|
|
|
|||||||
|
|||||||||
(Received for publication, August 14,
1995; and in revised form, October 12, 1995) From the
The phosphorylation of thyroid transcription factor-1 (TTF-1), a
homeodomain-containing transcription factor that is required for
thyroid-specific expression of the thyroglobulin and thyroperoxidase
gene promoters, has been studied. Phosphorylation occurs on a maximum
of seven serine residues that are distributed in three tryptic
peptides. Mutant derivatives of TTF-1, with alanine residues replacing
the serines in the phosphorylation sites, have been constructed and
used to assess the functional relevance of TTF-1 phosphorylation. The
DNA binding activity of TTF-1 appears to be
phosphorylation-independent, as indicated also by the performance of
TTF-1 purified from an overexpressing Escherichia coli strain.
Transcriptional activation by TTF-1 could require phosphorylation only
in specific cell types since in a co-transfection assay in heterologous
cells both wild-type and mutant proteins show a similar transcriptional
activity.
The thyroid transcription factor-1 (TTF-1) ( Phosphorylation is perhaps the most frequent post-translational
modification of those proteins whose activity is regulated in response
to changes in metabolic activity, environmental conditions, and
hormonal signals. Many transcription factors are regulated by
phosphorylation through several distinct mechanisms (10, 11, 12, 13) that can affect
either their DNA binding or their transcriptional activity. We have
previously demonstrated that, in the rat thyroid cell line FRTL-5,
TTF-1 is phosphorylated(14) . Furthermore, in a
Ha-
The amplified products were cloned
into the eukaryotic expression vector Rc/CMV (Invitrogen). Finally,
restriction fragments containing the serine-alanine substitutions were
excised and subcloned in CMV/TTF-1, D14, or D26, described in De Felice et al.(5) , to generate the mutated constructs
indicated in Fig. 2and Fig. 4.
Figure 2:
Identification of phosphorylated serine
residues in TTF-1. Panel A, schematic representation of TTF-1
mutants carrying the Ser/Ala substitutions. The constructs were
generated as described under ``Materials and Methods.'' Panel B, HeLa cells transfected with expression vectors
encoding the mutated proteins were in vivo labeled with
Figure 4:
Transactivation of the thyroglobulin
promoter containing TTF-1 binding sites, by wild-type TTF-1 and various
mutant proteins. The indicated amount (expressed in micrograms) of
expression vectors encoding TTF-1 either wild type or mutated at the
phosphorylation sites were transiently transfected into HeLa cells
together with 5 µg of a reporter construct carrying the
thyroglobulin promoter fused to the chloramphenicol acetyltransferase
gene. The activation values were obtained by dividing the enzymatic
activity present in extracts of cells transfected with the various
TTF-1 proteins by the activity obtained with the empty expression
vector (Rc/CMV).
Figure 1:
TTF-1 is equally
phosphorylated in FRTL-5 cells and upon expression in HeLa cells. Panel A, immunoprecipitation of TTF-1 from FRTL-5- and
HeLa-transfected cells. Left, either thyroid cells (FRTL-5) or HeLa cells transfected with a TTF-1 expression
vector were labeled with [
Figure 3:
Phosphorylation does not affect the
affinity of TTF-1 for the oligonucleotide C. Purified HeTTF-1 (0.5 ng) (Panel A), purified bTTF-1 (2 ng) (Panel B),
HeLa-transfected total extracts (about 3 µg) containing 0.5 ng of
wild-type TTF-1 (Panel C), or 0.5 ng of mutant S80 (Panel
D), or FRTL-5 nuclear extracts (about 2 µg) containing 0.5 ng
of TTF-1 (Panel E) (the concentrations of TTF-1 in the
extracts were determined by Western blotting analysis) were incubated
for 45 min in binding buffer containing increasing concentrations of
labeled oligonucleotide C. Bound and free DNA were visualized by
autoradiography, and the data obtained from each titration were plotted
in the graphs A-E. HeTTF-1:TTF-1 was purified from
overexpressing HeLa cells (37) and bTTF-1:TTF-1 was purified
from overexpressing E. coli cells.
Figure 5:
Half-life of TTF-1 protein. FRTL-5 cells
expressing endogenous TTF-1 were in vivo labeled with
[
Figure 6:
TTF-1 can be phosphorylated by protein
kinase C in vitro. Bacterially expressed TTF-1 protein was
phosphorylated in vitro with protein kinase C. Samples were
loaded on a 8% polyacrylamide gel, and phosphorylated proteins were
visualized by autographic exposure of the dried gel. To exclude any
possible effect from autophosphorylation of the kinase, the experiment
was also performed in the absence of the substrate (lane
1).
In this study, we have identified the phosphorylation sites
of TTF-1, a transcription factor implicated in the activation of both
thyroid- (21, 22) and lung-specific (8, 9) transcriptional units. TTF-1 is phosphorylated
exclusively on serine residues in three different tryptic peptides. The
number of phosphorylated serines may range from a minimum of 5 to a
maximum of 7 sites, given the uncertainty on the cluster of serines at
the amino terminus. Fine mapping of the sites has been obtained in HeLa
cells, by measuring the incorporation of labeled phosphate into TTF-1
mutants missing putative phosphorylation sites. Interestingly, no sites
for protein kinase A are observed, even though an important role has
been proposed for phosphorylation of TTF-1 by this protein
kinase(15) . The sites that we have identified show homology to
CKII (Ser-18), protein kinase C (Ser-4, -23, and -255), or
microtubule-associated protein kinase (Ser-328 and -337)
phosphorylation sites. These protein kinases are components of signal
transduction pathways that have been shown to control thyroid function
and to be activated in thyroid cells in response to a variety of
stimuli(23) . In our in vitro experiments only protein
kinase C was able to phosphorylate TTF-1. This result is of interest
since activation of protein kinase C has been suggested to inhibit
thyroid cell
differentiation(24, 25, 26, 27, 28, 29, 30) .
Furthermore, activation of protein kinase C has been implicated in TSH
stimulation of thyroid cell growth(31, 32) . Since
TTF-1 has been implicated both in the expression of thyroid
differentiated function (21) and in the control of thyroid cell
growth(33) , it is an attractive hypothesis that some of these
functions could be controlled via phosphorylation of TTF-1 by protein
kinase C. The data presented in this study do not, at present, support
this hypothesis, since we could not demonstrate any alteration in TTF-1
activity as a consequence of the lack of phosphorylation. However, we
cannot rule out the possibility that we were unable to provide evidence
for the relevance of phosphorylation in TTF-1 because of the transient
transfection assay in heterologous cells that we used. The regulation
of TTF-1 through phosphorylation may impinge on thyroid-specific
mechanisms which do not operate in HeLa cells such as, for example,
phosphorylation-dependent interaction (34) with specific
co-activators. Future experiments should aim at studying the
phosphorylation mutants in thyroid cells. More conclusive are our
studies on the role of phosphorylation in the DNA binding activity of
TTF-1. Phosphorylation has been indicated as a critical step for the
binding of TTF-1 to its target sequence on the Tg promoter (15, 35) as well as on the TSHr one(36) .
Moreover, TTF-1 binding was shown to be abrogated when nuclear extracts
were incubated with acid phosphatases. Treatment of extracts with
protein kinase A (15) was able to restore TTF-1 DNA binding
activity, leading to the conclusion that TTF-1 is directly modified by
protein kinase A and binds to the Tg promoter only if
phosphorylated(35) . In contrast, our results clearly show that
phosphorylation does not play an important role in the overall TTF-1
DNA binding activity. This conclusion is based on the comparable
affinities toward a double-stranded oligonucleotide containing a well
characterized TTF-1 binding site (oligonucleotide C) (17) of
wild-type TTF-1, purified from either bacteria or animal cells, and of
the S80 mutant, that contains less that 0.1 phosphorus atom/molecule.
We cannot exclude that ancillary proteins, which are protein kinase A
substrates, could either help or interfere with TTF-1
binding(15) , depending on the physiological conditions. In
addition, we have recently discovered that TTF-1 DNA binding activity
can be easily lost during extract preparation and can be readily
recovered by exposure to reducing agents (37) . It is also
conceivable that the exquisite sensitivity of TTF-1 to oxidation could
interfere with the interpretation of in vitro treatments with
phosphatases and kinases. Previous data from our laboratory have
demonstrated that TTF-1 is inactive in Ha-
Volume 271,
Number 4,
Issue of January 26, 1996 pp. 2249-2254
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
)is a
homeodomain-containing transcription factor (1) that binds to
the promoters of thyroglobulin (Tg) and thyroperoxidase (TPO) genes,
whose expression is restricted to the thyroid follicular
cells(2, 3) . Transactivation studies demonstrated
that TTF-1 is able to activate transcription from co-transfected
thyroglobulin and thyroperoxidase promoters in non-thyroid cells,
suggesting that TTF-1 may play an important role in the transcriptional
activation of thyroid-specific genes during
development(4, 5) . However, the presence of TTF-1
protein does not always correlate with active transcription of Tg and
TPO genes, as TTF-1 has been demonstrated in tissues other than
thyroid, where no Tg and TPO mRNA could be detected. Furthermore, TTF-1
protein has been detected very early during thyroid development, 5 days
before the appearance of Tg and TPO mRNAs(6) . These data
indicate that, in physiological conditions, TTF-1 is not sufficient to
activate transcription of thyroid-specific genes. Such a notion is
strongly supported by the observation that transgenic mouse lines
carrying a thyroglobulin promoter fused to a chloramphenicol
acetyltransferase gene express the reporter only in thyroid, again
indicating that TTF-1 present in other tissues is unable to activate
the Tg promoter(7) . Interestingly, the promoters of the
surfactant protein B and A genes, exclusively expressed in lung, have
been demonstrated to depend on TTF-1 for
expression(8, 9) . Taken together, these data suggest
that the activity of TTF-1 is differentially regulated. -transformed FRTL-5 cells TTF-1 has been
demonstrated to be underphosphorylated and unable to activate
transcription, suggesting that phosphorylation could be an important
mechanism in controlling TTF-1 activity(14) . It has also been
proposed that Ki-ras reduces the capacity of TTF-1 to bind to
DNA via a phosphorylation-dependent mechanism(15) . We report
in this study the mapping of TTF-1 phosphorylation sites. TTF-1 mutants
unable to be phosphorylated show normal levels of DNA binding and
transcriptional activity in heterologous cells, suggesting that
phosphorylation of TTF-1 may have an important role only in specific
cell types.
Plasmids Construction
Two primers (start)
CCCGGGAAGCTTCTCCACTCAAGCCAATTAAGGCGG and (end)
GCGCGCTCTAGAGAGCAGCGGGCGAATGGTGG were used to specifically amplify the
entire coding region of TTF-1 by polymerase chain reaction. HindIII and XbaI sites, respectively, were included
in these primers to facilitate cloning. Specific serine codons were
changed to alanine codons by polymerase chain reaction as described
previously, using primers containing the specific mutations, together
with (start) and (end) primers.
P, and TTF-1 was purified by immunoprecipitation, then
subjected to electrophoresis, transferred to nitrocellulose, and
subjected to autoradiography (P-32) or Western blot (WB) for quantification. Lanes 1, 2, 3, 4, 5, and 6 are respectively D14, DS40, DS41, DS63, S61, and S80. Panel C, the amino acid
sequence of TTF-1 showing the major phosphorylation sites. The seven
identified phosphoserines are indicated in lower case letters.
The homeodomain is boxed.
Cell Culture and Transfection Assay
The FRTL-5
cell line has been previously described in detail(16) .
Briefly, FRTL-5 cells were grown in Coon's modified F-12 medium
(Seromed) supplemented with 5% calf serum (Life Technologies, Inc.) and
six growth factors as described by Ambesi-Impiombato and
Coon(16) . HeLa cells were grown in Dulbecco's modified
Eagle's medium (DMEM) supplemented with 10% fetal calf medium
(Life Technologies, Inc.). For transient expression assays, before the in vivo labeling, cells were plated at 8 
10
/100-mm diameter tissue culture dish 1 day prior to
transfection. Transfections were carried out by the calcium phosphate
co-precipitation technique as described
elsewhere(4, 17) . For transactivation experiments,
cells were plated at 4 10 cells/60-mm diameter
tissue culture dish 5-8 h prior to transfection. One microgram of
a plasmid containing the luciferase gene under the control of the
cytomegalovirus enhancer/promoter was used to monitor for transfection
efficiency. Cell extracts were prepared 48 h after transfection, and
the chloramphenicol acetyltransferase and luciferase activities were
determined as described previously(18, 19) .Biosynthetic Labeling and Immunodetection
Techniques
Subconfluent cultures of FRTL-5 or HeLa transfected
cells were washed twice in phosphate-free DMEM, then labeled in
phosphate-free medium containing 0.5 mCi of
[P]orthophosphate/ml for 3-4 h. Cells were
then lysed in a buffer containing 10 mM sodium phosphate (pH
7.4), 0.1 M NaCl, 1% Triton X-100, 0.1% SDS, 0.5% sodium
deoxycholate, 2 mM phenylmethylsulfonyl fluoride, 1 µg/ml
pepstatin, 1 µg/ml leupeptin, 1 µg/ml aprotinin, 50 mM sodium fluoride, 10 mM sodium pyrophosphate, and 5 mM sodium vanadate. Extracts were clarified by centrifugation, an
excess of TTF-1 antibody (6) was added, and immune complexes
were recovered on protein A-Sepharose beads (Pharmacia Biotech Inc.).
Blocking experiments were performed by preincubation of the
anti-peptides antibody with an excess of the corresponding synthetic
antigenic peptide. Bound proteins were boiled in SDS-PAGE sample buffer
and resolved by electrophoresis in SDS-10% polyacrylamide gels (SDS-10%
PAGE). Labeling of HeLa cells was performed in a similar manner. The
cells were transfected with 15 µg of the expression vectors
carrying either wild-type TTF-1 or the deletion and point mutants, and
after 36 h the cells were labeled and immunoprecipitated as above. For
pulse-chase experiments, FRTL-5 or transfected HeLa cells were labeled
in methionine-free DMEM containing 0.5 mCi of
[
S]methionine for 1 h (pulse), the medium was
then removed, and the cells were incubated in DMEM containing an
100-fold excess of nonradioactive methionine (chase). For Western blot
analysis, the samples were electroblotted onto Immobilon membrane after
SDS-PAGE, the blots were probed with the same TTF-1 antibody used in
immunoprecipitation, and the immunocomplexes were identified by ECL
(Amersham Corp.).
Phosphoamino Acids Analysis and Two-dimensional
Phosphopeptide Mapping
The immunoprecipitated proteins were
resolved on SDS-PAGE and subjected to a brief autoradiography, and the P-labeled TTF-1 band was excised and eluted from the
acrylamide. Phosphoamino acid analysis and phosphopeptide mapping by
two-dimensional separation on thin layer cellulose plates were carried
out as described elsewhere(20) .
DNA-binding Assay
For gel shift assays, binding
reactions were carried out by incubating the proteins for 45 min in
binding buffer (20 mM Tris, pH 7.6, 75 mM KCl, 100
mM NaCl, 3 mM dithiothreitol, 10% glycerol, 1 mg/ml
bovine serum albumin, 30 µg/ml poly(dI
dC) in a 20-µl
final volume) containing increasing concentrations of labeled
oligonucleotide C. Bound and free DNA were visualized by
autoradiography, and the data obtained from each titration were plotted
in graphs. The following equilibrium equation was fitted to the data by
nonlinear least-squares in order to calculate K
:
[bound] = P
K[free]/(1
+ K[free]), where P is the total concentration of TTF-1, K is the dissociation constant, and
[bound] and [free] are the concentrations of the
bound and free oligonucleotide C probe, respectively.In Vitro Kinase Assay
Purified TTF-1 from E.
coli was used for in vitro labeling with protein kinase
C. Phosphorylation conditions were the following. The reaction was
carried out in 20 mM Hepes, pH 7.5, 10 mM MgCl
, 20 µM phospholipids
(phosphatidylserine and diolein), 10 µCi of
[-
P]ATP, and 10 microunits of the kinase in
each sample. Protein kinase C from rat brain was purchased from
Boehringer Mannheim. After labeling, the samples were resolved by
SDS-PAGE.
TTF-1 Is Phosphorylated on Serine Residues in Three
Tryptic Peptides
FRTL-5 cells and HeLa cells, transiently
transfected with a TTF-1 expression vector, were metabolically labeled
with [P]orthophosphate and TTF-1 was
immunoprecipitated from whole cells extracts by means of a specific
anti-peptide antibody. After electrophoresis and autoradiography, TTF-1
was detected as a band of the expected molecular mass (
43 kDa) (Fig. 1, Panel A, lanes 1 and 3). The
specificity of the immunoprecipitate was demonstrated by competition
experiments performed in the presence of an excess of the TTF-1 peptide
used for immunization (lanes 2 and 4). When TTF-1 was
revealed by Western blot in extracts from FRTL-5 and transfected HeLa
cells, a similar TTF-1 doublet was detected in both cell lines (Fig. 1, Panel A, lanes 5 and 6). To
determine the amino acid residue(s) involved in phosphorylation,
immunoprecipitated,
P-labeled TTF-1 from both FRTL-5 and
transfected HeLa cells was acid-hydrolyzed and subjected to thin layer
electrophoresis/chromatography. In both cell lines, the result
indicated that TTF-1 is phosphorylated exclusively on serine residues (Fig. 1, Panel B). Furthermore, the labeled TTF-1 band,
eluted from the acrylamide gel after immunoprecipitation, was
extensively digested with trypsin, and the resulting phosphopeptides
were resolved by two-dimensional electrophoresis/chromatography (Fig. 1, Panel C). Three similar phosphopeptides could
be detected (numbered 1, 2, and 3) whose identity in the two cell lines
used was confirmed by mixing experiments (data not shown). These
results validate the use of HeLa cells as an heterologous expression
system for the study of TTF-1 phosphorylation.
P]orthophosphate.
Equal amounts of TTF-1 were immunoprecipitated from the cell lysates
with specific antibodies, the protein was resolved by a 8% SDS-PAGE and
detected by autoradiography as described under ``Materials and
Methods.'' Lanes 1 and 3 show the phosphorylated
TTF-1 from both cell types. The specificity of the immunoprecipitation
is demonstrated by competition with an excess of the antigenic peptide (lanes 2 and 4). Lanes 5 and 6 show
a Western blot of TTF-1 from FRTL-5 and transfected HeLa cells,
respectively. Panel B, phosphoamino acid analysis of TTF-1
immunoprecipitated from FRTL-5 and transfected HeLa cells (left and right, respectively). Following detection by
autoradiography (see Panel A) the bands corresponding to
P-TTF-1 from FRTL-5 and Hela cells were cut from the gel,
and the protein was processed as described under ``Materials and
Methods.'' The plates were exposed for autoradiography at
-70 °C for 14 days with an intensifying screen. Panel
C, tryptic maps of TTF-1 from FRTL-5- and HeLa-transfected cells (left and right, respectively).
P-TTF-1
was purified by immunoprecipitation and electrophoresis, then eluted
from the gel and subjected to tryptic digestion as described under
``Materials and Methods.'' Tryptic digests (
500
cpm/each) were applied to thin layer cellulose plates, then resolved in
the horizontal dimension by electrophoresis at pH 8.9 (anode to the left) and the vertical dimension by ascending chromatography
as described under ``Materials and Methods.'' The plates were
exposed for autoradiography at -70 °C for 10 days with an
intensifying screen. The arrow marks the site of sample
application.
Mapping of TTF-1 Phosphorylation Sites
In order to
map the phosphorylated serine residues in TTF-1, a series of deletion
and point mutation constructs were generated. Preliminary experiments
using deletion mutants allowed us to localize the phosphorylated
residues in two regions, one near the amino terminus of TTF-1 and the
second on the carboxyl-terminal side of the homeodomain (data not
shown). We then focused on these regions and mutagenized the codons for
those serine residues that, on the basis of their sequence context,
were candidate phosphorylation sites, to alanine codons (Fig. 2, Panel A). The resulting mutant proteins were expressed in HeLa
cells, metabolically labeled with
[P]orthophosphate, immunoprecipitated from whole
cell extracts, and analyzed by SDS-PAGE and autoradiography to examine
their level of phosphorylation (Fig. 2B, P-32). The presence of comparable levels of TTF-1 in the
different transfections was monitored by Western blot (Fig. 2B, WB). A schematic drawing of the most
relevant mutants and their phosphorylation level is shown in Fig. 2, Panels A and B, respectively. Deletion
mutant D14, that lacks all the region on the carboxyl-terminal
side of TTF-1 homeodomain, is phosphorylated, but replacement of
serines 4, 12, 18, and 23 with alanines (mutant DS40) results
in a complete loss of phosphorylation, indicating that one or more of
these serines are the substrate for protein kinases. Mutant DS41 encodes for a TTF-1 mutated at the amino terminus as DS40 and
deleted of residues 221-294 at the carboxyl terminus of the
protein. Hence, DS41 phosphorylation must be located among residues
295-372. Mutations of codons for serines 328 and 337 within this
region results in a loss of phosphorylation, thus allowing the
identification of these two additional phosphorylation sites. Mutant S61 encodes a full-length TTF-1 protein containing Ser to Ala
substitutions at residues 4, 12, 18, 23, 328, and 337. (Hence S61
cannot be phosphorylated at neither of the two previously identified
sites.) Since S61 is phosphorylated, additional site(s) must exist
among residues 221-294, in the region immediately downstream the
homeodomain. Substitution of serine 255 with an alanine residue
generates a full-length protein, named S80, completely unable
to incorporate inorganic
P. A summary of all the mapped
phosphoserines is shown in Fig. 2, Panel C. From this
mutagenesis study we can conclude that the identified 7 serines are the
major phosphorylation sites of TTF-1.
The Overall DNA Binding Activity of TTF-1 Is
Phosphorylation-independent
Even though none of the mapped
phosphorylation sites lies in the DNA-binding domain of TTF-1, we asked
whether the ability of TTF-1 to bind to its target sequence could
depend upon phosphorylation. To test this hypothesis, purified TTF-1
made in HeLa cells (Fig. 3, Panel A), purified TTF-1
produced in E. coli (Fig. 3, Panel B), total
extracts of HeLa cells expressing either wild-type TTF-1 or mutant S80 (Fig. 3, Panels C and D, respectively), and
FRTL-5 nuclear extract (Fig. 3, Panel E) were compared
for their affinity toward the oligonucleotide C, containing a high
affinity TTF-1 binding site(17) . The amount of TTF-1 from
different sources has been previously normalized by silver staining for
the purified proteins and by Western blot for the extracts (data not
shown). From the data shown in Fig. 3it is evident that none of
the Ala to Ser replacements has an effect on TTF-1 binding activity (Fig. 3, Panels C and D). Furthermore,
bacterial TTF-1 shows the same affinity toward the C oligonucleotide as
the protein purified from HeLa cells or that present in FRTL-5 nuclear
extract (Fig. 3, Panels A, B, and E).
Taken together these experiments suggest that phosphorylation does not
directly influence the ability of TTF-1 to bind DNA.
Nonphosphorylated TTF-1 Can Activate Transcription in
HeLa Cells
We next approached the question of whether
phosphorylation modulates the ability of TTF-1 to activate
transcription. To this end, several expression vectors encoding either
wild-type or mutated TTF-1 and a reporter gene under the control of the
Tg promoter were co-transfected in HeLa cells. As shown in Fig. 4, all TTF-1 mutants were able to activate transcription as
well as the wild-type protein. We conclude that in heterologous HeLa
cells transient transfection assay TTF-1 does not require
phosphorylation to activate transcription.TTF-1 Protein Exhibits a Slow Turnover in Both FRTL-5 and
HeLa Cells
The turnover of TTF-1 was studied in a pulse-chase
experiments. As shown in Fig. 5, the amount of S-labeled TTF-1 decreased by 50% in about 14 h in FRTL-5
cells. In addition, HeLa cells were transfected with an equal amount of
wild-type TTF-1 or mutant S80 which has all the seven mapped serines
substituted with alanines. The half-life of wild-type TTF-1 in HeLa
cells is also 14 h and no significant alteration was observed with the
S80 mutant (data not shown).
S]methionine in a pulse-chase experiment as
described under ``Materials and Methods.'' After the
labeling, the chase was performed at the different times indicated.
TTF-1 protein was purified by immunoprecipitation, then subjected to
SDS-PAGE and exposed to autoradiography .
Protein Kinase C Phosphorylates TTF-1 in Vitro
In
order to determine whether any of the kinases for which a consensus
sequence is present among the phosphorylation sites of TTF-1 were
indeed capable of phosphorylating this transcription factor, we
performed in vitro phosphorylation experiments. Among several
protein kinases tested, only protein kinase C was able to phosphorylate
TTF-1 in vitro (Fig. 6) (data not shown). These data
suggest that TTF-1 could be a target for a specific cell signaling
pathway.
-transformed
cells, although it is present and capable of binding to
DNA(14) . In this cell line, we have observed a reduced
phosphorylation of TTF-1(14) , and we proposed that this could
be the cause for the inactivity of TTF-1 in transformed cells. In this
respect, it is interesting to note that ras activation has
been reported to affect the stimulation of protein kinase C in Xenopus oocytes (38) and in PC12 cells(39) .
It is also noteworthy the role of Ras proteins in signal transduction
pathways initiated in membrane receptors (insulin-like growth factor-I,
insulin, and epidermal growth factor) and involving
microtubule-activating protein kinases. These alterations in protein
kinases activities can be somehow affecting TTF-1, either by a direct
or an indirect mechanism involving other kinases and/or phosphatases.
The characterization of the phosphorylation sites in TTF-1 may be
instrumental for the elucidation of the mechanisms leading to the
interference between transformation and differentiation in thyroid
cells.
)
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
ABSTRACT
This article has been cited by other articles:
|
|
 |
|
  E. S. W. Ngan, B. H. H. Lang, T. Liu, C. K. Y. Shum, M.-T. So, D. K. C. Lau, T. Y. Y. Leon, S. S. Cherny, S. Y. Tsai, C.-Y. Lo, et al. A Germline Mutation (A339V) in Thyroid Transcription Factor-1 (TITF-1/NKX2.1) in Patients With Multinodular Goiter and Papillary Thyroid Carcinoma J Natl Cancer Inst, February 4, 2009; 101(3): 162 - 175. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Maeda, V. Dave, and J. A. Whitsett Transcriptional Control of Lung Morphogenesis Physiol Rev, January 1, 2007; 87(1): 219 - 244. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Das and V. Boggaram Proteasome dysfunction inhibits surfactant protein gene expression in lung epithelial cells: mechanism of inhibition of SP-B gene expression Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L74 - L84. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. L. Velez, E. Costamagna, E. T. Kimura, L. Fozzatti, C. G. Pellizas, M. M. Montesinos, A. M. Lucero, A. H. Coleoni, P. Santisteban, and A. M. Masini-Repiso Bacterial Lipopolysaccharide Stimulates the Thyrotropin-Dependent Thyroglobulin Gene Expression at the Transcriptional Level by Involving the Transcription Factors Thyroid Transcription Factor-1 and Paired Box Domain Transcription Factor 8 Endocrinology, July 1, 2006; 147(7): 3260 - 3275. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. M. Moya, G. Perez de Nanclares, L. Castano, N. Potau, J. R. Bilbao, A. Carrascosa, M. Bargada, R. Coya, P. Martul, E. Vicens-Calvet, et al. Functional Study of a Novel Single Deletion in the TITF1/NKX2.1 Homeobox Gene That Produces Congenital Hypothyroidism and Benign Chorea But Not Pulmonary Distress J. Clin. Endocrinol. Metab., May 1, 2006; 91(5): 1832 - 1841. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Sparkman, H. Chandru, and V. Boggaram Ceramide decreases surfactant protein B gene expression via downregulation of TTF-1 DNA binding activity Am J Physiol Lung Cell Mol Physiol, February 1, 2006; 290(2): L351 - L358. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Garcia-Barcelo, R. W. Ganster, V. C.H. Lui, T. Y.Y. Leon, M.-T. So, A. M.F. Lau, M. Fu, M.-H. Sham, J. Knight, M. S. Zannini, et al. TTF-1 and RET promoter SNPs: regulation of RET transcription in Hirschsprung's disease Hum. Mol. Genet., January 15, 2005; 14(2): 191 - 204. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. De Vita, L. Bauer, V. M. C. da Costa, M. De Felice, M. G. Baratta, M. De Menna, and R. Di Lauro Dose-Dependent Inhibition of Thyroid Differentiation by RAS Oncogenes Mol. Endocrinol., January 1, 2005; 19(1): 76 - 89. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Srisodsai, R. Kurotani, Y. Chiba, F. Sheikh, H. A. Young, R. P. Donnelly, and S. Kimura Interleukin-10 Induces Uteroglobin-related Protein (UGRP) 1 Gene Expression in Lung Epithelial Cells through Homeodomain Transcription Factor T/EBP/NKX2.1 J. Biol. Chem., December 24, 2004; 279(52): 54358 - 54368. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Rivas, B. Mellstrom, J. R. Naranjo, and P. Santisteban Transcriptional Repressor DREAM Interacts with Thyroid Transcription Factor-1 and Regulates Thyroglobulin Gene Expression J. Biol. Chem., August 6, 2004; 279(32): 33114 - 33122. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. deFelice, D. Silberschmidt, R. DiLauro, Y. Xu, S. E. Wert, T. E. Weaver, C. J. Bachurski, J. C. Clark, and J. A. Whitsett TTF-1 Phosphorylation Is Required for Peripheral Lung Morphogenesis, Perinatal Survival, and Tissue-specific Gene Expression J. Biol. Chem., September 12, 2003; 278(37): 35574 - 35583. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. P. Gelmann, D. J. Steadman, J. Ma, N. Ahronovitz, H. J. Voeller, S. Swope, M. Abbaszadegan, K. M. Brown, K. Strand, R. B. Hayes, et al. Occurrence of NKX3.1 C154T Polymorphism in Men with and without Prostate Cancer and Studies of Its Effect on Protein Function Cancer Res., May 1, 2002; 62(9): 2654 - 2659. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. L. Medina, M. Rivas, P. Cruz, I. Barroso, J. Regadera, and P. Santisteban RhoA Activation Promotes Transformation and Loss of Thyroid Cell Differentiation Interfering with Thyroid Transcription Factor-1 Activity Mol. Endocrinol., January 1, 2002; 16(1): 33 - 44. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Lonigro, D. Donnini, E. Zappia, G. Damante, M. E. Bianchi, and S. Guazzi Nestin Is a Neuroepithelial Target Gene of Thyroid Transcription Factor-1, a Homeoprotein Required for Forebrain Organogenesis J. Biol. Chem., December 14, 2001; 276(51): 47807 - 47813. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Feliciello, G. Allevato, A. M. Musti, D. De Brasi, A. Gallo, V. E. Avvedimento, and M. E. Gottesman Thyroid Transcription Factor 1 Phosphorylation Is Not Required for Protein Kinase A-dependent Transcription of the Thyroglobulin Promoter Cell Growth Differ., December 1, 2000; 11(12): 649 - 654. [Abstract] [Full Text]
|
|
|
|
|
|
K. Berhane, R. K. Margana, and V. Boggaram Characterization of rabbit SP-B promoter region responsive to downregulation by tumor necrosis factor-alpha Am J Physiol Lung Cell Mol Physiol, November 1, 2000; 279(5): L806 - L814. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. J. Steadman, D. Giuffrida, and E. P. Gelmann DNA-binding sequence of the human prostate-specific homeodomain protein NKX3.1 Nucleic Acids Res., June 15, 2000; 28(12): 2389 - 2395. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. W. Glasser, M. S. Burhans, S. K. Eszterhas, M. D. Bruno, and T. R. Korfhagen Human SP-C gene sequences that confer lung epithelium-specific expression in transgenic mice Am J Physiol Lung Cell Mol Physiol, May 1, 2000; 278(5): L933 - L945. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Missero, M. T. Pirro, and R. Di Lauro Multiple Ras Downstream Pathways Mediate Functional Repression of the Homeobox Gene Product TTF-1 Mol. Cell. Biol., April 15, 2000; 20(8): 2783 - 2793. [Abstract] [Full Text]
|
|
|
|
|
|
L. Perrone, G. Tell, and R. Di Lauro Calreticulin Enhances the Transcriptional Activity of Thyroid Transcription Factor-1 by Binding to Its Homeodomain J. Biol. Chem., February 19, 1999; 274(8): 4640 - 4645. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Shaw-White, M. D. Bruno, and J. A. Whitsett GATA-6 Activates Transcription of Thyroid Transcription Factor-1 J. Biol. Chem., January 29, 1999; 274(5): 2658 - 2664. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Kasahara and S. Izumo Identification of the In Vivo Casein Kinase II Phosphorylation Site within the Homeodomain of the Cardiac Tisue-Specifying Homeobox Gene Product Csx/Nkx2.5 Mol. Cell. Biol., January 1, 1999; 19(1): 526 - 536. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Velasco, A. Acebron, M. Zannini, J. MartIn-Perez, R. Di Lauro, and P. Santisteban Ha-ras Interference with Thyroid Cell Differentiation Is Associated with a Down-Regulation of Thyroid Transcription Factor-1 Phosphorylation Endocrinology, June 1, 1998; 139(6): 2796 - 2802. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Aurisicchio, R. Di Lauro, and M. Zannini Identification of the Thyroid Transcription Factor-1 as a Target for Rat MST2 Kinase J. Biol. Chem., January 16, 1998; 273(3): 1477 - 1482. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. J. Bachurski, S. E. Kelly, S. W. Glasser, and T. A. Currier Nuclear Factor I Family Members Regulate the Transcription of Surfactant Protein-C J. Biol. Chem., December 26, 1997; 272(52): 32759 - 32766. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. I. Ramirez, A. K. Rishi, Y. X. Cao, and M. C. Williams TGT3, Thyroid Transcription Factor I, and Sp1 Elements Regulate Transcriptional Activity of the 1.3-Kilobase Pair Promoter of T1alpha , a Lung Alveolar Type I Cell Gene J. Biol. Chem., October 17, 1997; 272(42): 26285 - 26294. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. Kumar, V. C. Venkatesh, B. C. Planer, S. I. Feinstein, and P. L. Ballard Phorbol Ester Down-regulation of Lung Surfactant Protein B Gene Expression by Cytoplasmic Trapping of Thyroid Transcription Factor-1 and Hepatocyte Nuclear Factor 3 J. Biol. Chem., August 15, 1997; 272(33): 20764 - 20773. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Yan and J. A. Whitsett Protein Kinase A Activation of the Surfactant Protein B Gene Is Mediated by Phosphorylation of Thyroid Transcription Factor 1 J. Biol. Chem., July 11, 1997; 272(28): 17327 - 17332. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Saito, T. Endo, M. Nakazato, T. Kogai, and T. Onaya Thyroid-Stimulating Hormone-Induced Down-Regulation of Thyroid Transcription Factor 1 in Rat Thyroid FRTL-5 Cells Endocrinology, February 1, 1997; 138(2): 602 - 606. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Missero, M. T. Pirro, S. Simeone, M. Pischetola, and R. Di Lauro The DNA Glycosylase T:G Mismatch-specific Thymine DNA Glycosylase Represses Thyroid Transcription Factor-1-activated Transcription J. Biol. Chem., August 31, 2001; 276(36): 33569 - 33575. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |