang, C. L., Zhang, S. J., Toomey, N. L., Palmer, T. N., Lee, M. Y. (1991) Biochemistry 30, 7534-7541 [CrossRef][Medline] [Order article via Infotrieve]
  27. Thomas, D. C., Roberts, J. D., Sabatino, R. D., Myers, T. W., Tan, C.-K., Downey, K. M., So, A. G., Bambara, R. A., Kunkel, T. A. (1991) Biochemistry 30, 11751-11759 [CrossRef][Medline] [Order article via Infotrieve]
  28. Kunkel, T. A., Mosbaugh, D. W. (1989) Biochemistry 28, 988-995 [CrossRef][Medline] [Order article via Infotrieve]
  29. Schaaper, R. M. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 8126-8130 [Abstract/Free Full Text]
  30. Morrison, A., Bell, J. B., Kunkel, T. A., Sugino, A. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 9473-9477 [Abstract/Free Full Text]
  31. Simon, M., Giot, L., Faye, G. (1991) EMBO J. 10, 2166-2170
  32. Novotony, L., and Plunkett, W. (1990) in Nucleic Acid Chemistry (Townsend, L. B., and Tipson, R. S., eds) Part 4, pp. 337-340, John Wiley & Sons, Inc., New York
  33. Chou, J., Chou, T. (1985) Dose-Effect Analysis with the Microcomputer , p. 5, Elsevier Science Publishers B.V., Amsterdam
  34. Lee, M. Y. W. T., Byrnes, J. J., Downey, K. M., So, A. G. (1980) Biochemistry 19, 215-219 [CrossRef][Medline] [Order article via Infotrieve]
  35. Lu, C.-D., Byrnes, J. J. (1992) Biochemistry 31, 12403-12409 [CrossRef][Medline] [Order article via Infotrieve]
  36. Wong, I., Patel, S. S., Johnson, K. A. (1991) Biochemistry 30, 526-537 [CrossRef][Medline] [Order article via Infotrieve]
  37. Donlin, M. J., Patel, S. S., Johnson, K. A. (1991) Biochemistry 30, 538-546 [CrossRef][Medline] [Order article via Infotrieve]
  38. Perrino, F. W., Loeb, L. A. (1990) Biochemistry 29, 5226-5231 [CrossRef][Medline] [Order article via Infotrieve]
  39. Reardon, J. E., Spector, T. (1989) J. Biol. Chem. 264, 7405-7411 [Abstract/Free Full Text]
  40. Reardon, J. E., Spector, T. (1991) Adv. Pharmacol. 22, 1-27
  41. Perrino, F. W., Mekosh, H. L. (1992) J. Biol. Chem. 267, 23043-23051 [Abstract/Free Full Text]
  42. Goscin, L. P., Byrnes, J. J. (1982) Biochemistry 21, 2513-2518 [CrossRef][Medline] [Order article via Infotrieve]
  43. Sabatino, R. D., Myers, T. W., Bambara, R. A. (1990) Cancer Res. 50, 5340-5344 [Abstract/Free Full Text]
  44. Cheng, C.-H., Kuchta, R. D. (1993) Biochemistry 32, 8568-8574 [CrossRef][Medline] [Order article via Infotrieve]
  45. Gao, Y.-G., van der Marel, G. A., van Boom, J. H., Wang, A. H.-J. (1991) Biochemistry 30, 9922-9931 [CrossRef][Medline] [Order article via Infotrieve]
  46. Navas, T. A., Zhou, Z., Elledge, S. (1995) Cell 80, 29-39 [CrossRef][Medline] [Order article via Infotrieve]
  47. Huang, P., Chubb, S., Hertel, L. W., Grindey, G. B., Plunkett, W. (1991) Cancer Res. 51, 6110-6117 [Abstract/Free Full Text]
  48. Huang, P., Farquhar, D., Plunkett, W. (1992) J. Biol. Chem. 267, 2817-2822 [Abstract/Free Full Text]
  49. Nickel, W., Austermann, S., Bialek, G., Grosse, F. (1992) J. Biol. Chem. 267, 848-854 [Abstract/Free Full Text]
  50. Skerra, A. (1992) Nucleic Acids Res. 20, 3551-3554 [Abstract/Free Full Text]
  51. Mikita, T., Beardsley, G. P. (1988) Biochemistry 27, 4698-4705 [CrossRef][Medline] [Order article via Infotrieve]
  52. Lindahl, T., Gally, J. A., Edelman, G. M. (1969) J. Biol. Chem. 244, 5014-5019 [Abstract/Free Full Text]
  53. Mosbaugh, D. W., Meyer, R. R. (1980) J. Biol. Chem. 255, 10239-10247 [Abstract/Free Full Text]
  54. Hollis, G. F., Grossman, L. (1981) J. Biol. Chem. 256, 8074-8079 [Abstract/Free Full Text]
  55. Skarnes, W., Bonin, P., Baril, E. (1986) J. Biol. Chem. 261, 6629-6636 [Abstract/Free Full Text]
  56. Vasquez-Padua, M. A., Starnes, M. C., Cheng, Y.-C. (1990) Cancer Commun. 2, 55-62 [Medline] [Order article via Infotrieve]
  57. Perrino, F. W., Miller, H., Ealey, K. A. (1994) J. Biol. Chem. 269, 16357-16363 [Abstract/Free Full Text]
  58. Skalski, V., Liu, S.-H., Cheng, Y.-C. (1995) Biochem. Pharmacol. 50, 815-821 [CrossRef][Medline] [Order article via Infotrieve]
  59. Bialek, G., Grosse, F. (1993) J. Biol. Chem. 268, 6024-6033 [Abstract/Free Full Text]

©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Cancer Res.Home page
Y. Wang, X. Liu, A. Matsuda, and W. Plunkett
Repair of 2'-C-Cyano-2'-Deoxy-1-{beta}-D-arabino-Pentofuranosylcytosine-Induced DNA Single-Strand Breaks by Transcription-Coupled Nucleotide Excision Repair
Cancer Res., May 15, 2008; 68(10): 3881 - 3889.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. A. Moufarij, D. Sampath, M. J. Keating, and W. Plunkett
Fludarabine increases oxaliplatin cytotoxicity in normal and chronic lymphocytic leukemia lymphocytes by suppressing interstrand DNA crosslink removal
Blood, December 15, 2006; 108(13): 4187 - 4193.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
V. A. Rao and W. Plunkett
Activation of a p53-mediated Apoptotic Pathway in Quiescent Lymphocytes after the Inhibition of DNA Repair by Fludarabine
Clin. Cancer Res., August 1, 2003; 9(8): 3204 - 3212.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
Y. Zhou, G. Achanta, H. Pelicano, V. Gandhi, W. Plunkett, and P. Huang
Action of (E)-2'-Deoxy-2'-(fluoromethylene)cytidine on DNA Metabolism: Incorporation, Excision, and Cellular Response
Mol. Pharmacol., January 1, 2002; 61(1): 222 - 229.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. Sampath and W. Plunkett
The Role of c-jun Kinase in the Apoptotic Response to Nucleoside Analogue-induced DNA Damage
Cancer Res., November 1, 2000; 60(22): 6408 - 6415.
[Abstract] [Full Text]


Home page
Mol. Pharmacol.Home page
P. Kramata and K. M. Downey
9-(2-Phosphonylmethoxyethyl) Derivatives of Purine Nucleotide Analogs: A Comparison of Their Metabolism and Interaction with Cellular DNA Synthesis
Mol. Pharmacol., December 1, 1999; 56(6): 1262 - 1270.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
D. J. Mazur and F. W. Perrino
Identification and Expression of the TREX1 and TREX2 cDNA Sequences Encoding Mammalian 3'right-arrow5' Exonucleases
J. Biol. Chem., July 9, 1999; 274(28): 19655 - 19660.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Kramata, K. M. Downey, and L. R. Paborsky
Incorporation and Excision of 9-(2-Phosphonylmethoxyethyl)guanine (PMEG) by DNA Polymerase delta  and epsilon  in Vitro
J. Biol. Chem., August 21, 1998; 273(34): 21966 - 21971.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Skalski, K. R. Brown, B. Y. Choi, Z.-Y. Lin, and S. Chen
A 3'-5' Exonuclease in Human Leukemia Cells. IMPLICATIONS FOR RESISTANCE TO 1-beta -D-ARABINOFURANOSYLCYTOSINE AND 9-beta -D-ARABINOFURANOSYL-2-FLUOROADENINE 5'-MONOPHOSPHATE
J. Biol. Chem., August 11, 2000; 275(33): 25814 - 25819.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kamiya, K.-i.
Right arrow Articles by Plunkett, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kamiya, K.-i.
Right arrow Articles by Plunkett, W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1996 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement