![]()
|
|
||||||||
Chain Drive Signal Transduction Specificity, Redundancy, and
Diversity*
(Received for publication, March 22, 1996)
From the a Gladstone Institute of Virology and Immunology, San Francisco, California 94141, Departments of g Medicine h Microbiology and Immunology, School of Medicine University of California, San Francisco, California 94143, and e Laboratory of Biochemistry and Metabolism, NIDDK, National Institutes of Health, Bethesda, Maryland 20892
To explore the basis for interleukin (IL)-2
receptor (IL-2R) signaling specificity, the roles of tyrosine-based
sequences located within the cytoplasmic tails of the
and
c chains were examined in the murine helper T cell line
HT-2. Activation of the Janus kinase/signal transducer and activator of
transcription (JAK/STAT) pathway, cellular proliferation, and the
induction of various genes were monitored. All four of the cytoplasmic
tyrosine residues as well as the distal portion of the
c
proved dispensable for the entire spectrum of IL-2R signaling responses
studied. Conversely, select tyrosine residues within the
chain were
essential and differentially required for various signaling events.
Specifically, activation of c-fos gene expression was found
to occur exclusively through the most membrane proximal tyrosine,
Tyr-338, whereas proliferation and the activation of STAT-5 were
induced either through Tyr-338 or through the two C-terminal tyrosine
residues, Tyr-392 and Tyr-510. These tyrosine residues mediated the
induction of two different STAT-5 isoforms, which were found to form
heterodimers upon receptor activation. In contrast to the tyrosine
dependence of c-fos and STAT-5 induction, bcl-2
gene induction proceeded independently of all IL-2R
tyrosine
residues. Thus, the tyrosine-based modules present within the IL-2R
cytoplasmic tail play a critical role in IL-2R signaling, mediating
specificity, redundancy, and multifunctionality.
A select group of cytokines is responsible for coordinating a
diverse array of biologic responses including hematopoiesis,
neurological development, and control of the immune system.
Understanding the molecular mechanisms by which such a limited number
of cytokines regulate a variety of cellular responses has remained a
central goal in the field of signal transduction (1). Cytokines act by
binding to specific cell surface receptors, many of which are members
of a single receptor superfamily (2). One striking feature of this
cytokine receptor superfamily is the shared use of common receptor
subunits to generate combinatorial diversity. For example, the
interleukin (IL)1-2 receptor is composed of
three subunits,
,
, and
(reviewed in Ref. 3). The
and
chains are shared by the IL-15 receptor, while the
subunit also
participates in the formation of the IL-4, -7, and -9 receptors (thus
termed
c for ``
common'') (4, 5, 6, 7). Since most immune
cells express receptors for multiple cytokines, signal integrity must
somehow be preserved despite the use of overlapping signal transduction
systems.
Considerable evidence has emerged supporting the view that cytokine receptors are composed of a series of functional signaling ``modules.'' At the level of the entire multimeric receptor, each individual subunit may be considered a distinct module, potentially serving a specialized function within the overall receptor complex. Moreover, individual receptor subunits contain within their cytoplasmic domains combinations of functional peptide sequences that link the receptor to a distinct array of intracellular signaling pathways. For example, the particular sequence surrounding receptor tyrosine residues may impart specificity by permitting the docking of particular SH2- or PTB-containing proteins (8, 9) such as ``signal transducer and activator of transcription'' (STAT) proteins (10). Ultimately, the combinatorial effects of these modular domains help to generate an integrated signal from the receptor that is unique to each cytokine.
The IL-2/IL-2 receptor (IL-2R) system exhibits the hallmark pleiotropy
of the cytokine family. Studies dissecting the functional role of the
IL-2R have yielded valuable information pertaining to the general
principles underlying cytokine signaling. First, chimeric receptors
have been employed to demonstrate that heterodimerization of receptor
subunits is critical for signal transduction (11, 12, 13). For example,
when the extracellular domains of the
and
c chains
are replaced with the erythropoietin (EPO) receptor extracellular
domain and expressed in IL-2-dependent T cells,
co-expression of these chimeric receptors is necessary to recapitulate
IL-2 signaling in response to EPO (11, 14). Similar results have been
obtained with other chimeric signaling systems (12, 13). Moreover,
since the IL-15 receptor also contains the IL-2R
and
c chains (7), these chimeras presumably also reflect
signaling mechanisms induced by this cytokine.
A second principle that applies generally to cytokine receptors is the
physical association of the receptor subunits with members of the Janus
family of tyrosine kinases (JAKs, reviewed in Ref. 15). The IL-2R
and
c subunits bind to JAK1 and JAK3, respectively
(16, 17, 18, 19); upon heterodimerization of the receptor by ligand, both the
JAKs and the receptor subunits themselves become
tyrosine-phosphorylated (14, 20, 21). JAK1 and JAK3 phosphorylation is
associated with an increase in their enzymatic activities (15), while
phosphorylation of the IL-2R subunits creates binding sites for
cytoplasmic effector molecules. For example, the signaling adapter Shc
has been shown to associate with the IL-2R
chain through a single
tyrosine residue, Tyr-338 (22). In addition, phosphorylation and
nuclear transport of the STAT factor STAT-5 is dependent upon tyrosine
residues located in the IL-2R
chain (23, 24, 25, 26, 27, 28).
Although heterodimerization of
and
c is necessary
for IL-2R signaling, studies examining the relative contributions of
the individual subunits have suggested that the
c
subunit may play a more limited role in this signaling cascade. For
example, all four of the tyrosine residues of
c are
dispensable for both proliferation and STAT-5 activation (11, 23).
Further recent studies have revealed that the entire
c
chain and its associated JAK3 molecule can be replaced by a
heterologous receptor that binds JAK2 without apparent disruption of
IL-2-specific signaling (14). These observations suggest that
and
c contribute quite differently to the IL-2 signaling
program, with
c acting mainly to trigger the signaling
cascade, while
serves to drive signaling specificity. However, it
is possible that some as yet unstudied downstream signaling events
might be more dependent on the
c chain.
In the present report, the participation of the
c and
chains in determining specificity in both early and downstream IL-2
signaling pathways has been defined in detail. In particular, these
studies assigned the molecular basis of signal transduction specificity
largely to individual tyrosine-containing peptides within the
cytoplasmic portion of the IL-2 receptor
chain. The findings
strongly support a separation of function between IL-2R
and
c within the receptor complex, and reveal that the
tyrosine residues of IL-2R
exhibit a high degree of specificity as
well as multifunctionality in coupling to various signaling
pathways.
The cell line HT-2, an
IL-2-dependent murine helper T cell line (ATCC) was
cultured in RPMI, 10% fetal bovine serum, antibiotics, and either 1 n human IL-2 (Chiron) or 5 units/ml erythropoietin (EPO,
Amgen) as described previously (11). HT-2EPO
-containing cell lines
were generated by transfecting HT-2EPO
cells by electroporation and
selecting stable transfectants by limiting dilution either in
hygromycin B (Boehringer Mannheim) and G418 (Life Technologies, Inc.)
as described previously (29) (HT-2EPO
YF:1Y, HT-2EPO
YF:234Y,
HT-2EPO
YF:5Y, HT-2EPO
YF:6Y cell lines) or in 5 units/ml EPO
(HT-2EPO
YF:1Y, EPO
YF:5Y, EPO
YF:6Y, HT-2EPO
YF:56Y,
HT-2EPO
YF:1234Y cell lines). No significant phenotypic differences
were observed between cell lines generated by selection in
G418/hygromycin B versus
EPO.2
For immunoprecipitations and nuclear extract preparation, cells were incubated for 2-4 h in RPMI with antibiotic and 1% bovine serum albumin (fraction V, Sigma) without growth factor as described previously (23). For RNA analyses, cells were incubated for 15 h in RPMI with antibiotic and 10% fetal bovine serum (Life Technologies, Inc.) in the absence of growth factor. Cells were stimulated for the indicated time intervals in 5-20 ml of the appropriate medium plus growth factor: IL-2 (10 n), murine IL-4, (100 units/ml, Genzyme), human EPO (50-100 units/ml).
Plasmid ConstructsAll receptor cDNAs were subcloned
into the expression vectors pCMV4 or pCMV4neo (29). Tyrosine
substitution mutants in the IL-2R
chain were created as described
previously (29). These mutations were transferred into the pEPO
neo
backbone by replacing the AflII/BamHI fragment
within the cytoplasmic tail of EPO
with an equivalent fragment
containing the
YF:1Y,
YF:234Y,
YF:5Y or
YF:6Y,
YF:56Y,
and
YF:1234Y (formerly
YF:56F) (11) mutations. Mutations were
confirmed by sequencing. The pME18 s-STAT-5A and pME18s-STAT-5B
constructs were generously provided by Dr. A. Mui (30).
Cytoplasmic RNA
was prepared from 1-2 × 107 cells using an RNeasy
mRNA kit (Qiagen) and quantified by UV spectrophotometry.
Denaturing gels were run with 10 µg of RNA/lane and blotted to Zeta
Probe membranes (Bio-Rad) as described elsewhere (31). Hybridization
was at 42 °C for 12-16 h. Probes were random prime-labeled using a
Megaprime labeling kit (Amersham Corp.) and [
-32P]dATP
and [
-32P]dCTP (Amersham Corp.). The
glyceraldehyde-3-phosphate dehydrogenase (GAPD) cDNA was from ATCC
(32), the c-fos cDNA was provided by Dr. I. Verma, and
the bcl-2 cDNA was provided by Dr. S. Korsmeyer. DNA
fragments used to label probes were as follows: a 1.2-kb
HindIII/KpnI fragment of the extracellular murine
EPO receptor, a 2.1-kb EcoRI murine c-fos
cDNA fragment from pMc-fos (33), a 0.9-kb PstI murine
bcl-2 fragment from pBS-bcl-2 (34), and a 1.0-kb
EcoRI fragment from GAPD.
Nuclear
extractions and EMSA were performed using the Fc
RI oligonucleotide
as described previously (23, 35). Antibody supershifts were performed
by preincubating nuclear extracts with 1 µl of STAT-5A or STAT-5B
antisera (see below), 3 µg of 4G10 (anti-phosphotyrosine), or 3 µg
of MOPC195 (IgG2b control) antibodies for 30 min on ice prior to the
binding reaction.
COS-7 cells (ATCC) were transfected with the indicated plasmids using Lipofectamine (Life Technologies, Inc.) per the manufacturer's instructions. Nuclear extracts were prepared from 1-2 million transfected cells as described previously (35).
ImmunoprecipitationsCells were lysed (1% Nonidet P-40, 150 m NaCl, 20 m Tris, pH 8.0, 50 m NaF, 100 u sodium orthovanadate, 1 m phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 10 µg/ml aprotinin, 1 µg/ml pepstatin A) and immunoprecipitated with 1 µl of anti-STAT-5A, anti-STAT-5B, or anti-JAK1 antiserum (Upstate Biotechnology, Inc.) per 20-30 million cells using protein A-agarose (Boehringer Mannheim). Immunoblotting studies were performed with anti-phosphotyrosine antibody (4G10, Upstate Biotechnology) or anti-STAT-5A or anti-STAT-5B followed by enhanced chemiluminescence (ECL) (Amersham Corp.) signal development.
Proliferation AssaysConventional 48-h [3H]thymidine incorporation assays and transient proliferation assays were performed as described previously (29). Data are expressed as a percentage of [3H]thymidine incorporation of cells treated with 10 n IL-2.
AntibodiesAnti-STAT-5A and anti-STAT-5B antibodies were generated in rabbits against the C-terminal peptides specific for mouse STAT-5A (LDARLSPPAGLFTSARSSLS) or mouse STAT-5B (MDSQWIPHAQS), and were used 1:50,000 in Western blotting and 1 µl/500 µg in immunoprecipitations.
Role of the IL-2R
and
c Tyrosine Residues in
Downstream Signaling Events
All facets of IL-2R signaling
examined thus far appear to require heterodimerization of the IL-2R
and
c chains; however, the relative contributions of
these individual subunits to specific signaling processes may be
distinct. In order to explore the functions of these chains in an
IL-2-responsive cellular environment, this laboratory has developed a
chimeric receptor system in which the extracellular domain of the EPO
receptor (EPOR) is fused to the cytoplasmic domains of the IL-2R
and
c chains, thus forming EPO
and EPO
(Fig.
1A). When expressed in
IL-2-dependent helper HT-2 cells, EPO stimulation
recapitulates all IL-2-mediated signaling events so far examined (11,
14, 23). In the present studies, a series of mutant tyrosine constructs
were created to delineate the role of individual IL-2R
tyrosine
residues in IL-2R signaling (Fig. 1A). These constructs were
introduced into HT-2EPO
cells (11), and receptor gene expression in
the stable transfectants was assessed by RNA blotting analysis to
identify positive clones for further study. Relative levels of EPO
and EPO
mRNA were approximately equivalent in all clones,
indicative of similar expression levels of receptors (data not shown).
As observed previously (11), the wild type HT-2EPO
cells
(
WT) exhibited a vigorous proliferative dose response to
EPO (Fig. 1B, panels 1-6), whereas the
HT-2EPO
YF/
cells failed to proliferate (Fig. 1B,
panels 3-6). HT-2 cell lines expressing either the two most
distal tyrosines of
(EPO
YF:56Y/
, panel
2) or the first four membrane-proximal tyrosines of
(EPO
YF:1234Y/
, panel 1) both showed a
strong proliferative response to EPO and could support long term growth
in EPO. Moreover, certain cell lines expressing a single
tyrosine
residue, EPO
YF:1Y/
, EPO
YF:5Y/
, or EPO
YF:6Y/
,
supported proliferation and long term growth comparably to those
expressing wild type EPO
(panels 3, 5, and
6). Finally, cells expressing EPO
YF:234Y/
did not
proliferate significantly or support long term growth in EPO (Fig.
1B, panel 4). It is not clear whether or not the
minor variations in proliferation among the EPO
, EPO
YF:1Y,
EPO
YF:5Y, and EPO
YF:6Y cell lines represent important
differences, and we do not attempt to draw quantitative conclusions
from these data. In conclusion, these experiments indicate that HT-2
cellular proliferation depends on select tyrosines within the IL-2R
chain, namely 1Y, 5Y, or 6Y, which are functionally independent of one
another. Moreover, the specific tyrosines capable of supporting
proliferation only partially overlap with those found to be important
in a pro-B cell line, Ba/F3 (11), indicating that IL-2 signaling in T
cells may differ in certain ways from that in pro-B cells (see
``Discussion'').
chain can support proliferation signaling.
HT-2EPO
, HT-2EPO
YF/
, HT-2EPO
YF:1Y/
,
HT-2EPO
YF:234Y/
, HT-2EPO
YF:5Y/
, HT-2EPO
YF:6Y/
,
HT-2EPO
YF:1234Y/
, and HT-2EPO
YF:56Y/
cells were stimulated
for 48 h with EPO at the indicated concentrations. Cells were
pulsed with [3H]thymidine for the final 4 h of the
culture and harvested. Results are expressed relative to the level of
incorporation occurring with stimulation in 10 n IL-2
(100%). Each data point is the mean of triplicates, and is
representative of three experiments. C, a single tyrosine
residue within IL-2R
is sufficient for growth signaling in the
absence of
c tyrosine residues. HT-2EPO
(left
panel) or HT-2EPO
YF (right panel) cells were
transiently transfected with the EPO
YF, EPO
YF:1Y, or EPO
(
WT) constructs as described previously (29), and
[3H]thymidine incorporation was measured at the indicated
time points after transfection. Each data point is the mean of
triplicates, and is representative of four experiments.
Prior studies have shown that the EPO
/
YF-expressing cell lines
proliferate in response to EPO equivalently to cells expressing wild
type EPO
receptors (11). Combined with the data presented above
(Fig. 1B), it appeared that a single tyrosine residue of the
IL-2R
chain was sufficient to support growth signaling. However, it
remained formally possible that tyrosines of the
c chain
could play a compensatory role in the context of a mutant
chain
containing only a single tyrosine residue. Therefore, the ability of
the IL-2R
tyrosine mutants to proliferate when paired with a
c chain lacking all of its cytoplasmic tyrosine residues
(EPO
YF) was assessed. As shown in Fig. 1C, both EPO
and EPO
YF:1Y induced proliferation equally well when transiently
transfected into HT-2EPO
cells and HT-2EPO
YF cells, whereas
EPO
YF failed to mediate the proliferative response in either case.
Similar results were obtained for the EPO
YF:5Y and the EPO
YF:6Y
(data not shown). Therefore, a single tyrosine residue in the
chain
of the IL-2 receptor complex is both necessary and sufficient to
support proliferation signaling in HT-2 cells.
A second important outcome of
IL-2R signaling is the induced expression of a number of specific genes
(36, 37). To assess the relative roles of the
and
c
subunits in gene induction, cells expressing various combinations of
mutant receptors were stimulated for varying lengths of time.
Cytoplasmic RNA was analyzed by Northern blotting with probes to the
c-fos and bcl-2 proto-oncogenes (33, 34). As
shown in Fig. 2A, EPO stimulation of
HT-2EPO
cells induced expression of these genes with reproducible
and characteristic time courses (lanes 5-8), whereas EPO
stimulation of HT-2 cells failed to induce these genes (lanes
1-4). To assess the role of the
c tyrosine
residues and distal tail in induction of these genes, HT-2EPO
/
YF
or HT-2EPO
/
336 cells were examined. These cell lines were found
to induce transcription of both c-fos and bcl-2
identically to the wild type controls (Fig. 2A, lanes
9-16). Thus, neither the tyrosine residues nor the distal 35 amino acids of the
c chain appear necessary for the
induction of c-fos or bcl-2 in this cellular
context.
c chain is not
required to specify activation of the bcl-2 and
c-fos proto-oncogenes. HT-2, HT-2EPO
,
HT-2EPO
/
YF, HT-2EPO
/
336, HT-2EPOR(1-321), and
HT-2EPO
/EPOR(1-321) cells were incubated in media without growth
factor for 15 h and stimulated with 50 units/ml EPO for 0, 30, 60 min or 9 h, as indicated. Total cellular RNA was prepared,
separated by Northern blotting, and probed with bcl-2,
c-fos or GAPD cDNA probes. B, a single
tyrosine residue of the IL-2R
chain is necessary and sufficient for
induction of c-fos gene expression. HT-2EPO
,
HT-2EPO
YF/
, HT-2EPO
YF:1234Y/
, HT-2EPO
YF:1Y/
,
HT-2EPO
YF:234Y/
, HT-2EPO
YF:56Y/
, HT-2EPO
YF:5Y/
, and
HT-2EPO
YF:6Y/
cells were stimulated with EPO as described in
A. Total cellular RNA was separated by Northern blotting and
probed with c-fos and GAPD cDNA probes. C,
induction of bcl-2 gene expression occurs via a
tyrosine-independent pathway. HT-2EPO
, HT-2EPO
YF/
,
HT-2EPO
YF:1234Y/
, HT-2EPO
YF:1Y/
, HT-2EPO
YF:234Y/
,
HT-2EPO
YF:56Y/
, HT-2EPO
YF:5Y/
, and HT-2EPO
YF:6Y/
cells were stimulated with EPO as described in A. Total
cellular RNA was prepared, separated by Northern blotting, and probed
with bcl-2 and GAPD cDNA probes.
To determine whether any other portion of the
c chain
was required for the induction of these genes, EPO
was replaced with
a truncated version of the erythropoietin receptor, EPOR(1-321), that
contains no tyrosine residues (14). Stimulation of cells expressing
EPOR(1-321) alone failed to induce transcription of the
c-fos or bcl-2 genes (Fig. 2A,
lanes 17-20). In contrast, co-expression of EPOR(1-321)
with a wild type EPO
chain induced expression of these genes that
was indistinguishable from cells expressing wild type EPO
(lanes 21-24). Thus,
c can be replaced
entirely with a heterologous receptor subunit with no apparent change
in downstream activation of a variety of IL-2-induced genes. These data
further indicate that JAK3, which binds to
c (16, 17),
can be replaced by JAK2, which binds to the EPOR (38), without altering
signaling specificity from the IL-2 receptor.
Since the tyrosine residues within the
c chain appeared
to provide no detectable specificity to the IL-2 signaling program, the
role of the six tyrosine residues within the cytoplasmic tail of the
IL-2R
chain was examined. HT-2EPO
cells expressing the EPO
tyrosine addback constructs (Fig. 1A) were stimulated, and
Northern blots were prepared. As illustrated in Fig. 2B,
c-fos induction was dependent on tyrosine-containing
sequences in the
chain, since HT-2EPO
YF/
cells failed to
induce these genes in response to receptor activation (Fig.
2B, lanes 5-8). Indeed, c-fos
transcription was linked to a single tyrosine residue, as only EPO
constructs that retain the most membrane proximal tyrosine, Y1
(Tyr-338), supported its transcriptional induction (Fig. 2B,
lanes 9-16). Thus, a single tyrosine residue within
IL-2R
is critical for the induction of c-fos. These data
further indicate that the mechanism of c-fos induction is
likely to occur via pathways linked to Shc, an adapter molecule we have
previously shown to be exclusively engaged by the first tyrosine
(Tyr-338) of the IL-2R
chain (22).
In contrast to the regulation of c-fos, the induced
expression of the bcl-2 proto-oncogene was found to be
independent of tyrosine residues. All
mutants examined, including a
mutant lacking all six cytoplasmic tyrosine residues (HT-2EPO
YF),
induced bcl-2 transcription in response to ligand (Fig.
2C). Thus, at least one downstream signaling event is
independent of tyrosine residues within the IL-2 receptor, while others
are governed by individual tyrosines.
Role of the IL-2R
Tyrosine Residues in Proximal Signaling
Events
Proliferation and gene induction are both
relatively late events in signaling through the IL-2R. One of the best
characterized signaling pathways initiated rapidly upon receptor
ligation is the phosphorylation of the Janus kinases JAK1 and JAK3 (18,
19), followed by the activation of STAT factors (23, 24, 25, 26, 27, 28, 39). To assess
the role of tyrosine residues within the IL-2R
chain in Janus kinase
activation, cells expressing tyrosine mutant EPO
chains were
stimulated with EPO or IL-2 as a positive control, and JAK1
immunoprecipitates were prepared for immunoblotting with 4G10
anti-phosphotyrosine antibodies. As shown in Fig. 3,
stimulation of all of the EPO
tyrosine mutant cell lines led to
phosphorylation of JAK1 (top panel). The blots were stripped
and reprobed with anti-JAK1 antibodies to ensure equivalent loading of
the gels (bottom panel). These results were consistent with
the previous demonstration that JAK1 and JAK3 activation is independent
of IL-2R
tyrosine residues (data not shown) (11). The slight
differences in relative JAK1 induction among cell lines may reflect
variations in either endogenous JAK1 levels and/or receptor expression.
However, it should be noted that these results serve as independent
confirmation that each of the mutant tyrosine receptors is expressed at
the cell surface and is capable of initiating signaling.
tyrosine residues. HT-2EPO
,
HT-2EPO
YF:1Y/
, HT-2EPO
YF:234Y/
,
HT-2EPO
YF:5Y/
, and HT-2EPO
YF:6Y/
cells were incubated
in the absence of growth factor for 4 h and stimulated for 15 min
with 50 units/ml EPO (E) or 10 n IL-2
(2). JAK1 immunoprecipitates were prepared, immunoblotted
with anti-phosphotyrosine (4G10) antibodies (top) or
stripped and reprobed with anti-JAK1 antibodies (bottom),
and visualized by ECL. Arrows indicate JAK1. Migration of
molecular weight markers is indicated in top panel.
STAT-5 Activation
One consequence of Janus kinase activation
in the IL-2 receptor system is the phosphorylation, nuclear import, and
DNA binding activity of several STAT factors, notably factors related
to STAT-5 (23, 24, 25, 26, 27, 28, 40). In particular, stimulation of either native or
chimeric IL-2 receptors expressed on HT-2 cells induces a nuclear DNA
binding complex that is recognized by antibodies raised against sheep
STAT-5/MGF (23). We examined the nature of the DNA binding complex in
more detail than has been previously described. In particular, two
murine isoforms of STAT-5 (STAT-5A and STAT-5B) have been identified
recently that differ at their C termini from the originally identified
sheep STAT-5/MGF (30, 41). Antibodies were raised against the unique,
C-terminal portions of STAT-5A and STAT-5B. These antisera exhibited no
detectable cross-reactivity by immunoblotting of cell lysates from
COS-7 cells expressing either STAT-5A or STAT-5B alone (Fig.
4A). To evaluate the specificity of these
antibodies in EMSA, either STAT-5A or STAT-5B was expressed with JAK1
in COS7 cells to permit constitutive, receptor-independent
phosphorylation of the STATs in an overexpression system. Nuclear
extracts were prepared from transfected COS7 cells, and an EMSA was
performed using an oligonucleotide corresponding to the Fc
RI STAT
response element (39) as described previously (23). JAK1 overexpression
in COS7 cells resulted in a DNA binding complex that represents
endogenous STAT-1 (Fig. 4B, lane 4, and data not
shown). However, when JAK1 was co-expressed with STAT-5A or STAT-5B,
DNA binding complexes were observed that co-migrated with STAT-5.
Importantly, addition of anti-STAT-5A and -5B antisera to the EMSA
reaction caused selective supershifting of their respective DNA binding
complexes, as demonstrated by the appearance of a slower migrating
complex present at the top of the gel (Fig. 4B, lanes
9, 10, 15, 16, 19, and
20), and these supershifted bands were accompanied by a
corresponding diminution of the original DNA binding complexes. The
anti-STAT-5A antiserum caused such a supershift only in extracts from
STAT-5A transfectants, and the anti-STAT-5B antiserum caused a
supershift only in extracts from STAT-5B transfectants. In addition, a
nonspecific (NS) reactivity was present in the anti-STAT-5A
and -5B antisera that was also found in preimmune sera (Fig.
5, lanes 5 and 6), but the bands
representing specific supershifts are nonetheless diagnostic for the
presence of STAT-5A or -5B.
RI STAT-response
element (GTATTTCCCAGAAAAAGGAC) (39). Nuclear extracts were incubated on
ice with 1 µl of anti-STAT-5A (5A, lanes 9,
14, and 19), 1 µl of anti-STAT-5B
(5B, lanes 10, 15, and 20),
3 µg of 4G10 (PY, lanes 11, 16, and
21), or 3 µg of MOPC195 IgG2b control antibodies
(C, lanes 12, 17, and 22)
for 30 min prior to EMSA. The top arrow indicates
supershifted bands, and the bottom arrow indicates STAT-5
DNA binding complexes. Endogenous represents a STAT-1 DNA
binding activity that appears constitutively in the presence of JAK1
overexpression (data not shown). C, IL-2R signaling induces
both STAT-5A and STAT-5B in HT-2 cells. HT-2 cells were incubated in
the absence of IL-2 for 2 h and stimulated for 15 min with 10 n IL-2 (2) (lanes 2-4) or 100 u/ml
murine IL-4 (4) (lanes 5-7), and nuclear
extracts were prepared as described in B. Nuclear extracts
were incubated with 1 µl of anti-STAT-5A (lanes 3 and
6) or anti-STAT-5B (lanes 4 and 7) for
45 min on ice prior to EMSA. Arrows indicate STAT-5 and
STAT-6; NS, nonspecific band. D, IL-2 induces
heterodimerization of STAT-5A and STAT-5B in HT-2 cells. HT-2EPO
cells were stimulated with EPO as described in C, and
cellular lysates were immunoprecipitated with 1µl anti-STAT-5B.
Immunoprecipitates were separated by 8.75% polyacrylamide gel
electrophoresis, immunoblotted with anti-STAT-5A, anti-phosphotyrosine
(PTyr, 4G10), or anti-STAT-5B antibodies as indicated.
c chain can be replaced
with a heterologous receptor subunit in STAT-5A/B induction.
HT-2EPO
/EPOR(1-321) cells were stimulated with EPO (E)
and nuclear extracts subjected to EMSA as described in Fig.
4B. Nuclear extracts were also incubated with 1 µl of
specific preimmune serum (PIS) for 30 min on ice prior to
EMSA (lanes 5 and 6). The top arrow
indicates the supershifted band, and the bottom arrow
indicates STAT-5. NS, nonspecific DNA binding complex.
In order to determine precisely which STAT-5 homologue(s) were induced by IL-2 in T cells, HT-2 cells were stimulated with IL-2 or IL-4 as a negative control and EMSA was performed as described in Fig. 4B. As shown in Fig. 4C, the IL-2-induced DNA binding complex reacted with both antisera specific for either STAT-5A or STAT-5B by causing a diminution in the DNA binding complex with a corresponding appearance of a specific supershift at the top of the gel (Fig. 4C, lanes 3 and 4). These findings imply that the IL-2R mediates the induction of both STAT-5A and STAT-5B, consistent with previous observations in the IL-3R system (30). This reactivity was not observed with preimmune sera from the same animals (Fig. 5, lanes 5 and 6), nor were IL-4-induced DNA binding complexes containing STAT-6 affected in this way (Fig. 4C, lanes 6 and 7). The finding that virtually the entire DNA binding complex induced by IL-2 in HT-2 cells was competed with anti-STAT-5A antibodies suggested that all of the DNA binding complexes contained STAT-5A (Fig. 4C, lane 3). However, the fact that only a partial supershift of the complex was achieved with anti-STAT-5B (Fig. 4C, lane 4) argued that the nucleoprotein complexes represented a combination of STAT-5A homodimers and STAT-5A/STAT-5B heterodimers.
To assess directly whether signaling through the IL-2R induces
heterodimerization of STAT-5A and -5B, lysates from uninduced or
EPO-induced HT-2EPO
cells were immunoprecipitated with
anti-STAT-5B antibodies and immunoblotted with anti-STAT-5A antisera.
As shown in Fig. 4D, the presence of STAT-5A was
dramatically increased in anti-STAT-5B immunoprecipitates following
induction of the IL-2R, indicating that STAT-5B and STAT-5A form
heterodimers primarily after stimulation (panel 1). The low
level of background bands seen in the uninduced cells may suggest that
some STAT-5A and STAT-5B molecules are preassociated prior to receptor
stimulation, but this association is significantly and reproducibly
enhanced upon ligation of the receptor. Since dimerization of STAT
factors is dependent on reciprocal SH2/phosphotyrosine interactions
(39), the phosphorylation status of the STAT-5B immunoprecipitates was
assessed by stripping the blot and re-probing with anti-phosphotyrosine
antibodies. Indeed, STAT-5B was found to be phosphorylated only after
EPO stimulation (Fig. 4D, panel 2). Finally,
efficient immunoprecipitation of STAT-5B was confirmed by stripping and
reprobing the blot with anti-STAT-5B (Fig. 4D, panel
3). Of course, these data do not rule out the possibility that
STAT-5A and STAT-5B homodimers are also present in the DNA binding
complexes in addition to the STAT-5A/B heterodimers. Nevertheless,
IL-2R stimulation induces the DNA binding activities of both STAT-5A
and STAT-5B, involving the formation of heterodimers (and possibly
homodimers) in vivo.
Neither the Four Cytoplasmic Tyrosine Residues of
c
nor JAK3 Are Required for STAT-5A/B Induction
Previous studies have demonstrated that a truncated EPO receptor
(EPOR(1-321)) is capable of functionally substituting for EPO
in
the IL-2 receptor complex, even though it physically associates with
and activates JAK2 rather than JAK3 (Fig. 2A) (14, 38). To
determine whether the
c chain exerts any influence on
the specific composition of the DNA binding complex induced by the
IL-2R, supershift analyses were performed with nuclear extracts
prepared from HT-2EPO
/EPOR(1-321) cells. Consistent with previous
observations, STAT-5A and -5B were both significantly induced in
HT-2EPO
/EPOR(1-321) cells (Fig. 5), indicating heterodimer
formation. In addition, STAT-5A and STAT-5B heterodimers were also
induced in HT-2EPO
/
YF and HT-2EPO
/
336 cells (data not
shown). These results confirmed that the
c chain plays
no role in determining the specificity of the STAT-5 isoform induced
following ligation of the IL-2R, and that JAK3 can be replaced with
JAK2 in the receptor complex without adverse functional effects in the
activation of select STAT factors.
Specific Tyrosine Residues of the IL-2R
Chain Regulate STAT-5A/B
Induction
Since tyrosine residues within the
c subunit failed
to specify STAT-5A/B induction (Fig. 5) (23), studies were performed to
delineate the role of the IL-2R
chain in this process. Previous
studies have established that one or more tyrosine residues of the
IL-2R
are required for STAT-5 activation, because a mutant IL-2R
chain lacking all cytoplasmic tyrosine residues failed to induce STAT-5
DNA binding activity in HT-2 cells (23). The abilities of the EPO
tyrosine reconstitution mutants to activate STAT-5A and -5B were
therefore tested in EMSA. Consistent with prior in vitro
peptide competition data (23, 26), HT-2 cells expressing either of the
two C-terminal tyrosine residues (EPO
YF:5Y/
or EPO
YF:6Y/
)
each induced STAT-5A and STAT-5B in response to EPO (Fig.
6, lanes 7 and 10). Furthermore,
supershift analyses suggested that typical STAT-5A/B heterodimers were
assembled via these receptors (Fig. 6, lanes 12-17). In
contrast, HT-2EPO
YF:234Y/
cells failed to induce significant
STAT-5A/B DNA binding activity, despite the activation of Janus kinases
in these cells (Fig. 3). Unexpectedly, HT-2 cells expressing
EPO
YF:1Y/
also proved competent to activate STAT-5A/B (Fig. 6,
lane 2). The relatively higher levels of STAT-5 induction by
the EPO
YF:1Y cell line as compared to the EPO
YF:5Y and
EPO
YF:6Y cell lines shown in this gel were not consistently
observed; thus all three mutants appear to activate STAT-5A/B roughly
equivalently. In addition, EPO
YF:1Y induced both STAT-5A/B in cells
expressing EPO
YF, indicating that
c tyrosine residues
do not exhibit a compensatory function for absent IL-2R
residues
(data not shown). These results underscore both redundancy and
specificity within the IL-2R system, since STAT-5A/B can be activated
through three different tyrosine residues but not by three other
cytoplasmic tyrosines.
chain induce STAT-5A/5B in HT-2 cells. HT-2EPO
YF:1Y/
,
HT-2EPO
YF:234Y/
, HT-2EPO
YF:5Y/
, and HT-2EPO
YF:6Y/
cells were stimulated with 50 units/ml EPO (E) (lanes
2, 4, 7, 10, and
12-17) or 10 n IL-2 (2)
(lanes 5, 8, and 11) and nuclear
extracts subjected to EMSA and antibody competitions performed as
described in Fig. 4B.
One of the paradoxes in cytokine receptor signal
transduction is that a high degree of signaling specificity is achieved
even though receptor subunits and intracellular signaling intermediates
are shared among multiple receptor types. In this regard, the
c subunit corresponds to a relatively short chain that
participates in the IL-2, -4, -7, -9, and -15 receptors (4, 5, 6, 7).
However,
c appears to confer no detectable specificity
to the IL-2 signaling program. Indeed, none of the four cytoplasmic
tyrosine residues within
c nor distal sequences within
the
c tail is required for effective signaling,
including proliferation, induction of the c-fos and
bcl-2 proto-oncogenes, or STAT-5A and -5B activation (Figs.
1C, 2A, and 5) (14). Furthermore, while JAK3 is
bound to proximal sequence elements in
c, this
cytoplasmic domain and Janus kinase can be replaced by a truncated form
of the erythropoietin receptor bound to JAK2 with no loss of signaling
specificity (Figs. 2A and 5) (14). Nevertheless,
c-associated JAK activity appears to be necessary for
native IL-2R signaling, since a dominant negative JAK3 mutant lacking
intrinsic kinase activity effectively disrupts signal transduction
(42). In addition, natural mutations of
c that abrogate
JAK3 binding lead to clinically significant immunodeficiencies (43).
Taken together, our present findings support the notion that
c plays an important role in the initiation of
transmembrane signaling but is likely dispensable for subsequent
execution and completion of specific signals. Accordingly, we have
suggested that
c and its associated JAK3 function as a
``trigger'' chain in the IL-2R complex (14).
In contrast, the subunits that pair with
c in the IL-2,
IL-4, IL-7, IL-9, and IL-15 receptors have relatively long cytoplasmic
domains that typically associate with multiple signaling intermediates.
For example, while the IL-2R
chain binds specifically to such
molecules as Shc and STAT-5 (22, 23, 24, 26, 27, 28), the IL-4R subunit binds
to STAT-6 (44, 45), thus specifying a very different signaling program.
The present findings provide further molecular evidence that these
longer subunits play a major role in driving the specificity of the
signaling program; thus, we have referred to this class of receptor
subunits as ``driver'' chains (14).
The findings reported here illustrate several
properties of the IL-2 receptor ``driver'' subunit, the IL-2R
chain, that characterize its mechanism of signaling. First, within the
IL-2R
chain, there are multiple functional, tyrosine-based peptide
modules that exhibit a high degree of specificity in coupling to
signaling pathways (summarized in Fig. 7B).
For example, the ability of an individual tyrosine residue to drive a
specific signal is manifested in the activation of c-fos
gene expression. Data presented here illustrate that Y1 (Tyr-338) is
uniquely required for inducing c-fos mRNA levels (Fig.
2B), while another recent study has shown that Y1 (Tyr-338)
is the only cytoplasmic tyrosine residue within IL-2R
that binds to
the Shc adapter molecule after IL-2R
phosphorylation (22). Taken
together, these observations suggest that c-fos is likely
induced via the Ras-Raf pathway that is activated by Shc (reviewed in
Ref. 46). These experiments have also shown that the c-fos
and STAT-5 pathways appear to be distinct. STAT-5 can be activated
through other tyrosine residues (Y5 (Tyr-392) and Y6 (Tyr-510)) that
fail to induce c-fos or bind Shc (Figs. 2B and 6)
(22). However, since both pathways are induced through an IL-2R
mutant that contains only Y1 (Tyr-338), these studies do not preclude
the possibility that STAT-5 activation is necessary but not sufficient
for AP-1 induction by this receptor (47).
tyrosine residues located in the
cytoplasmic tail. Conserved Box1 (1) and Box2 (2)
motifs are shaded (53), and relative positions of the six
tyrosine (Y) residues are indicated.
Second, in contrast to the selective activation of c-fos by
Y1 (Tyr-338), there is marked redundancy in the abilities of certain
tyrosine residues within IL-2R
to mediate other signaling events.
For example, Y1 (Tyr-338), Y5 (Tyr-392), and Y6 (Tyr-510) all promote
activation of STAT-5 nuclear import and DNA binding activity in HT-2
cells (Fig. 6), despite clear sequence differences in the amino acid
sequences flanking Tyr-338 and Tyr-392/Tyr-510 (Fig. 7A and
see below). Importantly, efficient STAT5A/5B heterodimerization is
induced via an IL-2R
mutant retaining a single STAT-binding motif,
indicating that the receptor does not necessarily form a multivalent
``platform'' to which multiple STATs are recruited simultaneously in
order to direct heterodimer or homodimer formation. Similar redundancy
among Y1 (Tyr-338), Y5 (Tyr-392), and Y6 (Tyr-510) is observed in the
activation of cellular proliferation (Fig. 1) (11), although STAT-5
activation and proliferation are probably independent events (23, 24).
The biological importance of such functional redundancy is unknown, but
it may allow for amplification of signaling, as has been demonstrated
for repetitive tyrosine-based motifs present in the T cell receptor
complex (48).
Third, the studies performed here indicate that individual
tyrosine-based motifs in the IL-2R
chain can serve multiple,
apparently independent functions. For example, as described above, Y1
(Tyr-338) couples both to a Shc-dependent pathway as well
as to the JAK-STAT pathway (Fig. 7B). Moreover, two isoforms
of STAT-5 are induced through single tyrosine residues, indicating at
least some potential for multifunctionality through these sequences.
Since both STAT-1 and STAT-3 have been implicated in IL-2 signaling in
other systems (26, 40), it is likely that more STAT factors may couple
to some or all of the receptor tyrosine residues.
Interestingly, no obvious function for the Tyr-234 (Tyr-355/Tyr-358/Tyr-361) tyrosine cluster has yet been detected in HT-2 cells. Although it is unknown whether the restriction of function of Tyr-234 occurs at the level of phosphorylation or at the level of binding to particular signaling intermediates, it is nonetheless clear that there is strict selectivity in which tyrosines are capable of mediating such events.
Finally, at least some signaling pathways are coupled to the IL-2R through a tyrosine-independent mechanism, as represented by induction of the proto-oncogene bcl-2. It has been previously shown that bcl-2 induction is independent of JAK3 activation (42), but the data presented here represent the first direct demonstration that bcl-2 induction is also independent of tyrosine residues within the IL-2 receptor. Further studies are needed to determine how tyrosine-independent pathways are initiated by cytokine receptors after receptor activation. Other studies with the growth hormone (GH) and erythropoietin receptor have suggested that receptor tyrosine residues are apparently not absolutely essential for activation of proliferation and the JAK-STAT pathway in these receptor systems (49, 50). It remains to be determined whether these observations represent a fundamental difference in the mechanism of signaling between the EPOR/GHR and the IL-2 receptors, or whether low levels of endogenous EPO and GH receptors might contribute to the observed functionality of the transfected receptor mutants.
Cell Context Specificity of STAT-binding MotifsAmong
cytokine receptors it is often possible to identify putative functional
``driver'' modules based on sequence alone, such as IRS-1- or
STAT-binding motifs (10, 44). The present studies reveal additional
complexities underlying STAT-5-activation motifs and the role of
additional cellular factors in permitting STAT activation. First, in
HT-2 cells, we have shown that two isoforms of STAT-5 (STAT-5A and -5B)
are induced by IL-2 stimulation through three different tyrosine
residues within IL-2R
(Figs. 4 and 6). Surprisingly, however,
although the sequences surrounding Y5 (Tyr-392) and Y6 (Tyr-510) are
quite similar to tyrosine motifs found in other STAT-5-inducing
receptors (D A Y L S/T L), the functionally redundant Y1 (Tyr-338) is
notably divergent from these in primary sequence (N Q G Y F F F) (Fig.
7A). Moreover, the context of the prolactin receptor
tyrosine residue that induces transcription through a STAT-response
element differs somewhat from these motifs (LDYLDPT) (51). Therefore,
STAT-5 appears to be activated through as many as three different
tyrosine-based sequences.
In addition, there appears to be an influence of cellular environment
on STAT-5 activation. First, in the pro-B/myeloid cell line Ba/F3, a
truncated IL-2R
chain retaining Y1 (Tyr-338) fails to activate
STAT-5 DNA binding, although it still maintains the ability to induce
cellular proliferation (24). These observations contrast with the
present observation that Y1 (Tyr-338) induces STAT-5A/B in
IL-2-dependent T cells (Fig. 6). Second, the effects of
point substitutions at Y1 (Tyr-338) on proliferation signaling appear
to vary depending on cellular context (11). Moreover, the EPOR can
induce STAT-5 only in certain cellular
contexts3 (52). These data suggest that the
type of cell chosen for receptor studies may be important in dissecting
specific consequences of cytokine signaling. In summary, a full
understanding of STAT-activation motifs and their functions in
different cellular environments will require further study.
In
summary, the present studies reveal that tyrosine-based sequences
located in the IL-2R
chain exhibit specificity, redundancy and
multifunctionality in regulating signaling events initiated by IL-2.
Since the signaling portion of IL-15 receptor contains both the
IL-2R
and
c chains (7), these findings probably apply
to this cytokine as well. It is likely that analogous modules in
``driver'' subunits within other receptor complexes also exhibit
these characteristics, and that the combinatorial association of
various modules within a receptor complex permits a diverse range of
biologic consequences. For example, some domains may have synergistic
or inhibitory influences on one another. A more complete understanding
of such interactions is essential to developing strategies to
manipulate these intracellular processes for clinical benefit.
We thank John Carroll and Amy Corder for excellent assistance in preparation of this manuscript. Recombinant IL-2 was a kind gift from the Chiron Corporation.