JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gaffen, S. L.
Right arrow Articles by Goldsmith, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gaffen, S. L.
Right arrow Articles by Goldsmith, M. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 271, Number 35, Issue of August 30, 1996 pp. 21381-21390
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

Distinct Tyrosine Residues within the Interleukin-2 Receptor beta  Chain Drive Signal Transduction Specificity, Redundancy, and Diversity*

(Received for publication, March 22, 1996)

Sarah L. Gaffen abc, Stephen Y. Lai ad, Michelle Ha ac, Xiuwen Liu ef, Lothar Hennighausen ef, Warner C. Greene afgh and Mark A. Goldsmith afgi

From the a  Gladstone Institute of Virology and Immunology, San Francisco, California 94141, Departments of g Medicine h Microbiology and Immunology, School of Medicine University of California, San Francisco, California 94143, and e Laboratory of Biochemistry and Metabolism, NIDDK, National Institutes of Health, Bethesda, Maryland 20892

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES


ABSTRACT

To explore the basis for interleukin (IL)-2 receptor (IL-2R) signaling specificity, the roles of tyrosine-based sequences located within the cytoplasmic tails of the beta  and gamma c chains were examined in the murine helper T cell line HT-2. Activation of the Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway, cellular proliferation, and the induction of various genes were monitored. All four of the cytoplasmic tyrosine residues as well as the distal portion of the gamma c proved dispensable for the entire spectrum of IL-2R signaling responses studied. Conversely, select tyrosine residues within the beta  chain were essential and differentially required for various signaling events. Specifically, activation of c-fos gene expression was found to occur exclusively through the most membrane proximal tyrosine, Tyr-338, whereas proliferation and the activation of STAT-5 were induced either through Tyr-338 or through the two C-terminal tyrosine residues, Tyr-392 and Tyr-510. These tyrosine residues mediated the induction of two different STAT-5 isoforms, which were found to form heterodimers upon receptor activation. In contrast to the tyrosine dependence of c-fos and STAT-5 induction, bcl-2 gene induction proceeded independently of all IL-2Rbeta tyrosine residues. Thus, the tyrosine-based modules present within the IL-2Rbeta cytoplasmic tail play a critical role in IL-2R signaling, mediating specificity, redundancy, and multifunctionality.


INTRODUCTION

A select group of cytokines is responsible for coordinating a diverse array of biologic responses including hematopoiesis, neurological development, and control of the immune system. Understanding the molecular mechanisms by which such a limited number of cytokines regulate a variety of cellular responses has remained a central goal in the field of signal transduction (1). Cytokines act by binding to specific cell surface receptors, many of which are members of a single receptor superfamily (2). One striking feature of this cytokine receptor superfamily is the shared use of common receptor subunits to generate combinatorial diversity. For example, the interleukin (IL)1-2 receptor is composed of three subunits, alpha , beta , and gamma  (reviewed in Ref. 3). The beta  and gamma  chains are shared by the IL-15 receptor, while the gamma  subunit also participates in the formation of the IL-4, -7, and -9 receptors (thus termed gamma c for ``gamma common'') (4, 5, 6, 7). Since most immune cells express receptors for multiple cytokines, signal integrity must somehow be preserved despite the use of overlapping signal transduction systems.

Considerable evidence has emerged supporting the view that cytokine receptors are composed of a series of functional signaling ``modules.'' At the level of the entire multimeric receptor, each individual subunit may be considered a distinct module, potentially serving a specialized function within the overall receptor complex. Moreover, individual receptor subunits contain within their cytoplasmic domains combinations of functional peptide sequences that link the receptor to a distinct array of intracellular signaling pathways. For example, the particular sequence surrounding receptor tyrosine residues may impart specificity by permitting the docking of particular SH2- or PTB-containing proteins (8, 9) such as ``signal transducer and activator of transcription'' (STAT) proteins (10). Ultimately, the combinatorial effects of these modular domains help to generate an integrated signal from the receptor that is unique to each cytokine.

The IL-2/IL-2 receptor (IL-2R) system exhibits the hallmark pleiotropy of the cytokine family. Studies dissecting the functional role of the IL-2R have yielded valuable information pertaining to the general principles underlying cytokine signaling. First, chimeric receptors have been employed to demonstrate that heterodimerization of receptor subunits is critical for signal transduction (11, 12, 13). For example, when the extracellular domains of the beta  and gamma c chains are replaced with the erythropoietin (EPO) receptor extracellular domain and expressed in IL-2-dependent T cells, co-expression of these chimeric receptors is necessary to recapitulate IL-2 signaling in response to EPO (11, 14). Similar results have been obtained with other chimeric signaling systems (12, 13). Moreover, since the IL-15 receptor also contains the IL-2Rbeta and gamma c chains (7), these chimeras presumably also reflect signaling mechanisms induced by this cytokine.

A second principle that applies generally to cytokine receptors is the physical association of the receptor subunits with members of the Janus family of tyrosine kinases (JAKs, reviewed in Ref. 15). The IL-2Rbeta and gamma c subunits bind to JAK1 and JAK3, respectively (16, 17, 18, 19); upon heterodimerization of the receptor by ligand, both the JAKs and the receptor subunits themselves become tyrosine-phosphorylated (14, 20, 21). JAK1 and JAK3 phosphorylation is associated with an increase in their enzymatic activities (15), while phosphorylation of the IL-2R subunits creates binding sites for cytoplasmic effector molecules. For example, the signaling adapter Shc has been shown to associate with the IL-2Rbeta chain through a single tyrosine residue, Tyr-338 (22). In addition, phosphorylation and nuclear transport of the STAT factor STAT-5 is dependent upon tyrosine residues located in the IL-2Rbeta chain (23, 24, 25, 26, 27, 28).

Although heterodimerization of beta  and gamma c is necessary for IL-2R signaling, studies examining the relative contributions of the individual subunits have suggested that the gamma c subunit may play a more limited role in this signaling cascade. For example, all four of the tyrosine residues of gamma c are dispensable for both proliferation and STAT-5 activation (11, 23). Further recent studies have revealed that the entire gamma c chain and its associated JAK3 molecule can be replaced by a heterologous receptor that binds JAK2 without apparent disruption of IL-2-specific signaling (14). These observations suggest that beta  and gamma c contribute quite differently to the IL-2 signaling program, with gamma c acting mainly to trigger the signaling cascade, while beta  serves to drive signaling specificity. However, it is possible that some as yet unstudied downstream signaling events might be more dependent on the gamma c chain.

In the present report, the participation of the gamma c and beta  chains in determining specificity in both early and downstream IL-2 signaling pathways has been defined in detail. In particular, these studies assigned the molecular basis of signal transduction specificity largely to individual tyrosine-containing peptides within the cytoplasmic portion of the IL-2 receptor beta  chain. The findings strongly support a separation of function between IL-2Rbeta and gamma c within the receptor complex, and reveal that the tyrosine residues of IL-2Rbeta exhibit a high degree of specificity as well as multifunctionality in coupling to various signaling pathways.


MATERIALS AND METHODS

Cell Culture

The cell line HT-2, an IL-2-dependent murine helper T cell line (ATCC) was cultured in RPMI, 10% fetal bovine serum, antibiotics, and either 1 n human IL-2 (Chiron) or 5 units/ml erythropoietin (EPO, Amgen) as described previously (11). HT-2EPObeta -containing cell lines were generated by transfecting HT-2EPOgamma cells by electroporation and selecting stable transfectants by limiting dilution either in hygromycin B (Boehringer Mannheim) and G418 (Life Technologies, Inc.) as described previously (29) (HT-2EPObeta YF:1Y, HT-2EPObeta YF:234Y, HT-2EPObeta YF:5Y, HT-2EPObeta YF:6Y cell lines) or in 5 units/ml EPO (HT-2EPObeta YF:1Y, EPObeta YF:5Y, EPObeta YF:6Y, HT-2EPObeta YF:56Y, HT-2EPObeta YF:1234Y cell lines). No significant phenotypic differences were observed between cell lines generated by selection in G418/hygromycin B versus EPO.2

Cytokine Stimulations

For immunoprecipitations and nuclear extract preparation, cells were incubated for 2-4 h in RPMI with antibiotic and 1% bovine serum albumin (fraction V, Sigma) without growth factor as described previously (23). For RNA analyses, cells were incubated for 15 h in RPMI with antibiotic and 10% fetal bovine serum (Life Technologies, Inc.) in the absence of growth factor. Cells were stimulated for the indicated time intervals in 5-20 ml of the appropriate medium plus growth factor: IL-2 (10 n), murine IL-4, (100 units/ml, Genzyme), human EPO (50-100 units/ml).

Plasmid Constructs

All receptor cDNAs were subcloned into the expression vectors pCMV4 or pCMV4neo (29). Tyrosine substitution mutants in the IL-2Rbeta chain were created as described previously (29). These mutations were transferred into the pEPObeta neo backbone by replacing the AflII/BamHI fragment within the cytoplasmic tail of EPObeta with an equivalent fragment containing the beta YF:1Y, beta YF:234Y, beta YF:5Y or beta YF:6Y, beta YF:56Y, and beta YF:1234Y (formerly beta YF:56F) (11) mutations. Mutations were confirmed by sequencing. The pME18 s-STAT-5A and pME18s-STAT-5B constructs were generously provided by Dr. A. Mui (30).

RNA Preparation and Northern Blot Analysis

Cytoplasmic RNA was prepared from 1-2 × 107 cells using an RNeasy mRNA kit (Qiagen) and quantified by UV spectrophotometry. Denaturing gels were run with 10 µg of RNA/lane and blotted to Zeta Probe membranes (Bio-Rad) as described elsewhere (31). Hybridization was at 42 °C for 12-16 h. Probes were random prime-labeled using a Megaprime labeling kit (Amersham Corp.) and [alpha -32P]dATP and [alpha -32P]dCTP (Amersham Corp.). The glyceraldehyde-3-phosphate dehydrogenase (GAPD) cDNA was from ATCC (32), the c-fos cDNA was provided by Dr. I. Verma, and the bcl-2 cDNA was provided by Dr. S. Korsmeyer. DNA fragments used to label probes were as follows: a 1.2-kb HindIII/KpnI fragment of the extracellular murine EPO receptor, a 2.1-kb EcoRI murine c-fos cDNA fragment from pMc-fos (33), a 0.9-kb PstI murine bcl-2 fragment from pBS-bcl-2 (34), and a 1.0-kb EcoRI fragment from GAPD.

Electrophoretic Mobility Shift Assay (EMSA)

Nuclear extractions and EMSA were performed using the Fcgamma RI oligonucleotide as described previously (23, 35). Antibody supershifts were performed by preincubating nuclear extracts with 1 µl of STAT-5A or STAT-5B antisera (see below), 3 µg of 4G10 (anti-phosphotyrosine), or 3 µg of MOPC195 (IgG2b control) antibodies for 30 min on ice prior to the binding reaction.

Protein Expression in COS-7 Cells

COS-7 cells (ATCC) were transfected with the indicated plasmids using Lipofectamine (Life Technologies, Inc.) per the manufacturer's instructions. Nuclear extracts were prepared from 1-2 million transfected cells as described previously (35).

Immunoprecipitations

Cells were lysed (1% Nonidet P-40, 150 m NaCl, 20 m Tris, pH 8.0, 50 m NaF, 100 u sodium orthovanadate, 1 m phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 10 µg/ml aprotinin, 1 µg/ml pepstatin A) and immunoprecipitated with 1 µl of anti-STAT-5A, anti-STAT-5B, or anti-JAK1 antiserum (Upstate Biotechnology, Inc.) per 20-30 million cells using protein A-agarose (Boehringer Mannheim). Immunoblotting studies were performed with anti-phosphotyrosine antibody (4G10, Upstate Biotechnology) or anti-STAT-5A or anti-STAT-5B followed by enhanced chemiluminescence (ECL) (Amersham Corp.) signal development.

Proliferation Assays

Conventional 48-h [3H]thymidine incorporation assays and transient proliferation assays were performed as described previously (29). Data are expressed as a percentage of [3H]thymidine incorporation of cells treated with 10 n IL-2.

Antibodies

Anti-STAT-5A and anti-STAT-5B antibodies were generated in rabbits against the C-terminal peptides specific for mouse STAT-5A (LDARLSPPAGLFTSARSSLS) or mouse STAT-5B (MDSQWIPHAQS), and were used 1:50,000 in Western blotting and 1 µl/500 µg in immunoprecipitations.


RESULTS

Role of the IL-2Rbeta and gamma c Tyrosine Residues in Downstream Signaling Events

Proliferation Signaling

All facets of IL-2R signaling examined thus far appear to require heterodimerization of the IL-2Rbeta and gamma c chains; however, the relative contributions of these individual subunits to specific signaling processes may be distinct. In order to explore the functions of these chains in an IL-2-responsive cellular environment, this laboratory has developed a chimeric receptor system in which the extracellular domain of the EPO receptor (EPOR) is fused to the cytoplasmic domains of the IL-2Rbeta and gamma c chains, thus forming EPObeta and EPOgamma (Fig. 1A). When expressed in IL-2-dependent helper HT-2 cells, EPO stimulation recapitulates all IL-2-mediated signaling events so far examined (11, 14, 23). In the present studies, a series of mutant tyrosine constructs were created to delineate the role of individual IL-2Rbeta tyrosine residues in IL-2R signaling (Fig. 1A). These constructs were introduced into HT-2EPOgamma cells (11), and receptor gene expression in the stable transfectants was assessed by RNA blotting analysis to identify positive clones for further study. Relative levels of EPObeta and EPOgamma mRNA were approximately equivalent in all clones, indicative of similar expression levels of receptors (data not shown). As observed previously (11), the wild type HT-2EPObeta gamma cells (beta WT) exhibited a vigorous proliferative dose response to EPO (Fig. 1B, panels 1-6), whereas the HT-2EPObeta YF/gamma cells failed to proliferate (Fig. 1B, panels 3-6). HT-2 cell lines expressing either the two most distal tyrosines of beta  (EPObeta YF:56Y/gamma , panel 2) or the first four membrane-proximal tyrosines of beta  (EPObeta YF:1234Y/gamma , panel 1) both showed a strong proliferative response to EPO and could support long term growth in EPO. Moreover, certain cell lines expressing a single beta  tyrosine residue, EPObeta YF:1Y/gamma , EPObeta YF:5Y/gamma , or EPObeta YF:6Y/gamma , supported proliferation and long term growth comparably to those expressing wild type EPObeta gamma (panels 3, 5, and 6). Finally, cells expressing EPObeta YF:234Y/gamma did not proliferate significantly or support long term growth in EPO (Fig. 1B, panel 4). It is not clear whether or not the minor variations in proliferation among the EPObeta gamma , EPObeta YF:1Y, EPObeta YF:5Y, and EPObeta YF:6Y cell lines represent important differences, and we do not attempt to draw quantitative conclusions from these data. In conclusion, these experiments indicate that HT-2 cellular proliferation depends on select tyrosines within the IL-2Rbeta chain, namely 1Y, 5Y, or 6Y, which are functionally independent of one another. Moreover, the specific tyrosines capable of supporting proliferation only partially overlap with those found to be important in a pro-B cell line, Ba/F3 (11), indicating that IL-2 signaling in T cells may differ in certain ways from that in pro-B cells (see ``Discussion'').


Fig. 1. A, diagrams of chimeric receptor constructs. Hatched boxes represent EPO receptor sequence, and open boxes represent IL-2R sequences. Shaded boxes within IL-2R sequences correspond to conserved Box1 and Box2 regions (53). Tyrosine residues are indicated by horizontal bars and are numbered as follows: Y1 = Tyr-338, Y2 = Tyr-355, Y3 = Tyr-358, Y4 = Tyr-361, T5 = Tyr-392, and Y6 = Tyr-510. B, multiple tyrosine residues of the IL-2Rbeta chain can support proliferation signaling. HT-2EPObeta gamma , HT-2EPObeta YF/gamma , HT-2EPObeta YF:1Y/gamma , HT-2EPObeta YF:234Y/gamma , HT-2EPObeta YF:5Y/gamma , HT-2EPObeta YF:6Y/gamma , HT-2EPObeta YF:1234Y/gamma , and HT-2EPObeta YF:56Y/gamma cells were stimulated for 48 h with EPO at the indicated concentrations. Cells were pulsed with [3H]thymidine for the final 4 h of the culture and harvested. Results are expressed relative to the level of incorporation occurring with stimulation in 10 n IL-2 (100%). Each data point is the mean of triplicates, and is representative of three experiments. C, a single tyrosine residue within IL-2Rbeta is sufficient for growth signaling in the absence of gamma c tyrosine residues. HT-2EPOgamma (left panel) or HT-2EPOgamma YF (right panel) cells were transiently transfected with the EPObeta YF, EPObeta YF:1Y, or EPObeta (beta WT) constructs as described previously (29), and [3H]thymidine incorporation was measured at the indicated time points after transfection. Each data point is the mean of triplicates, and is representative of four experiments.
[View Larger Version of this Image (36K GIF file)]

Prior studies have shown that the EPObeta /gamma YF-expressing cell lines proliferate in response to EPO equivalently to cells expressing wild type EPObeta gamma receptors (11). Combined with the data presented above (Fig. 1B), it appeared that a single tyrosine residue of the IL-2Rbeta chain was sufficient to support growth signaling. However, it remained formally possible that tyrosines of the gamma c chain could play a compensatory role in the context of a mutant beta  chain containing only a single tyrosine residue. Therefore, the ability of the IL-2Rbeta tyrosine mutants to proliferate when paired with a gamma c chain lacking all of its cytoplasmic tyrosine residues (EPOgamma YF) was assessed. As shown in Fig. 1C, both EPObeta and EPObeta YF:1Y induced proliferation equally well when transiently transfected into HT-2EPOgamma cells and HT-2EPOgamma YF cells, whereas EPObeta YF failed to mediate the proliferative response in either case. Similar results were obtained for the EPObeta YF:5Y and the EPObeta YF:6Y (data not shown). Therefore, a single tyrosine residue in the beta  chain of the IL-2 receptor complex is both necessary and sufficient to support proliferation signaling in HT-2 cells.

Induction of Gene Expression

A second important outcome of IL-2R signaling is the induced expression of a number of specific genes (36, 37). To assess the relative roles of the beta  and gamma c subunits in gene induction, cells expressing various combinations of mutant receptors were stimulated for varying lengths of time. Cytoplasmic RNA was analyzed by Northern blotting with probes to the c-fos and bcl-2 proto-oncogenes (33, 34). As shown in Fig. 2A, EPO stimulation of HT-2EPObeta gamma cells induced expression of these genes with reproducible and characteristic time courses (lanes 5-8), whereas EPO stimulation of HT-2 cells failed to induce these genes (lanes 1-4). To assess the role of the gamma c tyrosine residues and distal tail in induction of these genes, HT-2EPObeta /gamma YF or HT-2EPObeta /gamma 336 cells were examined. These cell lines were found to induce transcription of both c-fos and bcl-2 identically to the wild type controls (Fig. 2A, lanes 9-16). Thus, neither the tyrosine residues nor the distal 35 amino acids of the gamma c chain appear necessary for the induction of c-fos or bcl-2 in this cellular context.


Fig. 2. A, the gamma c chain is not required to specify activation of the bcl-2 and c-fos proto-oncogenes. HT-2, HT-2EPObeta gamma , HT-2EPObeta /gamma YF, HT-2EPObeta /gamma 336, HT-2EPOR(1-321), and HT-2EPObeta /EPOR(1-321) cells were incubated in media without growth factor for 15 h and stimulated with 50 units/ml EPO for 0, 30, 60 min or 9 h, as indicated. Total cellular RNA was prepared, separated by Northern blotting, and probed with bcl-2, c-fos or GAPD cDNA probes. B, a single tyrosine residue of the IL-2Rbeta chain is necessary and sufficient for induction of c-fos gene expression. HT-2EPObeta gamma , HT-2EPObeta YF/gamma , HT-2EPObeta YF:1234Y/gamma , HT-2EPObeta YF:1Y/gamma , HT-2EPObeta YF:234Y/gamma , HT-2EPObeta YF:56Y/gamma , HT-2EPObeta YF:5Y/gamma , and HT-2EPObeta YF:6Y/gamma cells were stimulated with EPO as described in A. Total cellular RNA was separated by Northern blotting and probed with c-fos and GAPD cDNA probes. C, induction of bcl-2 gene expression occurs via a tyrosine-independent pathway. HT-2EPObeta gamma , HT-2EPObeta YF/gamma , HT-2EPObeta YF:1234Y/gamma , HT-2EPObeta YF:1Y/gamma , HT-2EPObeta YF:234Y/gamma , HT-2EPObeta YF:56Y/gamma , HT-2EPObeta YF:5Y/gamma , and HT-2EPObeta YF:6Y/gamma cells were stimulated with EPO as described in A. Total cellular RNA was prepared, separated by Northern blotting, and probed with bcl-2 and GAPD cDNA probes.
[View Larger Version of this Image (69K GIF file)]

To determine whether any other portion of the gamma c chain was required for the induction of these genes, EPOgamma was replaced with a truncated version of the erythropoietin receptor, EPOR(1-321), that contains no tyrosine residues (14). Stimulation of cells expressing EPOR(1-321) alone failed to induce transcription of the c-fos or bcl-2 genes (Fig. 2A, lanes 17-20). In contrast, co-expression of EPOR(1-321) with a wild type EPObeta chain induced expression of these genes that was indistinguishable from cells expressing wild type EPOgamma (lanes 21-24). Thus, gamma c can be replaced entirely with a heterologous receptor subunit with no apparent change in downstream activation of a variety of IL-2-induced genes. These data further indicate that JAK3, which binds to gamma c (16, 17), can be replaced by JAK2, which binds to the EPOR (38), without altering signaling specificity from the IL-2 receptor.

Since the tyrosine residues within the gamma c chain appeared to provide no detectable specificity to the IL-2 signaling program, the role of the six tyrosine residues within the cytoplasmic tail of the IL-2Rbeta chain was examined. HT-2EPOgamma cells expressing the EPObeta tyrosine addback constructs (Fig. 1A) were stimulated, and Northern blots were prepared. As illustrated in Fig. 2B, c-fos induction was dependent on tyrosine-containing sequences in the beta  chain, since HT-2EPObeta YF/gamma cells failed to induce these genes in response to receptor activation (Fig. 2B, lanes 5-8). Indeed, c-fos transcription was linked to a single tyrosine residue, as only EPObeta constructs that retain the most membrane proximal tyrosine, Y1 (Tyr-338), supported its transcriptional induction (Fig. 2B, lanes 9-16). Thus, a single tyrosine residue within IL-2Rbeta is critical for the induction of c-fos. These data further indicate that the mechanism of c-fos induction is likely to occur via pathways linked to Shc, an adapter molecule we have previously shown to be exclusively engaged by the first tyrosine (Tyr-338) of the IL-2Rbeta chain (22).

In contrast to the regulation of c-fos, the induced expression of the bcl-2 proto-oncogene was found to be independent of tyrosine residues. All beta  mutants examined, including a mutant lacking all six cytoplasmic tyrosine residues (HT-2EPObeta YF), induced bcl-2 transcription in response to ligand (Fig. 2C). Thus, at least one downstream signaling event is independent of tyrosine residues within the IL-2 receptor, while others are governed by individual tyrosines.

Role of the IL-2Rbeta Tyrosine Residues in Proximal Signaling Events

JAK1 Activation

Proliferation and gene induction are both relatively late events in signaling through the IL-2R. One of the best characterized signaling pathways initiated rapidly upon receptor ligation is the phosphorylation of the Janus kinases JAK1 and JAK3 (18, 19), followed by the activation of STAT factors (23, 24, 25, 26, 27, 28, 39). To assess the role of tyrosine residues within the IL-2Rbeta chain in Janus kinase activation, cells expressing tyrosine mutant EPObeta chains were stimulated with EPO or IL-2 as a positive control, and JAK1 immunoprecipitates were prepared for immunoblotting with 4G10 anti-phosphotyrosine antibodies. As shown in Fig. 3, stimulation of all of the EPObeta tyrosine mutant cell lines led to phosphorylation of JAK1 (top panel). The blots were stripped and reprobed with anti-JAK1 antibodies to ensure equivalent loading of the gels (bottom panel). These results were consistent with the previous demonstration that JAK1 and JAK3 activation is independent of IL-2Rbeta tyrosine residues (data not shown) (11). The slight differences in relative JAK1 induction among cell lines may reflect variations in either endogenous JAK1 levels and/or receptor expression. However, it should be noted that these results serve as independent confirmation that each of the mutant tyrosine receptors is expressed at the cell surface and is capable of initiating signaling.


Fig. 3. IL-2-induced JAK1 phosphorylation occurs independently of IL-2Rbeta tyrosine residues. HT-2EPObeta gamma , HT-2EPObeta YF:1Y/gamma , HT-2EPObeta YF:234Y/gamma , HT-2EPObeta YF:5Y/gamma , and HT-2EPObeta YF:6Y/gamma cells were incubated in the absence of growth factor for 4 h and stimulated for 15 min with 50 units/ml EPO (E) or 10 n IL-2 (2). JAK1 immunoprecipitates were prepared, immunoblotted with anti-phosphotyrosine (4G10) antibodies (top) or stripped and reprobed with anti-JAK1 antibodies (bottom), and visualized by ECL. Arrows indicate JAK1. Migration of molecular weight markers is indicated in top panel.
[View Larger Version of this Image (35K GIF file)]

STAT-5 Activation

One consequence of Janus kinase activation in the IL-2 receptor system is the phosphorylation, nuclear import, and DNA binding activity of several STAT factors, notably factors related to STAT-5 (23, 24, 25, 26, 27, 28, 40). In particular, stimulation of either native or chimeric IL-2 receptors expressed on HT-2 cells induces a nuclear DNA binding complex that is recognized by antibodies raised against sheep STAT-5/MGF (23). We examined the nature of the DNA binding complex in more detail than has been previously described. In particular, two murine isoforms of STAT-5 (STAT-5A and STAT-5B) have been identified recently that differ at their C termini from the originally identified sheep STAT-5/MGF (30, 41). Antibodies were raised against the unique, C-terminal portions of STAT-5A and STAT-5B. These antisera exhibited no detectable cross-reactivity by immunoblotting of cell lysates from COS-7 cells expressing either STAT-5A or STAT-5B alone (Fig. 4A). To evaluate the specificity of these antibodies in EMSA, either STAT-5A or STAT-5B was expressed with JAK1 in COS7 cells to permit constitutive, receptor-independent phosphorylation of the STATs in an overexpression system. Nuclear extracts were prepared from transfected COS7 cells, and an EMSA was performed using an oligonucleotide corresponding to the Fcgamma RI STAT response element (39) as described previously (23). JAK1 overexpression in COS7 cells resulted in a DNA binding complex that represents endogenous STAT-1 (Fig. 4B, lane 4, and data not shown). However, when JAK1 was co-expressed with STAT-5A or STAT-5B, DNA binding complexes were observed that co-migrated with STAT-5. Importantly, addition of anti-STAT-5A and -5B antisera to the EMSA reaction caused selective supershifting of their respective DNA binding complexes, as demonstrated by the appearance of a slower migrating complex present at the top of the gel (Fig. 4B, lanes 9, 10, 15, 16, 19, and 20), and these supershifted bands were accompanied by a corresponding diminution of the original DNA binding complexes. The anti-STAT-5A antiserum caused such a supershift only in extracts from STAT-5A transfectants, and the anti-STAT-5B antiserum caused a supershift only in extracts from STAT-5B transfectants. In addition, a nonspecific (NS) reactivity was present in the anti-STAT-5A and -5B antisera that was also found in preimmune sera (Fig. 5, lanes 5 and 6), but the bands representing specific supershifts are nonetheless diagnostic for the presence of STAT-5A or -5B.


Fig. 4. A, anti-STAT-5A and anti-STAT-5B antibodies are specific in immunoblot analysis. Vectors containing STAT-5A, STAT-5B and a control vector (pCMV4) were transfected alone in COS7 cells, and cellular lysates prepared 48 h post-transfection. Lysates were separated by 8.75% SDS-polyacrylamide gel electrophoresis and immunoblotted with either STAT-5A or STAT-5B antisera, as indicated. Blots were visualized by ECL. Migration of molecular weight markers is shown. B, anti-STAT-5A and anti-STAT-5B antibodies exhibit specific supershifting in EMSA. COS-7 cells were transfected with the pCMV4 (lane 1), pCMV4-JAK1 (lanes 4-22), pME18s-STAT-5A (lanes 2, 5, 7, 8-12, and 18-22) or pME18sSTAT-5B (lanes 3, 6, 7, and 13-22) vectors. Nuclear extracts were prepared 48 h post transfection, and EMSA was performed as described under ``Materials and Methods.'' The specific probe employed was 32P-end-labeled Fcgamma RI STAT-response element (GTATTTCCCAGAAAAAGGAC) (39). Nuclear extracts were incubated on ice with 1 µl of anti-STAT-5A (5A, lanes 9, 14, and 19), 1 µl of anti-STAT-5B (5B, lanes 10, 15, and 20), 3 µg of 4G10 (PY, lanes 11, 16, and 21), or 3 µg of MOPC195 IgG2b control antibodies (C, lanes 12, 17, and 22) for 30 min prior to EMSA. The top arrow indicates supershifted bands, and the bottom arrow indicates STAT-5 DNA binding complexes. Endogenous represents a STAT-1 DNA binding activity that appears constitutively in the presence of JAK1 overexpression (data not shown). C, IL-2R signaling induces both STAT-5A and STAT-5B in HT-2 cells. HT-2 cells were incubated in the absence of IL-2 for 2 h and stimulated for 15 min with 10 n IL-2 (2) (lanes 2-4) or 100 u/ml murine IL-4 (4) (lanes 5-7), and nuclear extracts were prepared as described in B. Nuclear extracts were incubated with 1 µl of anti-STAT-5A (lanes 3 and 6) or anti-STAT-5B (lanes 4 and 7) for 45 min on ice prior to EMSA. Arrows indicate STAT-5 and STAT-6; NS, nonspecific band. D, IL-2 induces heterodimerization of STAT-5A and STAT-5B in HT-2 cells. HT-2EPObeta gamma cells were stimulated with EPO as described in C, and cellular lysates were immunoprecipitated with 1µl anti-STAT-5B. Immunoprecipitates were separated by 8.75% polyacrylamide gel electrophoresis, immunoblotted with anti-STAT-5A, anti-phosphotyrosine (PTyr, 4G10), or anti-STAT-5B antibodies as indicated.
[View Larger Version of this Image (52K GIF file)]


Fig. 5. The gamma c chain can be replaced with a heterologous receptor subunit in STAT-5A/B induction. HT-2EPObeta /EPOR(1-321) cells were stimulated with EPO (E) and nuclear extracts subjected to EMSA as described in Fig. 4B. Nuclear extracts were also incubated with 1 µl of specific preimmune serum (PIS) for 30 min on ice prior to EMSA (lanes 5 and 6). The top arrow indicates the supershifted band, and the bottom arrow indicates STAT-5. NS, nonspecific DNA binding complex.
[View Larger Version of this Image (41K GIF file)]

In order to determine precisely which STAT-5 homologue(s) were induced by IL-2 in T cells, HT-2 cells were stimulated with IL-2 or IL-4 as a negative control and EMSA was performed as described in Fig. 4B. As shown in Fig. 4C, the IL-2-induced DNA binding complex reacted with both antisera specific for either STAT-5A or STAT-5B by causing a diminution in the DNA binding complex with a corresponding appearance of a specific supershift at the top of the gel (Fig. 4C, lanes 3 and 4). These findings imply that the IL-2R mediates the induction of both STAT-5A and STAT-5B, consistent with previous observations in the IL-3R system (30). This reactivity was not observed with preimmune sera from the same animals (Fig. 5, lanes 5 and 6), nor were IL-4-induced DNA binding complexes containing STAT-6 affected in this way (Fig. 4C, lanes 6 and 7). The finding that virtually the entire DNA binding complex induced by IL-2 in HT-2 cells was competed with anti-STAT-5A antibodies suggested that all of the DNA binding complexes contained STAT-5A (Fig. 4C, lane 3). However, the fact that only a partial supershift of the complex was achieved with anti-STAT-5B (Fig. 4C, lane 4) argued that the nucleoprotein complexes represented a combination of STAT-5A homodimers and STAT-5A/STAT-5B heterodimers.

To assess directly whether signaling through the IL-2R induces heterodimerization of STAT-5A and -5B, lysates from uninduced or EPO-induced HT-2EPObeta gamma cells were immunoprecipitated with anti-STAT-5B antibodies and immunoblotted with anti-STAT-5A antisera. As shown in Fig. 4D, the presence of STAT-5A was dramatically increased in anti-STAT-5B immunoprecipitates following induction of the IL-2R, indicating that STAT-5B and STAT-5A form heterodimers primarily after stimulation (panel 1). The low level of background bands seen in the uninduced cells may suggest that some STAT-5A and STAT-5B molecules are preassociated prior to receptor stimulation, but this association is significantly and reproducibly enhanced upon ligation of the receptor. Since dimerization of STAT factors is dependent on reciprocal SH2/phosphotyrosine interactions (39), the phosphorylation status of the STAT-5B immunoprecipitates was assessed by stripping the blot and re-probing with anti-phosphotyrosine antibodies. Indeed, STAT-5B was found to be phosphorylated only after EPO stimulation (Fig. 4D, panel 2). Finally, efficient immunoprecipitation of STAT-5B was confirmed by stripping and reprobing the blot with anti-STAT-5B (Fig. 4D, panel 3). Of course, these data do not rule out the possibility that STAT-5A and STAT-5B homodimers are also present in the DNA binding complexes in addition to the STAT-5A/B heterodimers. Nevertheless, IL-2R stimulation induces the DNA binding activities of both STAT-5A and STAT-5B, involving the formation of heterodimers (and possibly homodimers) in vivo.

Neither the Four Cytoplasmic Tyrosine Residues of gamma c nor JAK3 Are Required for STAT-5A/B Induction

Previous studies have demonstrated that a truncated EPO receptor (EPOR(1-321)) is capable of functionally substituting for EPOgamma in the IL-2 receptor complex, even though it physically associates with and activates JAK2 rather than JAK3 (Fig. 2A) (14, 38). To determine whether the gamma c chain exerts any influence on the specific composition of the DNA binding complex induced by the IL-2R, supershift analyses were performed with nuclear extracts prepared from HT-2EPObeta /EPOR(1-321) cells. Consistent with previous observations, STAT-5A and -5B were both significantly induced in HT-2EPObeta /EPOR(1-321) cells (Fig. 5), indicating heterodimer formation. In addition, STAT-5A and STAT-5B heterodimers were also induced in HT-2EPObeta /gamma YF and HT-2EPObeta /gamma 336 cells (data not shown). These results confirmed that the gamma c chain plays no role in determining the specificity of the STAT-5 isoform induced following ligation of the IL-2R, and that JAK3 can be replaced with JAK2 in the receptor complex without adverse functional effects in the activation of select STAT factors.

Specific Tyrosine Residues of the IL-2Rbeta Chain Regulate STAT-5A/B Induction

Since tyrosine residues within the gamma c subunit failed to specify STAT-5A/B induction (Fig. 5) (23), studies were performed to delineate the role of the IL-2Rbeta chain in this process. Previous studies have established that one or more tyrosine residues of the IL-2Rbeta are required for STAT-5 activation, because a mutant IL-2Rbeta chain lacking all cytoplasmic tyrosine residues failed to induce STAT-5 DNA binding activity in HT-2 cells (23). The abilities of the EPObeta tyrosine reconstitution mutants to activate STAT-5A and -5B were therefore tested in EMSA. Consistent with prior in vitro peptide competition data (23, 26), HT-2 cells expressing either of the two C-terminal tyrosine residues (EPObeta YF:5Y/gamma or EPObeta YF:6Y/gamma ) each induced STAT-5A and STAT-5B in response to EPO (Fig. 6, lanes 7 and 10). Furthermore, supershift analyses suggested that typical STAT-5A/B heterodimers were assembled via these receptors (Fig. 6, lanes 12-17). In contrast, HT-2EPObeta YF:234Y/gamma cells failed to induce significant STAT-5A/B DNA binding activity, despite the activation of Janus kinases in these cells (Fig. 3). Unexpectedly, HT-2 cells expressing EPObeta YF:1Y/gamma also proved competent to activate STAT-5A/B (Fig. 6, lane 2). The relatively higher levels of STAT-5 induction by the EPObeta YF:1Y cell line as compared to the EPObeta YF:5Y and EPObeta YF:6Y cell lines shown in this gel were not consistently observed; thus all three mutants appear to activate STAT-5A/B roughly equivalently. In addition, EPObeta YF:1Y induced both STAT-5A/B in cells expressing EPOgamma YF, indicating that gamma c tyrosine residues do not exhibit a compensatory function for absent IL-2Rbeta residues (data not shown). These results underscore both redundancy and specificity within the IL-2R system, since STAT-5A/B can be activated through three different tyrosine residues but not by three other cytoplasmic tyrosines.


Fig. 6. Redundant tyrosine residues of the IL-2Rbeta chain induce STAT-5A/5B in HT-2 cells. HT-2EPObeta YF:1Y/gamma , HT-2EPObeta YF:234Y/gamma , HT-2EPObeta YF:5Y/gamma , and HT-2EPObeta YF:6Y/gamma cells were stimulated with 50 units/ml EPO (E) (lanes 2, 4, 7, 10, and 12-17) or 10 n IL-2 (2) (lanes 5, 8, and 11) and nuclear extracts subjected to EMSA and antibody competitions performed as described in Fig. 4B.
[View Larger Version of this Image (39K GIF file)]


DISCUSSION

The IL-2 Receptor Is Composed of Distinct, Functional Modules

One of the paradoxes in cytokine receptor signal transduction is that a high degree of signaling specificity is achieved even though receptor subunits and intracellular signaling intermediates are shared among multiple receptor types. In this regard, the gamma c subunit corresponds to a relatively short chain that participates in the IL-2, -4, -7, -9, and -15 receptors (4, 5, 6, 7). However, gamma c appears to confer no detectable specificity to the IL-2 signaling program. Indeed, none of the four cytoplasmic tyrosine residues within gamma c nor distal sequences within the gamma c tail is required for effective signaling, including proliferation, induction of the c-fos and bcl-2 proto-oncogenes, or STAT-5A and -5B activation (Figs. 1C, 2A, and 5) (14). Furthermore, while JAK3 is bound to proximal sequence elements in gamma c, this cytoplasmic domain and Janus kinase can be replaced by a truncated form of the erythropoietin receptor bound to JAK2 with no loss of signaling specificity (Figs. 2A and 5) (14). Nevertheless, gamma c-associated JAK activity appears to be necessary for native IL-2R signaling, since a dominant negative JAK3 mutant lacking intrinsic kinase activity effectively disrupts signal transduction (42). In addition, natural mutations of gamma c that abrogate JAK3 binding lead to clinically significant immunodeficiencies (43). Taken together, our present findings support the notion that gamma c plays an important role in the initiation of transmembrane signaling but is likely dispensable for subsequent execution and completion of specific signals. Accordingly, we have suggested that gamma c and its associated JAK3 function as a ``trigger'' chain in the IL-2R complex (14).

In contrast, the subunits that pair with gamma c in the IL-2, IL-4, IL-7, IL-9, and IL-15 receptors have relatively long cytoplasmic domains that typically associate with multiple signaling intermediates. For example, while the IL-2Rbeta chain binds specifically to such molecules as Shc and STAT-5 (22, 23, 24, 26, 27, 28), the IL-4R subunit binds to STAT-6 (44, 45), thus specifying a very different signaling program. The present findings provide further molecular evidence that these longer subunits play a major role in driving the specificity of the signaling program; thus, we have referred to this class of receptor subunits as ``driver'' chains (14).

Signaling Modules Are Specific, Redundant, and Multifunctional

The findings reported here illustrate several properties of the IL-2 receptor ``driver'' subunit, the IL-2Rbeta chain, that characterize its mechanism of signaling. First, within the IL-2Rbeta chain, there are multiple functional, tyrosine-based peptide modules that exhibit a high degree of specificity in coupling to signaling pathways (summarized in Fig. 7B). For example, the ability of an individual tyrosine residue to drive a specific signal is manifested in the activation of c-fos gene expression. Data presented here illustrate that Y1 (Tyr-338) is uniquely required for inducing c-fos mRNA levels (Fig. 2B), while another recent study has shown that Y1 (Tyr-338) is the only cytoplasmic tyrosine residue within IL-2Rbeta that binds to the Shc adapter molecule after IL-2Rbeta phosphorylation (22). Taken together, these observations suggest that c-fos is likely induced via the Ras-Raf pathway that is activated by Shc (reviewed in Ref. 46). These experiments have also shown that the c-fos and STAT-5 pathways appear to be distinct. STAT-5 can be activated through other tyrosine residues (Y5 (Tyr-392) and Y6 (Tyr-510)) that fail to induce c-fos or bind Shc (Figs. 2B and 6) (22). However, since both pathways are induced through an IL-2Rbeta mutant that contains only Y1 (Tyr-338), these studies do not preclude the possibility that STAT-5 activation is necessary but not sufficient for AP-1 induction by this receptor (47).


Fig. 7. A, amino acid motifs flanking tyrosine residues of STAT-5-inducing receptors. B, specific signaling events mediated by IL-2Rbeta tyrosine residues located in the cytoplasmic tail. Conserved Box1 (1) and Box2 (2) motifs are shaded (53), and relative positions of the six tyrosine (Y) residues are indicated.
[View Larger Version of this Image (28K GIF file)]

Second, in contrast to the selective activation of c-fos by Y1 (Tyr-338), there is marked redundancy in the abilities of certain tyrosine residues within IL-2Rbeta to mediate other signaling events. For example, Y1 (Tyr-338), Y5 (Tyr-392), and Y6 (Tyr-510) all promote activation of STAT-5 nuclear import and DNA binding activity in HT-2 cells (Fig. 6), despite clear sequence differences in the amino acid sequences flanking Tyr-338 and Tyr-392/Tyr-510 (Fig. 7A and see below). Importantly, efficient STAT5A/5B heterodimerization is induced via an IL-2Rbeta mutant retaining a single STAT-binding motif, indicating that the receptor does not necessarily form a multivalent ``platform'' to which multiple STATs are recruited simultaneously in order to direct heterodimer or homodimer formation. Similar redundancy among Y1 (Tyr-338), Y5 (Tyr-392), and Y6 (Tyr-510) is observed in the activation of cellular proliferation (Fig. 1) (11), although STAT-5 activation and proliferation are probably independent events (23, 24). The biological importance of such functional redundancy is unknown, but it may allow for amplification of signaling, as has been demonstrated for repetitive tyrosine-based motifs present in the T cell receptor complex (48).

Third, the studies performed here indicate that individual tyrosine-based motifs in the IL-2Rbeta chain can serve multiple, apparently independent functions. For example, as described above, Y1 (Tyr-338) couples both to a Shc-dependent pathway as well as to the JAK-STAT pathway (Fig. 7B). Moreover, two isoforms of STAT-5 are induced through single tyrosine residues, indicating at least some potential for multifunctionality through these sequences. Since both STAT-1 and STAT-3 have been implicated in IL-2 signaling in other systems (26, 40), it is likely that more STAT factors may couple to some or all of the receptor tyrosine residues.

Interestingly, no obvious function for the Tyr-234 (Tyr-355/Tyr-358/Tyr-361) tyrosine cluster has yet been detected in HT-2 cells. Although it is unknown whether the restriction of function of Tyr-234 occurs at the level of phosphorylation or at the level of binding to particular signaling intermediates, it is nonetheless clear that there is strict selectivity in which tyrosines are capable of mediating such events.

Finally, at least some signaling pathways are coupled to the IL-2R through a tyrosine-independent mechanism, as represented by induction of the proto-oncogene bcl-2. It has been previously shown that bcl-2 induction is independent of JAK3 activation (42), but the data presented here represent the first direct demonstration that bcl-2 induction is also independent of tyrosine residues within the IL-2 receptor. Further studies are needed to determine how tyrosine-independent pathways are initiated by cytokine receptors after receptor activation. Other studies with the growth hormone (GH) and erythropoietin receptor have suggested that receptor tyrosine residues are apparently not absolutely essential for activation of proliferation and the JAK-STAT pathway in these receptor systems (49, 50). It remains to be determined whether these observations represent a fundamental difference in the mechanism of signaling between the EPOR/GHR and the IL-2 receptors, or whether low levels of endogenous EPO and GH receptors might contribute to the observed functionality of the transfected receptor mutants.

Cell Context Specificity of STAT-binding Motifs

Among cytokine receptors it is often possible to identify putative functional ``driver'' modules based on sequence alone, such as IRS-1- or STAT-binding motifs (10, 44). The present studies reveal additional complexities underlying STAT-5-activation motifs and the role of additional cellular factors in permitting STAT activation. First, in HT-2 cells, we have shown that two isoforms of STAT-5 (STAT-5A and -5B) are induced by IL-2 stimulation through three different tyrosine residues within IL-2Rbeta (Figs. 4 and 6). Surprisingly, however, although the sequences surrounding Y5 (Tyr-392) and Y6 (Tyr-510) are quite similar to tyrosine motifs found in other STAT-5-inducing receptors (D A Y L S/T L), the functionally redundant Y1 (Tyr-338) is notably divergent from these in primary sequence (N Q G Y F F F) (Fig. 7A). Moreover, the context of the prolactin receptor tyrosine residue that induces transcription through a STAT-response element differs somewhat from these motifs (LDYLDPT) (51). Therefore, STAT-5 appears to be activated through as many as three different tyrosine-based sequences.

In addition, there appears to be an influence of cellular environment on STAT-5 activation. First, in the pro-B/myeloid cell line Ba/F3, a truncated IL-2Rbeta chain retaining Y1 (Tyr-338) fails to activate STAT-5 DNA binding, although it still maintains the ability to induce cellular proliferation (24). These observations contrast with the present observation that Y1 (Tyr-338) induces STAT-5A/B in IL-2-dependent T cells (Fig. 6). Second, the effects of point substitutions at Y1 (Tyr-338) on proliferation signaling appear to vary depending on cellular context (11). Moreover, the EPOR can induce STAT-5 only in certain cellular contexts3 (52). These data suggest that the type of cell chosen for receptor studies may be important in dissecting specific consequences of cytokine signaling. In summary, a full understanding of STAT-activation motifs and their functions in different cellular environments will require further study.

Modularity within the Cytokine Receptor Superfamily

In summary, the present studies reveal that tyrosine-based sequences located in the IL-2Rbeta chain exhibit specificity, redundancy and multifunctionality in regulating signaling events initiated by IL-2. Since the signaling portion of IL-15 receptor contains both the IL-2Rbeta and gamma c chains (7), these findings probably apply to this cytokine as well. It is likely that analogous modules in ``driver'' subunits within other receptor complexes also exhibit these characteristics, and that the combinatorial association of various modules within a receptor complex permits a diverse range of biologic consequences. For example, some domains may have synergistic or inhibitory influences on one another. A more complete understanding of such interactions is essential to developing strategies to manipulate these intracellular processes for clinical benefit.


FOOTNOTES

*   The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
b   Supported by a postdoctoral grant from the Bank of America-Giannini Foundation.
c   Supported by the J. David Gladstone Institutes.
d   In the NIH Medical Scientist Training Program and the Biomedical Sciences Program, University of California, San Francisco.
f   Supported by the National Institutes of Health Grants R01 AI36452 (to W. C. G. and M. A. G.) and R01 GM54351 (to M. A. G.).
i   To whom correspondence should be addressed: Gladstone Institute of Virology and Immunology, P. O. Box 419100, San Francisco, CA 94141. Tel.: 415-695-3775; Fax: 415-826-1514; E-mail: Mark_Goldsmith.givi{at}quickmail.ucsf.edu.
1   The abbreviations used are: IL, interleukin; IL-2R, interleukin-2 receptor; EPO, erythropoietin; JAK, Janus kinase; STAT, signal transducer and activator of transcription; EMSA, electrophoretic mobility shift assay; ECL, enhanced chemiluminescence; GAPD, glyceraldehyde-3-phosphate dehydrogenase; GH, growth hormone; kb, kilobase pair(s).
2   S. L. Gaffen, unpublished observations.
3   S. Y. Lai, unpublished observations.

Acknowledgments

We thank John Carroll and Amy Corder for excellent assistance in preparation of this manuscript. Recombinant IL-2 was a kind gift from the Chiron Corporation.


REFERENCES

  1. Paul, W. E., Seder, R. A. (1994) Cell 76, 241-251 [CrossRef][Medline] [Order article via Infotrieve]
  2. Bazan, J. F. (1990) Proc. Nat. Acad. Sci. U. S. A. 87, 6934-6938 [Abstract/Free Full Text]
  3. Goldsmith, M. A., Greene, W. C. (1994) Interleukin-2 and the Interleukin-2 Receptor Complex , Paston Press Ltd., Norfolk, England
  4. Noguchi, M., Nakamura, Y., Russel, S. M., Ziegler, S. F., Tsang, M., Cao, X., Leonard, W. J. (1993) Science 262, 1877-1880 [Abstract/Free Full Text]
  5. Russell, S. M., Keegan, A. D., Harada, N., Nakamura, Y., Noguchi, M., Leland, P., Friedman, M. C., Miyajima, A., Puri, R. K., Paul, W. E., Leonard, W. J. (1993) Science 262, 1880-1883 [Abstract/Free Full Text]
  6. Kondo, M., Takeshita, T., Ishii, N., Nakamura, M., Watanabe, S., Arai, K.-, Sugamura, K. (1993) Science 262, 1874-1877 [Abstract/Free Full Text]
  7. Giri, J. G., Ahdieh, M., Eisenmann, J., Shanebeck, K., Grabstein, K., Kumaki, S., Namen, A., Park, L. S., Cosman, D., Anderson, D. (1994) EMBO J. 13, 2822-2830 [Medline] [Order article via Infotrieve]
  8. Songyang, Z., Shoelson, S. E., Chaudhuri, M., Gish, G., Pawson, T., Haser, W. G., King, F., Roberts, T., Ratnofsky, S., Lechleider, R. J., Neel, B. G., Birge, R. B., Fajardo, J. E., Chou, M. M., Hanafusa, H., Schaffhausen, B., Cantley, L. C. (1993) Cell 72, 767-778 [CrossRef][Medline] [Order article via Infotrieve]
  9. Kavanaugh, W. M., Turck, C. W., Williams, L. T. (1995) Science 268, 1177-1180 [Abstract/Free Full Text]
  10. Stahl, N., Farruggella, T. J., Boulton, T. G., Zhong, Z., Darnell, J. E., Yancopoulos, G. D. (1995) Science 267, 1349-1353 [Abstract/Free Full Text]
  11. Goldsmith, M. A., Lai, S. Y., Xu, W., Amaral, M. C., Kuczek, E. S., Parent, L. J., Mills, G. B., Tarr, K. L., Longmore, G. D., Greene, W. C. (1995) J. Biol. Chem. 270, 21729-21737 [Abstract/Free Full Text]
  12. Nelson, B. H., Lord, J. D., Greenberg, P. D. (1994) Nature 369, 333-336 [CrossRef][Medline] [Order article via Infotrieve]
  13. Nakamura, Y., Russell, S. M., Mess, S. A., Friedmann, M., Erdos, M., Francois, C., Jacques, Y., Adelstein, S., Leonard, W. J. (1994) Nature 369, 330-333 [CrossRef][Medline] [Order article via Infotrieve]
  14. Lai, S. Y., Xu, W., Gaffen, S., Liu, K. D., Greene, W. C., Goldsmith, M. A. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 231-235 [Abstract/Free Full Text]
  15. Ihle, J. N. (1995) Nature 377, 591-594 [CrossRef][Medline] [Order article via Infotrieve]
  16. Russell, S. M., Johnston, J. A., Noguchi, M., Kawamura, M., Bacon, C. M., Friedmann, M., Berg, M., McVicar, D. W., Whitthuhn, B. A., Silvennoinen, O., Goldman, A. S., Schmalsteig, F. C., Ihle, J. N., O'Shea, J. J., Leonard, W. J. (1994) Science 266, 1042-1045 [Abstract/Free Full Text]
  17. Miyazaki, T., Kawahara, A., Fujii, H., Nakagawa, Y., Minami, Y., Liu, Z.-J., Oishi, I., Silvennoinen, O., Witthuhn, B. A., Ihle, J. N., Taniguchi, T. (1994) Science 266, 1045-1047 [Abstract/Free Full Text]
  18. Johnston, J. A., Kawamura, M., Kirken, R. A., Chen, Y.-Q., Blake, T. B., Shibuya, K., Ortaldo, J. R., McVicar, D. W., O'Shea, J. J. (1994) Nature 370, 151-153 [CrossRef][Medline] [Order article via Infotrieve]
  19. Witthuhn, B. A., Silvennoinen, O., Miura, O., Lai, K. S., Cwik, C., Liu, E. T., Ihle, J. N. (1994) Nature 370, 153-157 [CrossRef][Medline] [Order article via Infotrieve]
  20. Sugamura, K., Takeshita, T., Asao, H., Kumaki, S., Ohbo, K., Ohtani, K., Nakamura, M. (1990) Lymphokine Res. 9, 539-543 [Medline] [Order article via Infotrieve]
  21. Asao, H., Takeshita, T., Nakamura, M., Nagata, K., Sugamura, K. (1990) J. Exp. Med. 171, 637-644 [Abstract/Free Full Text]
  22. Evans, G. A., Goldsmith, M. A., Johnston, J. A., Xu, W., Weiler, S. R., Erwin, R., Howard, O. M. Z., Abraham, R. T., O'Shea, J. J., Greene, W. C., Farrar, W. L. (1995) J. Biol. Chem. 270, 28858-28863 [Abstract/Free Full Text]
  23. Gaffen, S. L., Lai, S. Y., Xu, W., Gouilleux, F., Groner, B., Goldsmith, M. A., Greene, W. C. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 7192-7196 [Abstract/Free Full Text]
  24. Fujii, H., Nakagawa, Y., Schindler, U., Kawahara, A., Mori, H., Gouilleux, F., Groner, B., Ihle, J. N., Minami, Y., Miyazaki, T., Taniguchi, T. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 5482-5486 [Abstract/Free Full Text]
  25. Hou, J., Schindler, U., Henzel, W. J., Wong, S. C., McKnight, S. L. (1995) Immunity 2, 325-330
  26. Lin, J.-X., Migone, T.-S., Tsang, M., Friedmann, M., Weatherbee, J. A., Zhou, L., Yamauchi, A., Bloom, E. T., Mietz, J., John, S., Leonard, W. J. (1995) Immunity 2, 331-339 [CrossRef][Medline] [Order article via Infotrieve]
  27. Gilmour, K. C., Pine, R., Reich, N. C. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 10772-10776 [Abstract/Free Full Text]
  28. Frank, D. A., Robertson, M. J., Bonni, A., Ritz, J., Greenberg, M. E. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 7779-7783 [Abstract/Free Full Text]
  29. Goldsmith, M. A., Xu, W., Amaral, M. C., Kuczek, E. S., Greene, W. C. (1994) J. Biol. Chem. 269, 14698-14704 [Abstract/Free Full Text]
  30. Mui, A. L.-F., Wakao, H., O'Farrell, A.-M., Harada, N., Miyajima, A. (1995) EMBO J. 14, 1166-1175 [Medline] [Order article via Infotrieve]
  31. Lamson, G., Koshland, M. E. (1984) J. Exp. Med. 160, 877-892 [Abstract/Free Full Text]
  32. Adams, M. D., Dubnick, M., Kerlavage, A. R., Moreno, R., Kelley, J. M., Utterback, T. R., Nagle, J. W., Fields, C., Venter, J. C. (1992) Nature 355, 632-634 [CrossRef][Medline] [Order article via Infotrieve]
  33. van Beveren, C., Van Straaten, F., Curran, T., Muller, R., Verma, I. M. (1983) Cell 32, 1241-1255 [CrossRef][Medline] [Order article via Infotrieve]
  34. Nunez, G., London, L., Hockenberry, D., Alexander, M., McKearn, J. P., Korsmeyer, S. J. (1990) J. Immunol. 144, 3602-3610 [Abstract]
  35. Schreiber, E., Matthias, P., Muller, M. M., Schaffner, W. (1989) Nucleic Acids Res. 17, 6419-6420 [Free Full Text]
  36. Hatakeyama, M., Kawahara, A., Mori, H., Shibuya, H., Taniguchi, T. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 2022-2026 [Abstract/Free Full Text]
  37. Miyazaki, T., Liu, Z.-J., Kawahara, A., Minami, Y., Yamada, K., Tsujimoto, Y., Barsoumian, E. L., Perlmutter, R. M., Taniguchi, T. (1995) Cell 81, 223-231 [CrossRef][Medline] [Order article via Infotrieve]
  38. Witthuhn, B. A., Quelle, F. W., Silvennoinen, O., Yi, T., Tang, B., Miura, O., Ihle, J. N. (1993) Cell 74, 227-236 [CrossRef][Medline] [Order article via Infotrieve]
  39. Darnell, J. E., Kerr, I. M., Stark, G. R. (1994) Science 264, 1415-1421 [Abstract/Free Full Text]
  40. Beadling, C., Gischin, D., Witthuhn, B. A., Ziemiecki, A., Ihle, J. N., Kerr, I. M., Cantrell, D. A. (1994) EMBO J. 13, 5605-5615 [Medline] [Order article via Infotrieve]
  41. Azam, M., Erdjument-Bromage, H., Kiedler, B. L., Xia, M., Quelle, F., Basu, R., Saris, C., Tempst, P., Ihle, J. N., Schindler, C. (1995) EMBO J. 14, 1402-1411 [Medline] [Order article via Infotrieve]
  42. Kawahara, A., Minami, Y., Miyazaki, T., Ihle, J. N., Taniguchi, T. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 8724-8728 [Abstract/Free Full Text]
  43. Russell, S. M., Tayebi, N., Nakajima, H., Reidy, M. C., Roberts, J. L., Aman, M. J., Migone, T.-S., Noguchi, M., Markert, M. L., Buckley, R. H., O'Shea, J. J., Leonard, W. J. (1995) Science 270, 797-799 [Abstract/Free Full Text]
  44. Keegan, A. D., Nelms, K., White, M., Wang, L.-M., Pierce, J., Paul, W. E. (1994) Cell 76, 811-820 [CrossRef][Medline] [Order article via Infotrieve]
  45. Hou, J., Schindler, U., Henzel, W. J., Ho, T. C., Brasseur, M., Mcknight, S. L. (1994) Science 265, 1701-1706 [Abstract/Free Full Text]
  46. Pronk, G. J., Bos, J. L. (1994) Biochim. Biophys. Acta 1198, 131-134 [Medline] [Order article via Infotrieve]
  47. Coffer, P., Lutticken, C., Van Puijenbroek, A., Klop-de Jonge,