|
|
|
|||||||
|
|||||||||
(Received for publication, November 13, 1996, and in revised form, March 25, 1996)
From the Centro de Biología Molecular, CSIC-UAM,
Universidad Autónoma de Madrid, Canto Blanco,
28049 Madrid, Spain
ABSTRACT Poliovirus infection leads to drastic alterations
in membrane permeability late during infection. Transient expression of
each nonstructural protein of poliovirus by means of recombinant
vaccinia virus encoding the T7 RNA polymerase indicates that proteins
2B and 2BC strongly enhance membrane permeability to hygromycin B in
HeLa cells. Almost no effect on expression of proteins 2C, 3A, 3AB, and
3C was found. Deletions and point mutations in 2B and 2BC have
identified sequences in 2B involved in membrane permeabilization.
Regions located at both ends of 2B are necessary to bring about these
permeability alterations. A deletion of 11 amino acids of 2BC at the
junction between 2B and 2C, as well as long deletions in 2C
encompassing the GTPase motifs of this protein, do not impair the
capacity of 2BC to modify the permeability of the membrane. The release
of compounds such as choline or uridine from preloaded cells is also
augmented by 2B and 2BC expression.
INTRODUCTION Infection of cells by cytolytic animal viruses leads to profound
alterations in membrane permeability (1, 2). These alterations occur at
two well defined moments during virus infection: at early times when
virus particles penetrate into cells and late during infection when the
majority of viral products are being synthesized (1, 2). Early
alterations of the membrane do not require virus gene expression (3,
4). Low molecular weight compounds as well as macromolecules enter
cells together with virus particles (3, 5). The exact mechanism of this
enhanced permeability at early times of infection is still poorly
understood. The suggestion has been put forward that the protonmotive
force is coupled to the translocation of virus particles and
macromolecules into cells during virus entry into cells (6, 7, 8).
In addition to this phenomenon, late membrane leakiness requires virus
gene expression and involves the diffusion of ions and small molecules
but not macromolecules through the plasma membrane (9, 10, 11, 12).
Picornaviruses have been extensively used as model systems to analyze
the mechanism of late membrane leakiness in detail (1, 2). As early as
2-3 h postinfection membrane potential drops in picornavirus-infected
cells, accompanied by a gradual redistribution of sodium and potassium
ions between the culture medium and the cytoplasm (9, 13, 14, 15). In
addition, increased passive diffusion of compounds such as choline,
nucleotides, and low molecular weight antibiotics takes place (16, 17).
Phospholipase C is selectively activated in poliovirus-infected cells
(18), whereas other lipases, including phospholipase A2, become
stimulated in other animal virus-infected cells (19). The exact
contribution of lipase activation to membrane leakiness remains to be
established, but it seems that a general disorganization of the plasma
membrane is generated at late times of poliovirus infection (1, 2).
Not only is the functioning of the plasma membrane altered, but also
the vesicular system is profoundly modified. Thus, the Golgi apparatus
is not recognized in poliovirus-infected cells, and numerous membranous
vesicles fill most of the cytoplasm at late times of infection (20,
21). The proliferation of these vesicles is tightly connected to the
replication of viral genomes, because inhibitors that interfere with
the generation of these membranes block poliovirus RNA synthesis
(22, 23, 24).
With regard to the picornavirus genes involved in these alterations, it
was found recently that 2BC and to a much lower extent 2C induced
membrane proliferation when individually expressed in mammalian cells
by means of recombinant vaccinia viruses (25, 26). Moreover, our recent
results indicate that 2BC induces membrane proliferation and blocks the
exocytic pathway in yeast cells (27). Sequences present in both 2B and
2C are required for these alterations to take place. Therefore, 2BC is
a protein that interacts with membranes and selectively modifies the
vesicular system. Much less is known about the poliovirus proteins
responsible for membrane permeabilization. The inducible expression of
each poliovirus nonstructural protein in bacteria led to the suggestion
that overexpression of 2B or 3A increased permeability of the bacterial
membranes (28). Recently, transient expression of 2B or 2BC and to a
lower extent 3A enhanced permeability to the hydrophilic antibiotic
hygromycin B in COS cells (29). In addition, elegant experiments
indicated that both 2B and 3A interfered with glycoprotein trafficking
through the vesicular system in mammalian cells (29).
MATERIALS AND METHODS HeLa, COS, CV2, and 143 TK cells were
grown in tissue culture dishes (Nunc) in Dulbecco's modified Eagle's
medium supplemented with 5% newborn calf serum. The recombinant
vaccinia viruses were grown in HeLa cells in Dulbecco's modified
Eagle's medium supplemented with 2% newborn calf serum. Only the
intracellular virus was collected after freezing and thawing the cells
three times.
The expression plasmids pTM1-2B,
pTM1-2BC, and pTM1-2C were constructed using polymerase chain
reaction techniques as described previously (26). For the construction
of the plasmids pTM1-3A, pTM1-3AB, and pTM1-3C, the amplified
products obtained using the primers 5 For
transfection experiments, cells were plated in 24-well dishes (Nunc)
24 h before infection with vaccinia virus bearing the T7 RNA
polymerase (VT7) (multiplicity of infection, 5) (kindly given by Dr. B. Moss, National Institutes of Health, Bethesda). After 45 min of virus
adsorption, a mixture of DNA (0.5 g/well) and Lipofectin (2 g/well) was
added to cells in Dulbecco's modified Eagle's medium as described by
the manufacturer (Life Technologies, Inc.). Cells were harvested at the
times indicated in each figure legend.
To estimate protein synthesis cells were
labeled with 25 µCi/ml [35S]methionine (1.45Ci/mmol,
Amersham) in methionine-free medium. To examine the radiolabeled
proteins, cell monolayers were dissolved in sample buffer (62.5 m Tris-HCl, pH 6.8, 2% sodium dodecyl sulfate, 0.1 dithiothreitol, 17% glycerol, and 0.024% bromphenol
blue as indicator), loaded onto 15%
SDS-PAGE1 gels and electrophoresed at 80 V
for 16 h. Immunoblot analysis of the proteins was as described
(30).
Transfected cells were radiolabeled for
1 h at 7 h.p.i. with 50 µCi/ml
[35S]Translabel (Amersham Corp.) in cysteine- and
methionine-free Dulbecco's modified Eagle's medium. After labeling,
the medium was removed and the cells were washed three times with
phosphate-buffered saline before adding the lysis buffer (20 m Tris-HCl, pH 7.8, 1% Nonidet P-40, 140 m
NaCl, 10 m iodoacetamide, 1 m
phenylmethylsulfonyl fluoride, 1 µg/ml pepstatin e A, and 1 µg/ml
leupeptin e). After incubating the cells for 30 min at 4 °C, the
lysates were recovered and cleared by centrifugation (15 min, 14,000 rpm, 4 °C). The supernatants were incubated with protein A-Sepharose
beads and preimmune serum overnight at 4 °C. After this incubation,
the beads were removed, and the supernatants were incubated with
protein A-Sepharose beads and immune serum at 4 °C. After 5 h
of incubation the immunoprecipitates were washed five times with the
lysis buffer and analyzed by 15% SDS-PAGE.
To determine
changes in membrane permeability, the radioactivity released from
[3H]choline- or [3H]uridine-preloaded HeLa
cells was measured. HeLa cells were loaded with 2 µCi/ml of
[3H]choline chloride (80 Ci/mmol, Amersham Corp.) or
[5,6-3H]uridine (35 Ci/mmol, ICN) for 14 h. Then the
cells were transfected with the different plasmids, 3 h.p.i. of
the medium was removed, and fresh medium was added. 1 h later the
process was repeated to eliminate the effects of the Lipofectins. At
the indicated times the medium was recovered, centrifuged at 15,000 rpm
for 5 min, and 3/4 of each supernatant was mixed with L-929
scintillation mixture (DuPont) to quantitate the radioactivity released
to the medium.
RESULTS AND DISCUSSION Previous results from our laboratory indicated that the poliovirus
nonstructural proteins 2B and 3A (or 3AB) enhanced membrane
permeability to several compounds in Escherichia coli cells
(28, 31). Other recent findings also showed that protein 2B and
marginally 3A (but not 3AB) permeabilized mammalian cells to hygromycin
B (29). Therefore, we expressed other poliovirus nonstructural
proteins, 2B, 2BC, 2C, 3A, 3AB, and 3C, in the vaccinia system to
determine which of them modified membrane permeability. To this end,
proteins were labeled in the absence or in the presence of hygromycin
B, immunoprecipitated with specific polyclonal antibodies, and analyzed
by SDS-PAGE. Clearly, the synthesis of proteins 2B and 2BC totally
disappears in the presence of the aminoglycoside antibiotic (Fig.
1A). Note that the anti-2B antibodies
immunoprecipitate a protein from control vaccinia virus-infected cells
that migrates slightly more slowly than poliovirus 2B. Poliovirus
proteins 2C, 3A, and 3AB do not enhance the entry of the inhibitor
(Fig. 1, A and B), whereas some permeabilizing
capacity occurs with protein 3C (Fig. 1C). However, this
modification of the membrane by 3C is less than that observed with 2B
or 2BC.
To determine which regions of 2B and 2BC are involved in the
enhancement of hygromycin B entry into cells, a number of deletion
variants of these proteins was constructed (Fig.
2A). Unfortunately, some of the 2B deletion
mutants obtained were not efficiently precipitated by the anti-2B
antibodies employed, i.e. 2b(
The effects of the 2BC mutant 2Bc(1-258) indicate that large portions
of 2C can be deleted without diminishing its permeabilizing capacity
(Fig. 2B). The GKS motif present in protein 2C, which
encompasses amino acid residues 281-283 of 2BC, is absent in variant
2BC(1-258). A similar conclusion applies to the deletion affecting the
junction between 2B and 2C (mutant 2bc ( Poliovirus infection enhances membrane permeability in both directions
across the membrane; not only impermeant antibiotics readily pass from
the medium into the cell, but also other compounds such as choline or
uridine are released from the infected cells to the culture medium (2).
Therefore, we wished to assay the release of these compounds from cells
expressing the different poliovirus nonstructural proteins. These
experiments posed a number of experimental problems, such as the
permeabilizing capacity of vaccinia virus itself to choline and uridine
at late times of infection (from 8-10 h.p.i.), which necessitated
testing the release of these compounds at earlier times of the
expression of poliovirus proteins. Another problem found in this type
of experiment is that Lipofectin itself may affect the assay and must
be washed off thoroughly after transfection. Despite these problems,
when cells are loaded with choline overnight and poliovirus proteins
are expressed, there is a clear enhancement of
[3H]choline released from cells that express proteins 2B
or 2BC (Fig. 3, A and B).
Consistently, in the majority of experiments conducted, 2BC has a
greater permeabilizing capacity than 2B. This is clearly observed when
[3H]uridine release is tested (Fig. 3C); in
this assay, only 2BC has a significant effect, whereas the other
poliovirus nonstructural proteins, namely 2C, 3A, 3AB, or 3C, did not
significantly alter membrane permeability in either of the assays.
Despite the wealth of information on the alterations of cellular
membranes induced by animal viruses, very little is known about the
specific virus products involved and their exact mode of action (1, 2).
Poliovirus nonstructural proteins may induce three types of membrane
modifications upon expression in cells: 1) morphological changes in
cytoplasmic vesicles characterized by a huge proliferation of
membranous vacuoles of different sizes (25, 26, 27); 2) functional
modifications of the vesicular system that involve the inhibition of
glycoprotein trafficking (27, 29); and 3) increased membrane
permeability that takes place at the plasma membrane level (1, 2).
Although the relationship between the three phenomena is unknown,
recent findings from several laboratories have shed some light on their
effects.
Initial attempts to identify the poliovirus nonstructural proteins
implicated in triggering membrane permeabilization involved the cloning
and expression in an inducible manner of these proteins in bacteria
(28, 31). Poliovirus proteins 2B or 3A were able to enhance membrane
permeability in E. coli, and their expression was highly
toxic for the bacterial cells (28, 31). The action of 2BC in this
system has not yet been tested, although 2BC is the only protein that
permeabilizes yeast cells.2 There is a
correlation between the capacity of 2BC to induce vesicle proliferation
(27) and permeabilization to hygromycin B in yeast cells. In the case
of mammalian cells, both proteins 2B and 2BC enhanced the entry of
hygromycin B as measured by the co-expression of the poliovirus protein
and Finally, it could be speculated that the inhibition of
glycoprotein traffic enhances plasma membrane permeability
nonspecifically. We consider this possibility unlikely because of a
number of considerations. First, there is no correlation between the
activity of poliovirus proteins to block glycoprotein traffic
(3A>2BC>2B) and their permeabilizing capacity (2BC>2B>3A). In
addition, a compound that interferes with glycoprotein traffic,
brefeldin A, has no effect on membrane permeability to hygromycin
B.3
The action of 2B or 2BC in the poliovirus replication cycle remains
poorly understood (32, 33). The finding that these proteins are
responsible for the permeabilization induced by poliovirus infection in
the infected cells is clear, but the exact molecular mechanism by which
modification of the plasma membrane is achieved by 2B and 2BC remains
puzzling. Nevertheless, the present studies point to protein 2B and
particularly to 2BC as the major determinant of the enhanced
permeabilization observed in poliovirus-infected cells. The capacity of
2BC to induce vesicle proliferation, to interfere with protein
trafficking, and to enhance membrane permeability is intriguing.
Further studies in this direction will be aimed at elucidating the
exact mode of action of 2BC and variant proteins on membranes.
FOOTNOTES REFERENCES
Volume 271, Number 38,
Issue of September 20, 1996
pp. 23134-23137
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
,
3A.YE
(GGCCGGGGATCCATG
) and 3 3A.E1A
(GGGCCCGAGCTCAGGCCTTACTA
) for the
amplification of 3A, the primers 5 3A.YE and 3 3B.E1A
(GGGCCCGAGCTCAGGCCTTACTA
) for the
amplification of 3AB, and the primers 5 3C.YE
(GGCCGGGATCCATG
) and 3 3C.E1A
(GGGCCCGAGCTCAGGCCTTACTA
) for the
amplification of 3C, were digested with NcoI and
SacI and cloned in pTM1 digested with the same
endonucleases. The 2BC variant designated as 2bc(
SphI)
was generated by digesting the construct pTM1-2BC with the
endonuclease SphI, eliminating one fragment of 72 nucleotides, and self-ligating the vector. The mutants 2Bc(1-258) and
2b(70
) (which encode 7 amino acids not present in the original
sequence) were generated from pEMBLyex-2BC (27) by digestion with
SpeI and SnaBI. The other 2BC variants were
obtained from the corresponding construct in pEMBLyex (27) and cloned
into the vector pTM1-2B previously digested with NcoI and
StuI. The plasmids pTM1-2BC(S) and pTM1-2BC(D)) were
constructed after digestion of the corresponding pEMBLyex construct
with AflII and PstI and subcloned in
pTM1-2B digested in the same way. pTM1-2B(D) was generated after
digestion of pEMBLyex 2bC(D) with BstEII and
SphI. The DNA fragment obtained was subcloned in pTM1-2B
digested with the same enzymes. The construct pTM1-2b(30) was
obtained by digestion of pEMBLyex-2bC(30N) with NcoI, and
the fragment was subcloned in pTM1-2B previously digested with
NcoI, eliminating 231 nucleotides. The pTM1-2bC(60N)
plasmid was generated by digesting with BspHI and
SacI pTM1 and the polymerase chain reaction product obtained
with primers 52B.60 and 32C.E1A, after digestion pTM1 and the
polymerase chain reaction product were ligated. The mutant 2b(Spe I)
was obtained digesting the construction pTM1-2B with SpeI,
blunt- ended with Klenow enzyme, and self-ligated.
Fig. 1.
Transient expression of poliovirus proteins
and induction of permeabilization to hygromycin B of HeLa cells.
Cells were infected with vaccinia VT7 (5 plaque-forming unit/cell) and
transfected with plasmids pTM1-2B, pTM1-2BC, pTM1-2C, pTM1-3A,
pTM1-3AB, and pTM1-3C by the Lipofectin method, as described under
``Materials and Methods.'' 4 h.p.i. of the medium was replaced.
Cells were labeled for 1 h with 50 µCi/ml of
[35S]Translabel at 7 h.p.i. in the presence (+) or
in the absence (
) of 1 m hygromycin B. The samples were
immunoprecipitated with polyclonal rabbit antibodies and analyzed by
15% SDS-PAGE (panels A and C) or by 20%
SDS-PAGE (panel B) as described under ``Materials and
Methods.'' Proteins 2C and 2BC were immunoprecipitated with anti-2C
antibody (-2C), whereas the rest of poliovirus proteins were
immunoprecipitated with their corresponding antibodies (2B with -2B;
3A and 3AB with -3A; and 3C with -3C).
30N),
2b(SpeI), and 2b(d). But, in the case of 2B (70) a
clear band was obtained that was observed both in the absence or in the
presence of hygromycin B, suggesting that deletion of 20 amino acids at
the carboxyl terminus of 2B abolishes its capacity to modify the
membrane. An alternative possibility is that this protein is made at
lower levels than 2B, which may not be sufficient to alter membrane
permeability. We do not favor this possibility because mutant
2bc(SphI), which is expressed at lower levels, does
enhance the entry of the antibiotic. The other 2B variants, mainly
2b(30N), 2b(SpeI), and 2b(d) do not promote hygromycin
B entry (Fig. 2B).
Fig. 2.
Permeabilization to hygromycin B induced by
several 2B and 2BC variant proteins. Panel A shows the
different variant genes constructed. The amino acids of each protein
are indicated. Variant protein 2bc(SphI) lacks amino
acids 86-108 of 2BC. Variants 2b(70) and 2b(SpeI) contain 7 and
4 amino acids, respectively, unrelated to the 2B sequence at the
carboxyl terminus. HeLa cells were infected with VT7 and transfected
with the plasmids corresponding to the mutants depicted in Fig. 3.
4 h.p.i. of the medium was replaced, and at 7 h.p.i. cells
were labeled for 1 h with 50 µCi/ml of
[35S]Translabel in the presence (+) or in the absence
() of 1 m hygromycin B, immunoprecipitated, and analyzed
by SDS-PAGE as described under ``Materials and Methods.''
SphI)), whereas
the presence of 30 amino acids of 2B located at the amino terminus are
crucial for the permeabilization of the membrane induced by 2BC to
occur (mutant 2b(30N) and 2bC(60N)). This result is of interest
because this deletion does not affect the two hydrophobic regions
present in 2B that theoretically could be involved in the interaction
of 2B with membranes. To assay the importance of the hydrophobic region
present in 2B for the modification of membrane permeability, one or two
point mutations were generated in this hydrophobic region of 2B. One
2BC variant had a V52D mutation, whereas another had two substitutions,
V52D and I54K. Analysis of the Kyte and Doolittle hydrophobic profiles
of these variant 2BC proteins indicated that the hydrophobic
characteristics of 2B in this region were greatly diminished. The
2bC(s) mutant was expressed at low levels, yet it clearly permeabilized
the membrane to hygromycin B. The second variant 2bC(D) showed partial
reduction of its synthesis in the presence of the antibiotic. These
results indicate that the integrity of the most hydrophobic region
present in 2B is not fully required by 2BC to increase hygromycin B
entry. However, protein 2b(D) does not permeabilize cells, suggesting
that 2BC is more active than 2B in this respect.
Fig. 3.
Release of choline and uridine from HeLa
cells synthesizing different poliovirus nonstructural proteins.
Hela cells were loaded for 14 h with [3H]choline (2 µCi/ml) or [3H]uridine (2 µCi/ml) before infection
with VT7. Cells were then transfected with plasmids pTM1-2B,
pTM1-2BC, pTM1-2C, pTM1-3A, pTM1-3AB, and pTM1-3C by the
Lipofectin method. At the indicated times the culture medium was
collected, and the radioactivity present was measured as described
under ``Materials and Methods.''
1 proteinase inhibitor labeled with
[35S]methionine, but a lower permeabilizing effect was
found with 3A (29). Our findings with the VT7 system clearly show that
2B and more markedly 2BC permeabilize the plasma membrane to various
compounds. Therefore, there is also a parallelism between the induction
of cytoplasmic vesicle and membrane permeability in HeLa cells. Perhaps
the formation of these membranous vacuoles affects the integrity of the
plasma membrane in an indirect way. Alternatively, 2B or 2BC may
themselves act directly at the plasma membrane. The possibility that 2B
or 2BC directly affect the plasma membrane is not supported by our
immunolocalization studies, indicating that these proteins concentrate
in the new vesicles formed and there are little if any of these
proteins at the plasma membrane level.3
This is, however, a negative result and should not be considered as
definitive proof that some traction of 2B or 2BC associates with the
plasma membrane. Both proteins 2BC and (to a lesser extent) 2C induce
membrane proliferation in HeLa cells (25, 26), but the morphology and
the kind of the membranes induced by 2C are different from those
induced by 2BC. This may explain why 2C is totally devoid of
permeabilizing capacity. The possibility that the induction of new
vesicles affects the permeability barrier of the plasma membrane is
very attractive, but our data do not prove it.
Recipient of a Gobierno Vasco fellowship.
§
Recipient of a Formacion del Personal Investigador fellowship.
¶
To whom correspondence should be addressed. Fax:
34-1-3974799.
1
The abbreviations used are: PAGE, polyacrylamide
gel electrophoresis; h.p.i., hours post-infection.
2
A. Barco and L. Carrasco, unpublished
results.
3
R. Aldabe and L. Carrasco, unpublished
results.
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
ABSTRACTThis article has been cited by other articles:
|
|
 |
|
  A. M. De Palma, H. J. Thibaut, L. van der Linden, K. Lanke, W. Heggermont, S. Ireland, R. Andrews, M. Arimilli, T. H. Al-Tel, E. De Clercq, et al. Mutations in the Nonstructural Protein 3A Confer Resistance to the Novel Enterovirus Replication Inhibitor TTP-8307 Antimicrob. Agents Chemother., May 1, 2009; 53(5): 1850 - 1857. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Armer, K. Moffat, T. Wileman, G. J. Belsham, T. Jackson, W. P. Duprex, M. Ryan, and P. Monaghan Foot-and-Mouth Disease Virus, but Not Bovine Enterovirus, Targets the Host Cell Cytoskeleton via the Nonstructural Protein 3Cpro J. Virol., November 1, 2008; 82(21): 10556 - 10566. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Yin, Y. Liu, E. Wimmer, and A. V. Paul Complete protein linkage map between the P2 and P3 non-structural proteins of poliovirus J. Gen. Virol., August 1, 2007; 88(8): 2259 - 2267. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. T. Cornell, W. B. Kiosses, S. Harkins, and J. L. Whitton Coxsackievirus B3 Proteins Directionally Complement Each Other To Downregulate Surface Major Histocompatibility Complex Class I J. Virol., July 1, 2007; 81(13): 6785 - 6797. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Krogerus, O. Samuilova, T. Poyry, E. Jokitalo, and T. Hyypia Intracellular localization and effects of individually expressed human parechovirus 1 non-structural proteins J. Gen. Virol., March 1, 2007; 88(3): 831 - 841. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. D. Stuart and T. D. K. Brown Entry of feline calicivirus is dependent on clathrin-mediated endocytosis and acidification in endosomes. J. Virol., August 1, 2006; 80(15): 7500 - 7509. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. S. de Jong, H.-J. Visch, F. de Mattia, M. M. van Dommelen, H. G. Swarts, T. Luyten, G. Callewaert, W. J. Melchers, P. H. Willems, and F. J. van Kuppeveld The Coxsackievirus 2B Protein Increases Efflux of Ions from the Endoplasmic Reticulum and Golgi, thereby Inhibiting Protein Trafficking through the Golgi J. Biol. Chem., May 19, 2006; 281(20): 14144 - 14150. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. C. Zhang, G. Zhang, L. Yang, J. Chisholm, and H. Sanfacon Evidence that Insertion of Tomato Ringspot Nepovirus NTB-VPg Protein in Endoplasmic Reticulum Membranes Is Directed by Two Domains: a C-Terminal Transmembrane Helix and an N-Terminal Amphipathic Helix J. Virol., September 15, 2005; 79(18): 11752 - 11765. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Salsman, D. Top, J. Boutilier, and R. Duncan Extensive Syncytium Formation Mediated by the Reovirus FAST Proteins Triggers Apoptosis-Induced Membrane Instability J. Virol., July 1, 2005; 79(13): 8090 - 8100. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Harris and V. R. Racaniello Amino Acid Changes in Proteins 2B and 3A Mediate Rhinovirus Type 39 Growth in Mouse Cells J. Virol., May 1, 2005; 79(9): 5363 - 5373. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Moffat, G. Howell, C. Knox, G. J. Belsham, P. Monaghan, M. D. Ryan, and T. Wileman Effects of Foot-and-Mouth Disease Virus Nonstructural Proteins on the Structure and Function of the Early Secretory Pathway: 2BC but Not 3A Blocks Endoplasmic Reticulum-to-Golgi Transport J. Virol., April 1, 2005; 79(7): 4382 - 4395. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Yanagiya, Q. Jia, S. Ohka, H. Horie, and A. Nomoto Blockade of the Poliovirus-Induced Cytopathic Effect in Neural Cells by Monoclonal Antibody against Poliovirus or the Human Poliovirus Receptor J. Virol., February 1, 2005; 79(3): 1523 - 1532. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Han and R. N. Harty The NS3 Protein of Bluetongue Virus Exhibits Viroporin-like Properties J. Biol. Chem., October 8, 2004; 279(41): 43092 - 43097. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. S. Choe and K. Kirkegaard Intracellular Topology and Epitope Shielding of Poliovirus 3A Protein J. Virol., June 1, 2004; 78(11): 5973 - 5982. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. de Jong, W. J. G. Melchers, D. H. R. F. Glaudemans, P. H. G. M. Willems, and F. J. M. van Kuppeveld Mutational Analysis of Different Regions in the Coxsackievirus 2B Protein: REQUIREMENTS FOR HOMO-MULTIMERIZATION, MEMBRANE PERMEABILIZATION, SUBCELLULAR LOCALIZATION, AND VIRUS REPLICATION J. Biol. Chem., May 7, 2004; 279(19): 19924 - 19935. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Campanella, A. S. de Jong, K. W. H. Lanke, W. J. G. Melchers, P. H. G. M. Willems, P. Pinton, R. Rizzuto, and F. J. M. van Kuppeveld The Coxsackievirus 2B Protein Suppresses Apoptotic Host Cell Responses by Manipulating Intracellular Ca2+ Homeostasis J. Biol. Chem., April 30, 2004; 279(18): 18440 - 18450. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Harris and V. R. Racaniello Changes in Rhinovirus Protein 2C Allow Efficient Replication in Mouse Cells J. Virol., April 15, 2003; 77(8): 4773 - 4780. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. de Jong, E. Wessels, H. B. P. M. Dijkman, J. M. D. Galama, W. J. G. Melchers, P. H. G. M. Willems, and F. J. M. van Kuppeveld Determinants for Membrane Association and Permeabilization of the Coxsackievirus 2B Protein and the Identification of the Golgi Complex as the Target Organelle J. Biol. Chem., January 3, 2003; 278(2): 1012 - 1021. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Blanco, L. Carrasco, and I. Ventoso Cell Killing by HIV-1 Protease J. Biol. Chem., January 3, 2003; 278(2): 1086 - 1093. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Jurgens and J. B. Flanegan Initiation of Poliovirus Negative-Strand RNA Synthesis Requires Precursor Forms of P2 Proteins J. Virol., December 20, 2002; 77(2): 1075 - 1083. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Agirre, A. Barco, L. Carrasco, and J. L. Nieva Viroporin-mediated Membrane Permeabilization. PORE FORMATION BY NONSTRUCTURAL POLIOVIRUS 2B PROTEIN J. Biol. Chem., October 18, 2002; 277(43): 40434 - 40441. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. J. M. van Kuppeveld, W. J. G. Melchers, P. H. G. M. Willems, and T. W. J. Gadella Jr. Homomultimerization of the Coxsackievirus 2B Protein in Living Cells Visualized by Fluorescence Resonance Energy Transfer Microscopy J. Virol., August 12, 2002; 76(18): 9446 - 9456. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. V. Sosnovtsev, M. Garfield, and K. Y. Green Processing Map and Essential Cleavage Sites of the Nonstructural Polyprotein Encoded by ORF1 of the Feline Calicivirus Genome J. Virol., June 14, 2002; 76(14): 7060 - 7072. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Carette, J. van Lent, S. A. MacFarlane, J. Wellink, and A. van Kammen Cowpea Mosaic Virus 32- and 60-Kilodalton Replication Proteins Target and Change the Morphology of Endoplasmic Reticulum Membranes J. Virol., May 13, 2002; 76(12): 6293 - 6301. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Bodelon, L. Labrada, J. Martinez-Costas, and J. Benavente Modification of Late Membrane Permeability in Avian Reovirus-infected Cells. VIROPORIN ACTIVITY OF THE S1-ENCODED NONSTRUCTURAL p10 PROTEIN J. Biol. Chem., May 10, 2002; 277(20): 17789 - 17796. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. de Jong, I. W. J. Schrama, P. H. G. M. Willems, J. M. D. Galama, W. J. G. Melchers, and F. J. M. van Kuppeveld Multimerization reactions of coxsackievirus proteins 2B, 2C and 2BC: a mammalian two-hybrid analysis J. Gen. Virol., April 1, 2002; 83(4): 783 - 793. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. J. M. van Kuppeveld, P. J. J. C. van den Hurk, I. W. J. Schrama, J. M. D. Galama, and W. J. G. Melchers Trans-complementation of a genetic defect in the coxsackie B3 virus 2B protein J. Gen. Virol., February 1, 2002; 83(2): 341 - 350. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. R. Ciccaglione, A. Costantino, C. Marcantonio, M. Equestre, A. Geraci, and M. Rapicetta Mutagenesis of hepatitis C virus E1 protein affects its membrane-permeabilizing activity J. Gen. Virol., September 1, 2001; 82(9): 2243 - 2250. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Egger, N. Teterina, E. Ehrenfeld, and K. Bienz Formation of the Poliovirus Replication Complex Requires Coupled Viral Translation, Vesicle Production, and Viral RNA Synthesis J. Virol., July 15, 2000; 74(14): 6570 - 6580. [Abstract] [Full Text]
|
|
|
|
|
|
H. Shimizu, M. Agoh, Y. Agoh, H. Yoshida, K. Yoshii, T. Yoneyama, A. Hagiwara, and T. Miyamura Mutations in the 2C Region of Poliovirus Responsible for Altered Sensitivity to Benzimidazole Derivatives J. Virol., May 1, 2000; 74(9): 4146 - 4154. [Abstract] [Full Text]
|
|
|
|
|
|
T. Pfister, K. W. Jones, and E. Wimmer A Cysteine-Rich Motif in Poliovirus Protein 2CATPase Is Involved in RNA Replication and Binds Zinc In Vitro J. Virol., January 1, 2000; 74(1): 334 - 343. [Abstract] [Full Text]
|
|
|
|
|
|
Y.-S. Chang, C.-L. Liao, C.-H. Tsao, M.-C. Chen, C.-I Liu, L.-K. Chen, and Y.-L. Lin Membrane Permeabilization by Small Hydrophobic Nonstructural Proteins of Japanese Encephalitis Virus J. Virol., August 1, 1999; 73(8): 6257 - 6264. [Abstract] [Full Text]
|
|
|
|
|
|
T. Pfister and E. Wimmer Characterization of the Nucleoside Triphosphatase Activity of Poliovirus Protein 2C Reveals a Mechanism by Which Guanidine Inhibits Poliovirus Replication J. Biol. Chem., March 12, 1999; 274(11): 6992 - 7001. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Bolten, D. Egger, R. Gosert, G. Schaub, L. Landmann, and K. Bienz Intracellular Localization of Poliovirus Plus- and Minus-Strand RNA Visualized by Strand-Specific Fluorescent In Situ Hybridization J. Virol., November 1, 1998; 72(11): 8578 - 8585. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Barco and L. Carrasco Identification of Regions of Poliovirus 2BC Protein That Are Involved in Cytotoxicity J. Virol., May 1, 1998; 72(5): 3560 - 3570. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Cuconati, W. Xiang, F. Lahser, T. Pfister, and E. Wimmer A Protein Linkage Map of the P2 Nonstructural Proteins of Poliovirus J. Virol., February 1, 1998; 72(2): 1297 - 1307. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |