|
Volume 271, Number 37,
Issue of September 13, 1996
pp. 22915-22922
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
Identification and Characterization of the Cell Type-specific and
Developmentally Regulated 7 Integrin Gene Promoter*
(Received for publication, March 15, 1996, and in revised form, June 10, 1996)
Barry L.
Ziober
and
Randall H.
Kramer
From the Departments of Stomatology and Anatomy, University of
California, San Francisco, California 94143-0512
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES
ABSTRACT
Expression of 7 is mainly confined to skeletal
and cardiac muscle in which it appears to be the major laminin-binding
integrin. When myoblasts differentiate to myotubes, 7 mRNA and
protein expression is up-regulated. To explore the mechanisms involved
in the tissue-specific and developmentally regulated expression of
7, we isolated and characterized a genomic clone containing ~2.8
kilobase pairs (kb) of the 5 -flanking region of the murine 7 gene.
The 5 -flanking region lacks both TATA and CCAAT boxes but contains
five putative Sp1 binding sites located in a CpG island. Two
transcription start sites, located near an initiator-like sequence, are
176 and 170 base pairs upstream of the translation start site. There
are numerous binding sites for developmental and cell type-specific
transcription factors, including AP-1, AP-2, GATA, and several AT-rich
sites. There are also eight consensus E-boxes that bind the basic
helix-loop-helix family of muscle-specific transcription factors. The
~2.8-kb 5 -flanking region was an active promoter in C2C12 skeletal
myoblasts and exhibited increased expression upon conversion to
myotubes but was inactive in HtLM2 cells, a mouse breast carcinoma
epithelial cell line that does not express 7. Deletion analysis
identified both positive and negative regulatory elements within the
~2.8-kb fragment. In 10T1/2 fibroblasts the ~2.8-kb 7 promoter
was trans-activated by the myogenic basic helix-loop-helix
proteins myogenin and MyoD but not by MRF4 and myf5. These results
suggest that muscle-specific transcription factors play a role in
regulating the cell-type expression of the 7 gene during
development.
INTRODUCTION
The integrin superfamily is made up of a number of transmembrane
heterodimeric receptors that mediate cell-extracellular matrix and
cell-cell interactions (1). Each integrin is composed of noncovalently
paired and subunits. Regulation of the genes expressing these
extracellular matrix receptors is important in a number of processes
including development, migration, and invasion (2, 3, 4).
Previously, we have reported that human and mouse melanoma cells
express an integrin complex designated 7 1 (5, 6). This integrin
receptor binds to the E8 fragment of laminin-1 and mediates cell
adhesion to this ligand (6). In melanoma, the expression of the 7
integrin receptor is elevated in the nonmetastatic phenotype but is
lacking in metastatic cells, suggesting that absence of this laminin
adhesion receptor can play a role in melanoma tumor cell
dissemination.1
Expression of 7, as detected by reverse
transcriptase-PCR,2 has also been reported
to be present in a number of tissues including for example stomach and
uterus (7). However, it has not yet been determined if any of the 7
protein isoforms are expressed in these tissues. In myoblasts and
cardiomyocytes, 7 appears to be the predominant laminin-binding
integrin expressed (8, 9). In vitro, basal levels of 7
expression are seen in replicating rat and mouse myoblasts (7, 10, 11).
Expression of 7 is increased upon differentiation of myoblasts to
myotubes. This up-regulation is paralleled by increased expression of
myogenin (11), a member of the muscle-specific basic helix-loop-helix
(bHLH) transcription factor family, suggesting that these factors play
a regulatory role in 7 expression during muscle development.
At embryonic day 7.5, 7 can be detected in the ectoplacental cone
(differentiating murine trophoblast), where it is believed to play a
role in trophoblast adhesion and/or differentiation. The use of laminin
fragments suggested that 7 1 may be one of the major trophoblast
laminin-binding integrins involved in embryo implantation (12).
Recently, the cDNAs for rat and mouse 7 have been isolated and
shown to be alternatively spliced in both the extracellular (giving
rise to two isoforms, X1 and X2) and cytoplasmic (producing three
isoforms, A, B, and C) domains. Subsequent work has shown that these
alternatively spliced forms are also developmentally regulated in
muscle (7, 10, 13).
Taken together, these results indicate that expression of 7 plays a
role in embryo implantation and muscle development. Furthermore, the
developmental and restricted tissue expression (in skeletal muscle and
cardiac muscle) of the 7 subunit suggests that the elements
governing its expression are complex. As an approach to understanding
the mechanisms regulating cell type- and differentiation-specific
expression of the 7 subunit, we isolated and characterized the
promoter region for the murine 7 integrin gene.
EXPERIMENTAL PROCEDURES
Isolation of a Mouse 7 Genomic Clone, Restriction Enzyme
Analysis, and Sequencing
Approximately 1 × 106
plaque-forming units of a mouse spleen genomic library constructed in a
Fix II phage vector (Stratagene Cloning Systems, La Jolla, CA) were
screened as described previously (10). An ~17-kb positive clone, G9,
was identified and subcloned into pBluescript (Stratagene Cloning
Systems). A partial restriction enzyme map was determined by standard
techniques using single and double restriction enzyme digestion and
Southern blot analysis (14). The probes used in the Southern analysis
were labeled with [ -32P]dCTP using a Multiprime DNA
labeling kit (Amersham Corp.). Hybridized nylon filters (Nytran+,
Schleicher & Schuell) were stringently washed and exposed to x-ray film
at 80 °C as described previously (10). A subclone of G9 designated
as G2 that contains the 7 promoter region was sequenced and analyzed
further.
All nucleotide sequences were determined by the dideoxy chain
termination method for double-stranded DNA as described previously
(10). Primers for sequencing and polymerase chain reaction (PCR) were
synthesized using the 391 DNA Synthesizer PCR-Mate from Applied
Biosystems (Foster City, CA).
Plasmid Constructs
To create the ~2.8-kb 7
chloramphenicol acetyltransferase (CAT) construct, the 7 genomic
clone G2 was digested with NcoI and blunt-ended with mung
bean nuclease to remove the ATG start site (14). A second digest with
SalI released the ~2.8-kb fragment. The XbaI
site of pCAT-Basic (Promega, Madison, WI) was digested and filled in
with Klenow, and pCAT-Basic was then digested with SalI and
ligated to the blunt-ended/SalI ~2.8-kb 7 promoter
fragment. The orientation of the insert was confirmed by sequencing.
pCAT-Basic plasmids containing deletions of the 7 gene 5 -flanking
region were created using PCR and the ~2.8-kb construct as the
template for each reaction. A common 3 -oligonucleotide,
promSalI,
5 d-(AAG GGATCAACGCTCTC-CCAGCTAGTGC)-3 , corresponding
to the sequence between positions +151 and +175 and containing a
SalI restriction enzyme site at the 5 end (underlined) was
used in the PCR reactions to create all deletion constructs. The
oligonucleotides used as 5 PCR primers each contained a
HindIII restriction enzyme site (underlined) and are
as follows: 1.22 kb,
5 -d(A TTGCAGGTCTGGGTCTTCAAGCC)-3 , 400 bp,
5 -d(A GCGGTTTGATTCTTACAGCC)-3 , 200 bp,
5 -d(A GTGGAAGGAATGAGTGCACAG)-3 , 100 bp,
5 -d(A CTTGCGCCTGAGTCTACTGC)-3 , 20 bp,
5 -d(A GCTCCCAAGGCGTGCAGTAG)-3 . All PCR reactions
were performed in 1 × Vent buffer (New England BioLabs,
Beverly, MA) with 200 µM of each deoxynucleotide, 40 pmol
of each primer, and 2 units of Vent DNA polymerase (New England
BioLabs) with proofreading activity. Typically, the thermocycling
program consisted of an initial denaturation step at 94 °C followed
by 20-25 cycles consisting of 1 min denaturation at 94 °C, 30 s annealing at 58 °C, and 30 s elongation at 72 °C. A final
10-min elongation at 72 °C followed. The PCR fragments were digested
with HindIII and SalI and ligated into the
corresponding sites in pCAT-Basic. Each construct was verified by
sequencing.
Cell Culture
The mouse C2C12 myoblast cell line was
provided by Dr. H. Blau (Stanford University). C2C12 cells were
maintained in Dulbecco's minimal essential medium (DME-H-21, Cell
Culture Facility, UCSF) supplemented with 20% fetal bovine serum. To
induce their differentiation into myotubes, myoblasts were switched to
differentiation medium (DM) containing DME-H21 with 2% horse serum for
the indicated amount of time. Murine breast carcinoma cells, HtLM2
(provided by Dr. C. Damsky, UCSF), were grown in DME-H-16 with 10%
fetal bovine serum. 10T1/2 fibroblasts were maintained in growth medium
containing DME-H-16 supplemented with 10% fetal bovine serum. The
mouse melanoma cell line K1735 cl19 was maintained as described
previously (6).
Transfection Assays
Mouse C2C12 cells were maintained in
DME-H-21 containing 20% fetal bovine serum. Cells were plated at
1.35 × 105 cells per 35-mm dish and incubated for
18-24 h. Two µg of each chimeric CAT reporter gene construct and 0.5 µg of a reference SV40-luciferase plasmid (pGL2, Promega) were
combined with 6 µl of LipofectAMINE (Life Technologies, Inc.) in 200 µl of Opti-MEM (Life Technologies, Inc.). Cells were washed with 2 ml
of Opti-MEM and overlaid with the LipofectAMINE-DNA complexes diluted
to 1 ml with Opti-MEM. After 5 h, one-half of the cultures were
switched to DME-H-21 with 20% fetal bovine serum. The remaining
cultures were switched to DM to stimulate the formation of myotubes
during growth for an additional 72 h. HtLM2 cells were transiently
transfected in the same way as C2C12 myoblasts except that 10 µl of
LipofectAMINE was used. After 5 h the LipofectAMINE-DNA complex
was replaced with growth medium, and the cells were incubated for
72 h.
CAT Assays
Cells were rinsed twice in phosphate-buffered
saline and manually harvested using 1 ml of phosphate-buffered saline.
Cell pellets were resuspended in 100 µl of phosphate-buffered saline
containing 1 mM phenylmethylsulfonyl fluoride. Fifty µl
of this cell suspension was subjected to three freeze-thaw cycles, spun
at 500 × g for 5 min to remove cell debris, and
assayed for CAT activity. CAT activity was detected and quantitated by
assaying 20 µl of either the C2C12 or the HtLM2 cell lysate, using an
enzyme-linked immunosorbent assay (ELISA). This colorimetric CAT-ELISA
(5 Prime-3 Prime, Boulder, CO) detects the fully native, enzymatically
active (trimeric) form as well as the denatured, enzymatically inactive
(monomeric) form of the CAT protein. Each ELISA was performed according
to the manufacturer's instructions, and CAT activity in cell lysates
was determined from a standard curve run for each experiment.
To normalize the CAT activity between transfections, we assayed the
luciferase activity transcribed by cotransfecting plasmid pGL2. The
remaining 50 µl of the cell suspension (see above) was lysed using
1 × Reporter lysis buffer (Promega) and spun briefly to pellet
cell debris. Three µl of the cell extract was mixed with 100 µl of
luciferase assay reagent (Promega), and luciferase activity was
measured using a Turner luminometer (Promega). The luciferase values
were used to normalize CAT activity readings for transfection
efficiency.
For trans-activation studies, 1.35 × 105
10T1/2 fibroblasts plated in 35-mm dishes were transfected with
LipofectAMINE-DNA complexes containing 2 µg of the p2.8kb-CAT
construct (full-length promoter) and 0.5 µg of one of the expression
vectors for muscle-specific bHLH proteins, MyoD (15), myogenin (16),
MRF4 (17), and myf5 (18). The cDNA for each of the bHLH proteins
was contained in the expression vector pEMSVcribe (15). Following
transfection, 10T1/2 cells were grown for 72 h in DM prior to
harvesting.
S1 Nuclease Protection and Primer Extension Analysis
S1
nuclease protection assays were performed on total RNA isolated by the
guanidinium isothiocyanate method as described (10). A single-stranded
~290-bp 5 genomic fragment of 7 extending from the initiation
methionine to 115 was used as the probe for S1 analysis. This probe
contained 175 bp of the untranslated region and 115 bp of the
5 -flanking sequences. The probe was end-labeled with T4 polynucleotide
kinase, and ~3 × 105 cpm of the probe was
hybridized with 40 µg of RNA from K1735 cells and from C2C12
myoblasts and myotubes for 16 h at 30 °C in an S1 hybridization
mixture containing 40 mM Pipes, pH 6.4, 400 mM
NaCl, 1 mM EDTA, pH 8, and 80% deionized formamide. The
hybridization mixture was digested with 1200 units/ml S1 nuclease
(Boehringer Mannheim) in S1 nuclease buffer containing 0.28 M NaCl, 50 mM sodium acetate, pH 4.5, 4.5 mM ZnSO4, and 20 mg/ml salmon sperm DNA for
1 h at 30 °C. The reaction products were ethanol-precipitated,
and the protected fragments were analyzed on a denaturing
polyacrylamide gel. A sequencing reaction primed with the same
oligonucleotide (PE1) used to make the single-stranded S1 nuclease
probe was run as size and site standard. DNA fragments labeled with
32P or 35S were run at the same position and as
such should not affect length determinations.
Primer extension was performed using antisense oligonucleotide PE1
(GGATCAACGCTCTCCCAGCTAGTGC) (Fig. 2). PE1 was end-labeled with T4
polynucleotide kinase, and 105-106 cpm was
hybridized to 10-15 µg of total RNA for 16 h at 30 °C in S1
hybridization buffer. The complementary DNA was extended in 1 × PCR buffer (see below) containing 5 mM dithiothreitol, 100 µg of actinomycin, 0.5 units of RNasin, 0.4 mM dNTPs, and
Superscript II (Life Technologies, Inc.) for 2 h at 42 °C (19).
The reaction products were run on a denaturing polyacrylamide gel along
with a sequencing reaction using the ~2.8-kb promoter clone as
template primed with PE1 to determine length of the extended
products.
Fig. 2.
S1 nuclease protection analysis to identify
the transcription initiation site. A single-stranded ~290-bp 5
genomic fragment of 7 genomic clone G2, extending from the
initiation methionine to 115, was used as the probe for S1 analysis.
This probe contained 175 bp of the untranslated region and 115 bp of
the 5 -flanking sequences. The probe was end-labeled with T4
polynucleotide kinase and hybridized with 40 µg of total RNA from
K1735 cells (lane 3) and from C2C12 myoblasts (lane
1) and myotubes (lane 2). The RNA-DNA hybrid was
subjected to S1 digestion, and the protected products were analyzed on
a denaturing 6% polyacrylamide gel. Digested probe only was run in
lane 4. The sequence (order of sequencing reactions is TCGA)
of the two transcription start sites is denoted by ** and *.
Oligonucleotide PE1 was used as the primer for sequencing
analysis.
[View Larger Version of this Image (79K GIF file)]
RNA Isolation, Northern Blot
Total RNA was isolated by the
guanidinium-isothiocyanate/phenol method (20). RNA samples (15 µg)
were electrophoresed in a 1.2% agarose gel containing formaldehyde.
After electrophoresis, the RNA was transferred to nylon membranes
(Nytran+, Schleicher & Schuell) by capillary blotting and fixed to the
filter by exposure to UV light. The RNA was hybridized with a ~900-bp
7 cDNA fragment labeled with 32P using a Multiprime
DNA labeling kit (Amersham Corp.). To control for differences in RNA
loading, blots were re-probed with a 300-bp 32P-labeled
mouse glyceraldehyde-3-phosphate dehydrogenase cDNA fragment.
Hybridizations were carried out at 42 °C in 50% formamide, 5 × SSC, 5 × Denhardt's, 0.1% SDS, and 300 µg/ml salmon sperm
DNA. Filters were washed twice in 1 × SSC, 0.1% SDS at room
temperature and once at 65 °C in 0.1 × SSC, 0.1% SDS. Filters
were exposed to x-ray film at 80 °C with intensifying screens.
RESULTS AND DISCUSSION
Isolation of a 5 7 Genomic Clone
The 5 -flanking
sequences of genes, which contain promoter and enhancer elements,
regulate developmental and tissue-specific gene transcription. In order
to study the elements governing the tissue-specific and developmental
regulation of the 7 integrin subunit in more detail, we screened a
mouse genomic library in Fix II for the 5 -untranslated and
5 -flanking region of the 7 gene. Using a cDNA fragment that
contained sequences near the start of translation, we isolated one
positive clone and plaque-purified it. A subclone (designated clone G2)
that contained the 5 -untranslated region and 5 -flanking region of the
7 gene was examined further.
Mapping the Site of Transcription Initiation
Partial
restriction enzyme mapping and Southern blotting indicated that clone
G2 contains ~7 kb (Fig. 1) of sequence. To map the
site of transcription initiation, we used a combination of primer
extension and S1 nuclease analysis. S1 nuclease analysis was performed
by hybridizing a 5 end-labeled 290-bp genomic fragment (extending from
115 to +175) with total mRNA from mouse melanoma K1735 cells,
C2C12 myoblasts, and C2C12 myotubes (Fig. 2). Two
protected fragments were identified in all cell lines indicating that
there are two major transcriptional start sites, located 170 and 176 bp, respectively, upstream of the translation initiation methionine
(Figs. 2 and 4). This result also indicates that there is no change in
the transcription start positions in myoblast versus
myotubes. To confirm the S1 analysis result, we performed primer
extension with antisense oligonucleotide PE1 (Figs. 3
and 4). Primer extension identified two major extension
products whose sizes matched the two transcriptional initiation sites
determined by S1 nuclease analysis. Previously, we reported the
isolation and characterization of the mouse 7 cDNA (10). The
start of the 5 -untranslated region, as determined by 5 rapid
amplification of cDNA ends, of the full-length 7 cDNA
terminated at the same position as the 170-bp fragment identified in S1
nuclease and primer extension analysis. Thus, by S1 analysis and primer
extension, we have confirmed the presence of two primary transcription
initiation sites at 176 and 170 bp upstream of the initiation
methionine. Multiple transcriptional start sites are not uncommon for
promoter regions lacking a TATA box.
Fig. 1.
Partial restriction enzyme map of the
5 -flanking region, exon 1, intron 1, and exon 2 of the 7 integrin
gene. The top line demonstrates the partial restriction
map of the mouse 7 genomic subclone G2. The solid line
represents the 5 -flanking sequences and the first intron, whereas
exons 1 and 2 are depicted by rectangles. This subclone is
comprised of ~7 kilobases, containing 2.8 kb of the 7 5 -flanking
region, exon 1, intron 1, and exon 2. The position of exon 1 and exon 2 was assigned by sequencing. The arrow at +1 denotes the
transcription start site.
[View Larger Version of this Image (5K GIF file)]
Fig. 4.
The nucleotide sequence of the 5 -flanking
region and exon 1 of the 7 gene. The sequence is in the
standard 5 to 3 order. Exon 1 extends from the transcription start
site, denoted by +1, to the intron/exon border at the 3 end
of the sequence. Sequences encoding the protein portion of exon 1 are
in italics; the translation start site is denoted by
Met. Sequences underlined and labeled correspond
to consensus and putative binding sites for transcription factors. The
position of the oligonucleotide (PE1) used for primer extension
analysis and sequencing is underlined with a dashed
line.
[View Larger Version of this Image (76K GIF file)]
Fig. 3.
Primer extension analysis to confirm the
transcription start site of the 7 integrin gene. Primer
extension was performed using antisense oligonucleotide PE1. PE1 was
end-labeled with T4 polynucleotide kinase, and
105-106 cpm was hybridized to 10-15 µg of
total RNA from C2C12 myoblasts (lane 2) and C2C12 myotubes
(lane 3). After a 16-h hybridization the complementary DNA
was extended with Superscript II (reverse transcriptase), and the sizes
of the extended products were determined on a 6% polyacrylamide gel.
Lane 1 is extension of primer only. The length of the
reaction products was determined by running a sequencing reaction
(T, lane 4; C, lane 5) using the ~2.8-kb
promoter clone as template and primed with PE1.
[View Larger Version of this Image (47K GIF file)]
Sequence analysis indicated that the genomic clone G2 contains ~2.8
kb of the 5 -flanking sequence, the first exon, all of intron 1, and
exon 2. Designating the 176 initiation site as the start of
transcription and performing sequence analysis indicated that exon 1 is
comprised of 383 bp, of which 212 bp encodes the signal sequence and
translation start site (Figs. 1 and 2). Exon 1 is followed by ~3.5 kb
that makes up the first intron. Adjacent to this intron is an open
reading frame of ~124 bp that encodes exon 2. Similar genomic
organization is seen for other integrin genes (21, 22). Each of the
intron/exon boundaries analyzed (Fig. 2) conformed to the consensus 5
and 3 splice sequences, G(T/A)G (23).
The 5 -Flanking Region of the a7 Gene
The promoter regions
for a number of the integrin receptor genes ( II , 2, 4,
5, 6,3 v, 1, 2, 3, 7,
CD11a, CD11b, CD11c and CD18) have recently been identified and
characterized (24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37). The 5 -flanking sequences near the
transcriptional start site of the 7 gene, like the other identified
integrin promoters (except the human 4 promoter) (26), lacks both a
TATA and a CCAAT box (Fig. 4). Transcription from promoters without
TATA and CCAAT boxes can initiate at a consensus sequence defined as
the initiator sequence (Inr) (38). The original consensus Inr
sequences, as designated by the terminal deoxynucleotide transferase
gene (38), closely resemble the initiator sequences found in the
II , 5, CD11a, and CD11b 5 -flanking regions (24, 27, 32, 34).
The sequence at the initiation site for 7, like that for the 2
integrin gene, diverges somewhat from the consensus Inr sequence
(consensus, CTCANTCT; 7, CTGGGTCC) (Fig. 2; 25). In addition, like
the promoters for 5 and 6,3 the transcription start
site for the 7 gene appears to start not in the Inr-like sequences
but in close proximity to it (27). In fact, the start site at 170 bp 5
of the translational start site is only 2 bp upstream of the Inr-like
sequence (Fig. 4). Typically, the Inr, in combination with nearby
Sp1/GC boxes (38, 39), directs correct transcription initiation.
Located within 90 bp of the transcription start sites of the 7 gene
are three tandem sequences for Sp1 (Fig. 4). Further upstream, at
positions 165 and 194, are two additional Sp1 sites. All five Sp1
sites are located in the 5 -flanking region between +1 and 238. This
region is composed of 70% guanine (G) and cytosine (C) residues with
three HpaII restriction enzyme sites (CCGG). Similar G/C
rich regions, termed CpG islands, have been described for the 2,
5, and 63 promoters (25, 27). When methylated, G/C
islands can affect chromatin structure and thus influence the
regulation and tissue specificity of gene expression (40, 41).
In addition to the Inr sequence and the five putative Sp1 binding
sites, the ~2.8-kb sequence of the 7 5 -flanking region contains
numerous binding sites for ubiquitous, developmental, and cell
type-specific transcription factors. Binding sites for ubiquitous
transcription factors include three sites for AP-1 at 2100, 838,
and 109 and four AP-2/AP-2-like sites at 955, 147, 127, and +20
(Fig. 4). Transcription is mediated from AP-1 and AP-2 sites via the
phorbol ester/diacylglycerol-activated protein kinase C pathway,
whereas the cAMP pathway induces gene transcription from AP-2 (25, 42).
Whether these two pathways play a role in 7 transcription remains to
be determined. AP-1 and AP-2 sites are present in a number of the
integrin genes including 2, 4, 5, and CD11c and a number of
muscle-specific genes such as muscle creatine kinase and desmin
(25, 26, 27, 36). In addition to sequence recognition sites for AP-1 and
AP-2, two GATA sites are present, at position 327 (GATA-like) and
756 (consensus site) (Fig. 4). GATA sites bind the heart progenitor
cell-specific transcription factor, GATA-4, which has recently been
shown to be necessary for cardiac muscle cell development (43). This
factor may be important in regulating expression of 7 in late fetal
and adult heart. A second putative developmental binding site, for the
ets transcription factor, is located at position 752 (Fig.
4). Recently, the ets DNA-binding domain was shown to be
required for high level -enolase promoter activity in myoblasts and
to be important for repression of expression in fibroblasts (44).
Further analysis of the 5 -flanking region of the 7 gene revealed a
number of potential cell-specific and differentiation-related
regulatory sequence elements. There are eight consensus E-boxes
(CANNTG), located at 2539, 2210, 2146, 2127, 2059, 2032,
1449, and 571 (Fig. 4). E-boxes are the DNA-binding sites for a
family of muscle-specific bHLH proteins (45, 46). The members of this
family, comprised of MyoD, myf5, MRF4, and myogenin, are able to
convert nonmuscle cells into myogenic lineages, can direct expression
of many muscle-specific genes including desmin, troponin I, M-creatine
kinase, are expressed only in skeletal (not cardiac) muscle, and are
believed to play a major role in muscle differentiation (47, 48, 49).
Previously, it has been shown that the 7 mRNA level in rat L8
myoblast is increased 3-4-fold upon conversion of myoblasts to
myotubes (11). This increase in 7 mRNA is paralleled by
increases in the bHLH transcription factor myogenin. In addition, 7
expression is seen in the developing embryo during the time the MRFs,
MyoD and myogenin are expressed (50, 51, 52). These results suggest that
the E-boxes in the promoter region of 7 may play an important role
in 7 expression during muscle development and differentiation.
Finally, it is interesting to note that the E-box at 2127 contains
the symmetrical core consensus sequences, CAGCTG, that have been shown
by in vitro studies to be the preferred binding sites for
MyoD (53).
A/T-rich sites, termed the MADS box, CArG box, and the serum response
element, have recently been identified in a number of muscle-specific
genes (54, 55, 56). Several factors that are important in embryogenesis and
skeletal and heart muscle development (Mhox, Oct 1) and are required
for transcriptional activity in skeletal and cardiac myocytes (MEFS,
Mef2a-d, serum response factor) bind to these sequence elements (56,
57). There are five A/T-rich sites in the 7 promoter (Fig. 4) that
may function as binding sites for these factors and possibly regulate
7 expression in skeletal and/or cardiac tissue. Finally, at position
585 is an MCAT-like sequence. The MCAT motif is the binding site for
transcriptional enhancer factor-1 (TEF-1) or a TEF-1-like protein (58,
59) and is believed to be critical in directing cardiac-specific
expression (60, 61).
The 5 -Flanking Region of the 7 Gene Acts as a Promoter and
Directs Cell-specific Transcription in Transfection Assays
To
determine whether the 5 -flanking region of the mouse 7 gene could
act as a promoter and direct transcription in a cell-specific and
differentiation-specific manner, we ligated the ~2.8-kb genomic
fragment upstream of the CAT gene in pCAT-Basic (see Fig. 6 and
``Experimental Procedures''). The CAT-promoting activity of this
fragment was determined by transiently transfecting the ~2.8-kb/CAT
(p2.8kb-CAT) construct into HtLM2 mouse breast carcinoma cells and
C2C12 myoblasts. Replicating C2C12 myoblasts express moderate levels of
7 mRNA (Fig. 5). In contrast, the HtLM2 mouse
breast carcinoma cell line is of epithelial origin and does not express
7, as determined by Western blotting (not shown). The 7 gene
5 -flanking region directs CAT enzymatic activity in C2C12 myoblasts.
When normalized for transfection efficiency, the ~2.8-kb/CAT
construct generated ~14-fold greater activity than the CAT-structural
sequences alone in C2C12 myoblasts (Fig. 6). In
contrast, the same construct showed no activity in HtLM2 mouse breast
carcinoma cells. Thus, the ~2.8-kb 5 -flanking sequence of the 7
gene can function as a promoter and demonstrates cell-specific
activity.
Fig. 6.
Deletion analysis of the 5 -flanking
sequences of the 7 integrin gene. A, diagram of 7
promoter-CAT constructs. The construct p2.8kb-CAT contained the entire
5 -flanking sequence of the murine 7 gene shown in Fig. 2 ligated to
the CAT structural gene. Constructs p1.22kb-CAT ( 982 to +175),
p600bp-CAT ( 439 to +175), p400bp-CAT ( 223 to +175), p300bp-CAT
( 114 to +175), and p200bp-CAT ( 23 to +175) were deletion mutants
derived from p2.8kb-CAT. B, promoter activity in C2C12
myoblasts. All constructs in A were transfected using
Lipofectamine in parallel with pCAT-control (Promega), which contains
the SV-40 promoter and enhancer, into the mouse myoblast C2C12 cell
line. Cotransfection of pGL2, which contains the luciferase gene, was
used to control for transfection efficiency. After 72 h in growth
medium cell extracts were assayed using a colorimetric CAT-ELISA that
detects the fully native, enzymatically active (trimeric) form as well
as the denatured, enzymatically inactive (monomeric) form of the CAT
protein. Relative CAT activity of the constructs, which is the average
of three to five independent experiments, is plotted. Bars
represent range of experimental values. C, promoter activity
in C2C12 myotubes. All deletion constructs were transfected as
described in B. Cultures were switched to DM in order to
stimulate the formation of myotubes. After 72 h of incubation,
cell extracts were isolated and assayed as in B.
D, promoter activity in the mouse epithelial cell line
HtLM2. All constructs in A were transfected into the murine
breast carcinoma cell line HtLM2 and after 72 h cell extracts were
assayed as described in B. The results presented are the
average of two independent transfections.
[View Larger Version of this Image (34K GIF file)]
Fig. 5.
Induction of 7 mRNA expression during
C2C12 muscle cell differentiation. Northern blot analysis. C2C12
myoblasts were plated on growth medium, and the following day the cells
were switched to differentiation medium. Total RNA was isolated at day
0 (while in growth medium) and at 2, 4, or 6 days after induction of
myotube formation. The RNA was analyzed by Northern blot using a murine
7 cDNA probe. The line indicates the position of the
~4.8-kb 7 mRNA transcript. GAPDH,
glyceraldehyde-2-phosphate dehydrogenase.
[View Larger Version of this Image (40K GIF file)]
To characterize the 5 -flanking region required for either myoblast- or
myotube-specific promoter activity, 5 deletion mutants of p2.8kb-CAT
( 2669 to +175), p1.22kb-CAT ( 982 to +175), p600bp-CAT ( 439 to
+175), p400bp-CAT ( 223 to +175), p300bp-CAT ( 114 to +175), and
p200bp-CAT ( 23 to +175) were constructed (Fig. 6). We assayed the
promoter deletion constructs in C2C12 myoblasts since they display
basal levels of 7 expression as myoblasts and an increasing level of
7 mRNA when induced to form myotubes (Fig. 5). All deletion
constructs directed CAT expression in both C2C12 myoblasts and
myotubes. The p200bp-CAT construct, which contains only 23 bp 5 of the
transcription start site, displayed the lowest promoter activity in
both myoblast and myotubes. In myotubes this construct directed 2-fold
higher enzymatic activity than in myoblasts. In contrast, the same
construct was unable to direct CAT activity in HtLM2 mouse breast
carcinoma cells. The addition of ~96 bp further 5 in the p300bp-CAT
construct resulted in a ~14-fold increase in enzymatic activity in
both myoblasts and myotubes. This construct directed the greatest CAT
activity of all promoter deletion constructs. The p300bp-CAT construct
displayed the highest activity in the HtLM2 mouse breast carcinoma
cells as well. Comparison of the activity of p300bp-CAT in myoblasts
and myotubes indicated that it was capable of directing ~2-fold
higher CAT expression in myotubes than in myoblasts. A number of
possible factors may be important for the increase in promoter activity
displayed by this construct. For example, located within p300bp-CAT are
three tandem Sp1/GC boxes, an AP-1 site, and an ets-like
site (Fig. 2). These sites, either alone or in combination, may play a
role in this increased activity.
The p400bp-CAT construct appears to contain a negative element, as
indicated by the 3.5- and 12-fold reduction in CAT activity in myoblast
and myotubes, respectively (Fig. 6). No consensus sequences for known
negative regulatory elements or silencers are located in this region.
Either an unidentified element is present in this construct or other
regulatory elements located further upstream are required for efficient
expression of these sequences. In HtLM2 cells, this construct also
directed decreased enzymatic activity. In contrast, the addition of 200 bp 5 in p600bp-CAT only slightly elevated the CAT activity in
myoblasts but increased the enzyme level 5-fold in C2C12 myotubes.
Comparison of the CAT activity stimulated by this construct in
myoblasts and myotubes showed only a modest increase in myotubes. In
the mouse breast epithelial cell line, little to no activity was
elicited by this construct.
Both the p1.22kb-CAT and p2.8kb-CAT deletion constructs were able to
efficiently direct transcription in both myoblasts and myotubes (Fig.
6). The p1.22kb-CAT was able to promote ~13- and ~10-fold enzymatic
activity in myoblasts and myotubes, respectively, in comparison to
p200bp-CAT. p1.22kb-CAT showed only slightly less activity than the
highest-promoting deletion construct, p300bp-CAT. p1.22kb-CAT contains
an E-box and an A/T-rich region, which may explain the higher CAT
activity of this construct compared with p600bp-CAT. p2.8kb-CAT was
able to induce ~10- and ~7-fold higher CAT activity in myoblasts
and myotubes, respectively, as compared with p200bp-CAT. The increased
expression elicited by both constructs suggests that a positive
regulatory element or an enhancer-like element may be located 5 of the
p400bp-CAT construct. Neither construct was able to direct enzymatic
activity in the murine breast carcinoma cell line, indicating that both
constructs contain sequence elements required for tissue-specific
expression. p1.22-CAT could direct nearly 2-fold more transcription in
myotubes than in myoblasts, which may be due to the E-box. The
p2.8kb-CAT that contains all E-boxes was only able to promote
~1.3-fold more activity in myotubes than myoblast. The 2- and
1.3-fold induction elicited by these constructs is of borderline
relevance given the complexity of the CAT reporter assay system,
suggesting other factors may account for the large increase in 7
mRNA during myotube differentiation. It is possible that this
increase may be a due to a combination of factors, for example elevated
promoter activity and mRNA stability. Taken together, these results
indicate that the 5 -flanking region of the 7 gene functions as a
promoter and shows the expected tissue-specific and developmentally
regulated activity. Studies are ongoing to determine which sequence
elements and post-transcriptional events are involved in this
regulation.
As a start to determine the elements involved in the regulation of 7
in myoblasts and myotubes, we undertook trans-activation
assays (see ``Experimental Procedures''). trans-Activation
assays have been routinely used to determine if the family of
muscle-specific bHLH factors can activate transcription from
muscle-specific gene promoters (47, 62, 63, 64, 65). Vectors expressing MyoD,
myogenin, MRF4, and myf5 were transiently cotransfected into 10T1/2
fibroblast cells with the 7 promoter-CAT fusion construct,
p2.8kb-CAT. As a negative control the p2.8kb-CAT construct was
cotransfected with pGEM-11fZ(+). A number of reports have previously
demonstrated that bHLH transcription factors can differentially
trans-activate muscle-specific genes. For example, the subunit gene of the acetylcholine receptor is efficiently
trans-activated by myogenin and myf5 whereas MRF4
preferentially trans-activates the subunit gene promoter
(62, 66). Only myogenin and MyoD were able to efficiently
trans-activate the 7 promoter-CAT construct (Fig.
7). Myogenin trans-activated the promoter by
~2-fold whereas MyoD was able to trans-activate by nearly
4-fold, indicating that both of these factors may play a role in 7
gene expression during muscle development. Co-transfection of MyoD,
myogenin, and p2.8kb-CAT at the same time did not show any additive or
synergistic effects (data not shown). It is possible that other
factors, like the ubiquitously expressed E-proteins, form heterodimers
with these factors during transactivation of the 7
promoter. p2.8kb-CAT alone produced very little activity in 10T1/2
cells. These results are supported by recent work with myoblasts
showing that 7 expression levels increase during myotube formation
in a pattern that is similar to increases in myogenin expression (11).
In addition, when MyoD was transfected into 10T1/2 cells, it
significantly increased the level of 7 mRNA expression. In
contrast, no 7 expression was seen in the untransfected 10T1/2 cells
(Fig. 8). Taken together, these results demonstrate that
the bHLH factor MyoD (and myogenin) activates 7 gene transcription
and that this activation appears to be mediated by the interaction of
MyoD (and myogenin) with the 7 gene promoter. Finally, it has
recently been shown that transfection of MRF4 into 10T1/2 cells caused
a slight induction in 7 mRNA expression (11). This is in
contrast to our trans-activation assays that indicated that
MRF4 could not directly activate the 7 promoter. This apparent
discrepancy between the trans-activation of the native gene
as compared with the reporter gene may be the result of a single
trans-activating factor generating a new or novel
transcription start site. It is also possible that MRF4 may activate
7 expression through an indirect pathway (67).
Fig. 7.
trans-Activation of the 7 promoter
by bHLH transcription factors. Expression plasmids (pEMSV)
encoding myogenin (myoG), myf5, MyoD, or MRF4 were cotransfected into
10T1/2 cells along with p2.8kb-CAT. The data are expressed as fold
activation of the cotransfection of the muscle-specific transcription
factors over the p2.8kb-CAT cotransfected with pGEM-11Zf(+) alone. CAT
activity in cell extracts was determined by a CAT-ELISA assay. The
results presented are the average of two independent
co-transfections.
[View Larger Version of this Image (36K GIF file)]
Fig. 8.
Induction of 7 mRNA expression by
MyoD. Northern blot analysis. 10T1/2 fibroblasts untransfected
(lane 1) or transfected with pEMSV-MyoD (lane 2)
and plated into differentiated medium. After 72 h, total RNA was
prepared and analyzed by Northern blot analysis using an 7 cDNA
probe. The line indicates the position of the ~4.8-kb 7
mRNA transcript. GAPDH, glyceraldehyde-2-phosphate
dehydrogenase.
[View Larger Version of this Image (29K GIF file)]
In summary, we have identified the murine 7 gene promoter and its
activity in C2C12 myoblasts and myotubes. Characterization of the 7
5 -flanking region of the murine gene revealed that the 7 integrin
subunit's expression is modulated by a number of positive and negative
regulatory elements that confer cell type-specific and
development-specific expression. We have located regions that contain
possible enhancer and silencer elements and have identified potential
transcription factors that may regulate 7 expression during muscle
development. Further work will be required to define how these elements
as well as the regulatory sequences and binding factors are important
in controlling the tissue-specific and developmentally regulated
expression of the 7 integrin subunit.
FOOTNOTES
*
This work was supported by Grants from the National
Institutes of Health CA51884, DE10564, and DE10306 (to R. H. K.) and
by National Cancer Institute Research Fellowship Award CA66272 (to
B. L. Z.). The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
``advertisement'' in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) U60419[GenBank].
To whom correspondence should be addressed: Dept. of Stomatology,
Box 0512/Rm. HSW-604, University of California San Francisco, San
Francisco, CA 94143-0512. Tel.: 415-476-3275; Fax: 415-476-4204.
1
D. M. Ramos, N. Waleh, M. P. Vu, B. L. Ziober,
C. C. Yao, and R. H. Kramer, submitted for publication.
2
The abbreviations used are: PCR, polymerase
chain reaction; bHLH, basic helix loop helix; CAT, chloramphenicol
acetyltransferase; bp, base pair(s); kb, kilobase pair(s); Pipes,
1,4-piperazinediethanesulfonic acid; Inr, initiator sequence.
3
C.-S. Lin and R. H. Kramer, submitted for
publication.
Acknowledgments
We would like to thank Drs. Eric Olsen,
Harold Weintraub, Hans Arnold, and Steve Konieczny for providing us
with the vectors expressing myogenin, MyoD, myf5, and MRF4,
respectively. We are also grateful for the technical assistance from
Yao Qi Chen, Rachel Squillace, and Truc Huynh.
REFERENCES
-
Hynes, R. O.
(1992)
Cell
69,
11-25
[CrossRef][Medline]
[Order article via Infotrieve]
-
Ruoslahti, E.,
Reed, J. C.
(1994)
Cell
77,
477-478
[CrossRef][Medline]
[Order article via Infotrieve]
-
Rosales, C.,
O'Brien, V.,
Kornberg, L.,
Juliano, R.
(1995)
Biochim. Biophys. Acta
1242,
77-98
[Medline]
[Order article via Infotrieve]
-
Bosman, F. T.
(1993)
Histochem. J.
25,
469-477
[CrossRef][Medline]
[Order article via Infotrieve]
-
Kramer, R. H.,
McDonald, K. A.,
Vu, M. P.
(1989)
J. Biol. Chem.
264,
15642-15649
[Abstract/Free Full Text]
-
Kramer, R. H.,
Vu, M. P.,
Cheng, Y. P.,
Ramos, D. M.,
Timpl, R.,
Waleh, N.
(1991)
Cell Regul.
2,
805-817
[Medline]
[Order article via Infotrieve]
-
Collo, G.,
Starr, L.,
Quaranta, V.
(1993)
J. Biol. Chem.
268,
19019-19024
[Abstract/Free Full Text]
-
Kaufman, S. J.,
Foster, R. F.,
Haye, K. R.,
Faiman, L. E.
(1985)
J. Cell Biol.
100,
1977-1987
[Abstract/Free Full Text]
-
Mark, H.,
Durr, J.,
Sonnenberg, A.,
Mark, K.,
Deutzmann, R.,
Goodman, S. L.
(1991)
J. Biol. Chem.
266,
23593-23601
[Abstract/Free Full Text]
-
Ziober, B. L.,
Vu, M. P.,
Waleh, N.,
Crawford, J.,
Lin, C.-S.,
Kramer, R. H.
(1993)
J. Biol. Chem.
268,
26773-26783
[Abstract/Free Full Text]
-
Song, W. K.,
Wang, W.,
Foster, R. F.,
Bielser, D. A.,
Kaufman, S.
J.
(1992)
J. Cell Biol.
117,
643-650
[Abstract/Free Full Text]
-
Sutherland, A. E.,
Calarco, P. G.,
Damsky, C. H.
(1993)
Development
119,
1175-1186
[Abstract]
-
Song, W. K.,
Wang, W.,
Sato, H.,
Bielser, D. A.,
Kaufman, S. J.
(1993)
J. Cell. Sci.
106,
1139-1152
[Abstract]
-
Maniatis, T.,
Fritsch, E. F.,
Sambrook, J.
(1989)
Molecular Cloning: A Laboratory Manual
, Cold Spring Harbor Laboratory, Cold
Spring Harbor, NY
-
Davis, R. L.,
Weintraub, H.,
Lassar, A. B.
(1987)
Cell
51,
987-1000
[CrossRef][Medline]
[Order article via Infotrieve]
-
Edmondson, D. G.,
Olsen, E. N.
(1989)
Genes Dev.
3,
628-640
[Abstract/Free Full Text]
-
Rhodes, S. J.,
Konieczny, S. F.
(1989)
Genes Dev.
3,
2050-2061
[Abstract/Free Full Text]
-
Brann, T. E.,
Boder, E.,
Winter, B.,
Rosenthal, N.,
Arnold, H. H.
(1990)
EMBO J.
9,
821-831
[Medline]
[Order article via Infotrieve]
-
Bodner, M.,
Karin, M.
(1987)
Cell
50,
267-275
[CrossRef][Medline]
[Order article via Infotrieve]
-
Chomczynski, P.,
Sacchi, N.
(1987)
Anal. Biochem.
162,
156-159
[Medline]
[Order article via Infotrieve]
-
Yang, J. T.,
Rayburn, H.,
Hynes, R. O.
(1994)
Development
121,
549-560
[Abstract]
-
Yang, J. T.,
Rayburn, H.,
Hynes, R. O.
(1993)
Development
119,
1093-1105
[Abstract]
-
Mount, S. M.
(1982)
Nucleic Acids Res.
10,
459-472
[Abstract/Free Full Text]
-
Prandini, M.-H.,
Uzan, G.,
Martin, F.,
Thevenon, D.,
Marguerie, G.
(1992)
J. Biol. Chem.
267,
10370-10374
[Abstract/Free Full Text]
-
Zutter, M. M.,
Santoro, S. A.,
Painter, A. S.,
Tsung, Y. L.,
Gafford, A.
(1994)
J. Biol. Chem.
269,
463-469
[Abstract/Free Full Text]
-
Rosen, G. D.,
Birkenmeier, T. M.,
Dean, D. C.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
4094-4098
[Abstract/Free Full Text]
-
Birkenmeier, T. M.,
McQuillan, J. J.,
Boedeker, E. D.,
Argraves, W. S.,
Ruoslahti, E.,
Dean, D. C.
(1991)
J. Biol. Chem.
266,
20544-20549
[Abstract/Free Full Text]
-
Donahue, J. P.,
Sugg, N.,
Hawiger, J.
(1994)
Biochim. Biophys. Acta
1219,
228-232
[Medline]
[Order article via Infotrieve]
-
Cervella, P.,
Silengo, L.,
Pastore, C.,
Altruda, F.
(1993)
J. Biol. Chem.
268,
5148-5155
[Abstract/Free Full Text]
-
Bottinger, E. P.,
Shelley, C. S.,
Farokhzad, O. C.,
Arnaout, M. A.
(1994)
Mol. Cell. Biol.
14,
2604-2615
[Abstract/Free Full Text]
-
Villa, G. M.,
Li, L.,
Rielly, F.,
Bray, P. F.
(1994)
Blood
83,
668-676
[Abstract/Free Full Text]
-
Leung, E.,
Mead, P. E.,
Yuan, Q.,
Jiang, W. M.,
Watson, J. D.,
Krissansen, G. W.
(1993)
Int. Immunol.
5,
551-558
[Abstract/Free Full Text]
-
Nueda, A.,
Lopez-Cabrera, M.,
Vara, A.,
Corbi, A. L.
(1993)
J. Biol. Chem.
268,
19305-19311
[Abstract/Free Full Text]
-
Hickstein, D. D.,
Baker, D. M.,
Gollahon, K. A.,
Back, A. L.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
2105-2109
[Abstract/Free Full Text]
-
Lopez-Cabrera, M.,
Nueda, A.,
Vara, A.,
Garcia-Aguilar, J.,
Tugores, A.,
Corbi, A. L.
(1993)
J. Biol. Chem.
268,
1187-1193
[Abstract/Free Full Text]
-
Rosmarin, A. G.,
Levy, R.,
Tenen, D. G.
(1992)
Blood
79,
2598-2604
[Abstract/Free Full Text]
-
Agura, E. D.,
Howard, M.,
Collins, S. J.
(1992)
Blood
79,
602-609
[Abstract/Free Full Text]
-
Smale, S. T.,
Baltimore, D.
(1989)
Cell
57,
103-113
[CrossRef][Medline]
[Order article via Infotrieve]
-
Dynan, W. S.,
Tjian, R.
(1983)
Cell
35,
79-87
[CrossRef][Medline]
[Order article via Infotrieve]
-
Brutlag, D. L.
(1980)
Annu. Rev. Genet.
14,
121-144
[CrossRef][Medline]
[Order article via Infotrieve]
-
Hamada, H.,
Petrino, M. G.,
Kakunaga, T.
(1982)
Proc. Natl. Acad. Sci. U. S. A.
79,
6465-6469
[Abstract/Free Full Text]
-
Imagawa, M.,
Chiu, R.,
Karin, M.
(1987)
Cell
51,
251-260
[CrossRef][Medline]
[Order article via Infotrieve]
-
Grepin, C.,
Robitaille, L.,
Antakly, T.,
Nemer, M.
(1995)
Mol. Cell. Biol.
15,
4095-4102
[Abstract]
-
Taylor, J. M.,
Davies, J. D.,
Peterson, C. A.
(1995)
J. Biol. Chem.
270,
2535-2540
[Abstract/Free Full Text]
-
Olsen, E. N.
(1990)
Genes Dev.
4,
1454-1461
[Free Full Text]
-
Wright, W. E.
(1992)
Curr. Opin. Genet. Dev.
2,
243-248
[CrossRef][Medline]
[Order article via Infotrieve]
-
Li, H.,
Capetanaki, Y.
(1993)
Nucleic Acids Res.
21,
335-343
[Abstract/Free Full Text]
-
Trask, R. V.,
Koster, J. C.,
Ritchie, M. E.,
Billadello, J. J.
(1992)
Nucleic Acids Res.
20,
2313-2320
[Abstract/Free Full Text]
-
Christensen, T. H.,
Prentice, H.,
Gahlmann, R.,
Kedes, L.
(1993)
Mol. Cell. Biol.
13,
6752-6765
[Abstract/Free Full Text]
-
George-Weinstein, M.,
Foster, R. F.,
Gerhart, J. V.,
Kaufman, S. J.
(1993)
Dev. Biol.
156,
209-229
[CrossRef][Medline]
[Order article via Infotrieve]
-
Sassoon, D.,
Lyons, G.,
Wright, W. E.,
Lin, V.,
Lasser, A.,
Weintraub, H.,
Buckingham, M.
(1989)
Nature
341,
303-307
[CrossRef][Medline]
[Order article via Infotrieve]
-
Ott, M. O.,
Boder, E.,
Lyons, G.,
Arnold, H.,
Buckingham, M.
(1991)
Development
111,
1097-1107
[Abstract/Free Full Text]
-
Blackwell, K. T.,
Weintraub, H.
(1990)
Science
250,
1104-1110
[Abstract/Free Full Text]
-
Amacher, S. L.,
Buskin, J. N.,
Hauschka, S. D.
(1993)
Mol. Cell. Biol.
13,
2753-2764
[Abstract/Free Full Text]
-
Vincent, C. K.,
Gualberto, A.,
Patel, C. V.,
Walsh, K.
(1993)
Mol. Cell. Biol.
13,
1264-1272
[Abstract/Free Full Text]
-
Cserjesi, P.,
Lilly, B.,
Hinkley, C.,
Perry, M.,
Olsen, E. N.
(1994)
J. Biol. Chem.
269,
16740-16745
[Abstract/Free Full Text]
-
Pollock, R.,
Treisman, R.
(1991)
Genes Dev.
5,
2327-2341
[Abstract/Free Full Text]
-
Farrance, I. K. G.,
Mar, J. H.,
Ordahl, C. P.
(1992)
J. Biol. Chem.
267,
17234-17240
[Abstract/Free Full Text]
-
Shimizu, N.,
Smith, G.,
Izumo, S.
(1993)
Nucleic Acids Res.
21,
4103-4110
[Abstract/Free Full Text]
-
Mar, J. H.,
Ordahl, C. P.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
6404-6408
[Abstract/Free Full Text]
-
Mar, J. H.,
Ordahl, C. P.
(1990)
Mol. Cell. Biol.
10,
4271-4283
[Abstract/Free Full Text]
-
Sunyer, T.,
Merlie, J. P.
(1993)
J. Neurosci. Res.
36,
224-234
[CrossRef][Medline]
[Order article via Infotrieve]
-
Parmacek, M. S.,
Ip, H. S.,
Jung, F.,
Shen, T.,
Martin, J. F.,
Vora, A.
J.,
Olson, E. N.,
Leiden, J. M.
(1994)
Mol. Cell. Biol.
14,
1870-1885
[Abstract/Free Full Text]
-
Mak, K. L.,
To, R. Q.,
Kong, Y.,
Konieczny, S. F.
(1992)
Mol. Cell. Biol.
12,
4334-4346
[Abstract/Free Full Text]
-
Banerjee-Basu, S.,
Buonanno, A.
(1993)
Mol. Cell. Biol.
13,
7019-7028
[Abstract/Free Full Text]
-
Durr, I.,
Numberger, M.,
Berberich, C.,
Witzemann, V.
(1994)
Eur. J. Biochem.
224,
353-364
[Medline]
[Order article via Infotrieve]
-
Black, B. L.,
Martin, J. F.,
Olsen, E. N.
(1995)
J. Biol. Chem.
270,
2889-2892
[Abstract/Free Full Text]
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J. E. Rooney, P. B. Gurpur, Z. Yablonka-Reuveni, and D. J. Burkin
Laminin-111 Restores Regenerative Capacity in a Mouse Model for {alpha}7 Integrin Congenital Myopathy
Am. J. Pathol.,
January 1, 2009;
174(1):
256 - 264.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Liu, D. J. Burkin, and S. J. Kaufman
Increasing {alpha}7{beta}1-integrin promotes muscle cell proliferation, adhesion, and resistance to apoptosis without changing gene expression
Am J Physiol Cell Physiol,
February 1, 2008;
294(2):
C627 - C640.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Jethanandani and R. H. Kramer
{alpha}7 Integrin Expression Is Negatively Regulated by {delta}EF1 during Skeletal Myogenesis
J. Biol. Chem.,
October 28, 2005;
280(43):
36037 - 36046.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Yafe, S. Etzioni, P. Weisman-Shomer, and M. Fry
Formation and properties of hairpin and tetraplex structures of guanine-rich regulatory sequences of muscle-specific genes
Nucleic Acids Res.,
May 20, 2005;
33(9):
2887 - 2900.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Burkin, G. Q. Wallace, D. J. Milner, E. J. Chaney, J. A. Mulligan, and S. J. Kaufman
Transgenic Expression of {alpha}7{beta}1 Integrin Maintains Muscle Integrity, Increases Regenerative Capacity, Promotes Hypertrophy, and Reduces Cardiomyopathy in Dystrophic Mice
Am. J. Pathol.,
January 1, 2005;
166(1):
253 - 263.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-T. Chao, G. A. Meininger, J. L. Patterson, S. A. L. Jones, C. R. Partridge, J. D. Neiger, E. S. Williams, S. J. Kaufman, K. S. Ramos, and E. Wilson
Regulation of {alpha}7-integrin expression in vascular smooth muscle by injury-induced atherosclerosis
Am J Physiol Heart Circ Physiol,
July 1, 2004;
287(1):
H381 - H389.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Xiao, P. Jethanandani, B. L. Ziober, and R. H. Kramer
Regulation of {alpha}7 Integrin Expression during Muscle Differentiation
J. Biol. Chem.,
December 12, 2003;
278(50):
49780 - 49788.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Chang, D. R. Webster, A. A. Salam, D. Gruber, A. Prasad, J. P. Eiserich, and J. C. Bulinski
Alteration of the C-terminal Amino Acid of Tubulin Specifically Inhibits Myogenic Differentiation
J. Biol. Chem.,
August 16, 2002;
277(34):
30690 - 30698.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Feng, S. L. Teitelbaum, M. E. Quiroz, S.-L. Cheng, C.-F. Lai, L. V. Avioli, and F. P. Ross
Sp1/Sp3 and PU.1 Differentially Regulate beta 5 Integrin Gene Expression in Macrophages and Osteoblasts
J. Biol. Chem.,
March 17, 2000;
275(12):
8331 - 8340.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. D. Luo, Y. Wang, G. Werlen, S. Camp, K. R. Chien, and P. Taylor
Calcineurin Enhances Acetylcholinesterase mRNA Stability during C2-C12 Muscle Cell Differentiation
Mol. Pharmacol.,
November 1, 1999;
56(5):
886 - 894.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
B. L. Ziober, Y. Q. Chen, D. M. Ramos, N. Waleh, and R. H. Kramer
Expression of the {{alpha}}7{beta}1 Laminin Receptor Suppresses Melanoma Growth and Metastatic Potential
Cell Growth Differ.,
July 1, 1999;
10(7):
479 - 490.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
X. Feng, S. L. Teitelbaum, M. E. Quiroz, D. A. Towler, and F. P. Ross
Cloning of the Murine beta 5 Integrin Subunit Promoter. IDENTIFICATION OF A NOVEL SEQUENCE MEDIATING GRANULOCYTE-MACROPHAGE COLONY-STIMULATING FACTOR-DEPENDENT REPRESSION OF beta 5 INTEGRIN GENE TRANSCRIPTION
J. Biol. Chem.,
January 15, 1999;
274(3):
1366 - 1374.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. B. Nicholas, W. Yang, S.-L. Lee, H. Zhu, K. D. Philipson, and J. Lytton
Alternative promoters and cardiac muscle cell-specific expression of the Na+/Ca2+ exchanger gene
Am J Physiol Heart Circ Physiol,
January 1, 1998;
274(1):
H217 - H232.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Yao, J Breuss, R Pytela, and R. Kramer
Functional expression of the alpha 7 integrin receptor in differentiated smooth muscle cells
J. Cell Sci.,
January 7, 1997;
110(13):
1477 - 1487.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Yao, B. Ziober, A. Sutherland, D. Mendrick, and R. Kramer
Laminins promote the locomotion of skeletal myoblasts via the alpha 7 integrin receptor
J. Cell Sci.,
January 12, 1996;
109(13):
3139 - 3150.
[Abstract]
[PDF]
|
 |
|
Copyright © 1996 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|