|
Volume 271, Number 40,
Issue of October 4, 1996
pp. 24639-24648
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
GHF-1/Pit-1 Functions as a Cell-specific Integrator of Ras
Signaling by Targeting the Ras Pathway to a Composite Ets-1/GHF-1
Response Element*
(Received for publication, February 22, 1996, and in revised form, July 19, 1996)
Andrew P.
Bradford
,
Kerry E.
Conrad
§,
Phat H.
Tran
,
Michael C.
Ostrowski
¶ and
Arthur
Gutierrez-Hartmann

From the Departments of Medicine and of Biochemistry,
Biophysics and Genetics, Program in Molecular Biology, and Colorado
Cancer Center, University of Colorado Health Sciences Center, Denver,
Colorado 80262 and the ¶ Department of Molecular Genetics, Ohio
State University, Columbus, Ohio 43210
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES
ABSTRACT
Activation of the rat prolactin (rPRL) promoter
by Ras is a prototypical example of tissue-specific transcriptional
regulation in a highly differentiated cell type. Using a series of
site-specific mutations and deletions of the proximal rPRL promoter we
have mapped the major Ras/Raf response element (RRE) to a composite
Ets-1/GHF-1 binding site located between positions 217 and 190.
Mutation of either the Ets-1 or GHF-1 binding sites inhibits Ras and
Raf activation of the rPRL promoter, and insertion of this RRE into the
rat growth hormone promoter confers Ras responsiveness. We show that
Ets-1 is expressed in GH4 cells and, consistent with their
functional synergistic interaction, both Ets-1 and GHF-1 are able to
bind specifically to this bipartite RRE. We confirm that Ets-1 or a
related Ets factor is the nuclear target of the Ras pathway leading to
activation of the rPRL promoter and demonstrate that Elk-1 and Net do
not mediate the Ras response. Thus, the pituitary-specific POU
homeodomain transcription factor, GHF-1, serves as a cell-specific
signal integrator by functionally interacting with an Ets-1-like
factor, at uniquely juxtaposed binding sites, thereby targeting an
otherwise ubiquitous Ras signaling pathway to a select subset of
cell-specific GHF-1-dependent genes.
INTRODUCTION
The p21 Ras proto-oncogene is a critical component of a network of
signaling pathways that mediate the control of cell growth, metabolism,
and differentiation (1) Signals initiated at transmembrane receptors
are transduced via Ras and propagated, by a phosphorylation cascade, to
the nucleus, resulting in changes in the activity of specific
transcription factors (2, 3). Distinct signaling components of the Ras
pathway may be present in different cell types, allowing the signal to
be interpreted in a cell-specific manner (4, 5) Indeed, cell-specific,
phenotypic sequelae of Ras activation are exemplified by the
differential effects of oncogenic Ras in PC12 pheochromocytoma, TT
medullary carcinoma, and FRTL5 thyroid cells (6, 7, 8), whereby V-12 Ras
induces terminal differentiation of the first two cell lines but causes
transformation of the last. Thus, the characterization of cell-specific
endogenous nuclear factors that may act as effectors of the Ras
signaling pathway and the identification of specific Ras-responsive
cis-acting DNA elements are important unanswered questions.
Several Ras/Raf response elements (RREs)1
or oncogene response units have been identified to date, implicating
members of the Ets, AP-1, and ATF/CREB families of transcription
factors as nuclear components of the Ras signaling pathway (2, 3).
Tandem c-Ets-2 binding sites have been shown to confer Ras
responsiveness in NIH-3T3 cells (9), and dominant-negative Ets
constructs inhibit both Ras-induced mitogenesis (10) and transformation
(11). The serum response is governed by MAP kinase phosphorylation of
Elk-1, a member of the Ets family of transcription factors (12, 13),
thus facilitating its interaction with serum response factor (SRF).
Similarly, the Drosophila Ets factors, Pointed and Yan (14,
15), the negative regulator Net (16), and the repressor Erf (17) are
also regulated by the Ras/Raf/MAP kinase pathway.
A number of RREs contain AP-1-like elements (18, 19, 20). Furthermore, the
transcription potency of both c-Fos and c-Jun is enhanced by
phosphorylation catalyzed by Ras-activated protein kinases (21, 22),
and a transdominant Jun factor is able to suppress transformation of
cells by Ras (23). Other RREs contain a cAMP response element (CRE)
(24, 25), and Ras-dependent phosphorylation of CREB/ATF,
leading to increased transcription of the c-fos
proto-oncogene, has been demonstrated in PC12 cells (26). Finally,
the oncogene response units of certain cellular genes consists of
binding sites for both AP-1 and Ets factors (27, 28), and these
transcription factors have been shown to cooperate functionally in
mediating a Ras response (29, 30).
Regulation of the rat prolactin (rPRL) gene in the rat GH4
pituitary cell line is an excellent model system in which to study
cell-specific aspects of the Ras signaling pathway (31, 32, 33, 34).
GH4 cells are a highly differentiated neuroendocrine line,
which retain cell-specific functions and hormonal responses (35, 36, 37)
and express the phenotypic marker PRL under control of the
pituitary-specific, POU homeodomain transcription factor, GHF-1/Pit-1
(38, 39). We have previously shown that oncogenic V-12 Ras selectively
activates the rPRL promoter in GH4 cells and that the Ras
signal is not transduced via protein kinase C or protein kinase A. Indeed, in our pituitary model system, the Ras and protein kinase
A/protein kinase C signaling pathways are mutually antagonistic (33,
34). Furthermore, overexpression of c-Jun inhibits Ras activation of
the proximal rPRL promoter (34), which does not contain any DNA
sequences homologous to canonical CRE or AP-1 sites (32). Recent
evidence from this laboratory indicates a critical role for the
transcription factor Ets-1 in Ras activation of the rPRL promoter (32)
and demonstrates that a functional interaction of Ets-1 and GHF-1 is
required for an optimal Ras response (31). Additionally we have
proposed that an Ets binding site (EBS) adjacent to a GHF-1 binding
site (footprint IV (FPIV)), spanning positions 217 to 190,
functions as a composite rPRL promoter RRE. However, a recent report
has implicated a more proximal region of the rPRL promoter, ( 165 to
150), also containing a composite EBS/GHF-1 site, as being capable of
conferring Ras responsiveness on a heterologous promoter construct
(40). Thus, in the studies presented here, we determine the precise
cis-acting DNA sequences and transacting factors, within the
context of the proximal rPRL promoter, that are necessary and
sufficient for Ras activation. We utilized a series of site-specific
mutations and deletions in the proximal rPRL promoter to precisely map
the principal and physiologically relevant RRE to the composite
Ets-1/GHF-1 binding site spanning positions 217 to 190.
Furthermore, we show, using immunological and electrophoretic mobility
shift techniques, that GH4 rat pituitary cells express both
GHF-1 and c-Ets-1 and that both factors exhibit specific binding to
this composite RRE. In contrast, the more proximal element ( 165 to
150) (40) was not functionally relevant for Ras or Raf activation in
the context of an intact rPRL promoter.
Thus, the interaction of a widely expressed transcription factor,
Ets-1, with the pituitary-specific POU homeodomain factor GHF-1 at a
unique cis-element provides a molecular mechanism by which
the ubiquitous Ras signaling pathway can selectively regulate
expression of a cell-specific gene.
EXPERIMENTAL PROCEDURES
Cell Culture
GH4T2 rat pituitary tumor cells
were repassaged through rats as described (33) and grown in Dulbecco's
modified Eagle's medium (Life Technologies, Inc.) supplemented with
10% fetal calf serum (Hyclone, Logan, UT) and penicillin-streptomycin.
Cells were maintained at 37 °C in 5% CO2. Medium was
changed 4-12 h prior to each transfection, and cells were harvested at
50-70% confluency.
Plasmid Constructs
The reporter construct
pA3PRLluc (33) contains a 498-base pair
fragment, from positions 425 to +73, of the rPRL gene ligated
upstream of the firefly luciferase gene and downstream of three
polyadenylation termination sites in pA3luc.
pA3luc[s], containing a novel SalI
site in the polylinker, was constructed by cutting
pA3luc with SmaI and insertion of a
SalI linker. pG7PRL was constructed by ligation of the
EcoRI fragment from pG6PRL (41) into EcoRI-cut
pGem7.
Plasmids pSVras, pRSVRaf-BXB, and pSG5c-Ets-1 have been described
elsewhere (31). pTL1Elk-1 (13) and pTL2Net (16) encode the Ets
transcription factors Elk-1 and Net, respectively. A plasmid containing
the Escherichia coli -galactosidase gene under control of
the human cytomegalovirus immediate early promoter, pCMV (Clonetech) was used as an internal control for transfection
efficiency. The inducible bacterial expression vector pGEX2TrGHF-1
encodes a glutathione S-transferase (GST) rat GHF-1 fusion
protein, and pGEX2TEts encodes the DNA binding domain of human c-Ets2
fused to GST. Plasmid DNAs were purified by alkaline-SDS extraction and
cesium chloride density gradient centrifugation. DNA was quantified by
spectrophotometry at 260 nm and by comparison with DNA standards on
agarose gel electrophoresis.
Exonuclease Deletions and Site-directed Mutagenesis
The
series of rPRL promoter deletions were constructed by exonuclease III
digestion. pG7PRL was linearized with ApaI, leaving a
3 -overhang, and then digested with XhoI to generate a
5 -overhang immediately upstream of the rPRL promoter sequence, thereby
allowing unidirectional deletion of bases. The resulting rPRL promoter
fragment was treated with 1000 units of exonuclease III (Boehringer
Mannheim) in 66 mM Tris-HCl, 77 mM NaCl, 5 mM MgCl2, and 10 mM EDTA, pH 8.0, at 20 °C. Aliquots (2.5 µl) were removed at 20-s intervals over 8 min and added to 7.5 µl of 30 mM sodium acetate, 50 mM NaCl, 1 mM ZnCl2, 5% glycerol
containing 2 units of mung bean nuclease (U.S. Biochemical Corp.).
Reactions were incubated for a further 10 min at 37 °C to cleave
single-stranded DNA and terminated by heating to 65 °C for 10 min.
Samples from each of five consecutive time points were pooled,
extracted with phenol:chloroform, and ethanol-precipitated. The
resulting five groups were filled in with T4 DNA polymerase (Life
Technologies, Inc.), and the pG7PRL constructs were religated in the
presence of SalI linker (Life Technologies, Inc.). The
deletions were transformed into E. coli DH5 , and
minipreps were digested with SalI and HindIII to
estimate the insert size. Selected deletions (see figure legends) were
directionally cloned into SalI/HindIII-cut
pA3luc[s], and the deletion end points were
verified by dideoxy sequencing of the rPRL promoter fragments.
The pA3(mEBS)rPRLluc promoter was created by PCR
site-directed mutagenesis of the 214 to 209 EBS in pG7rPRL. The
core AAGGAA was changed to CTCGAG, generating a unique XhoI
restriction site, and the resulting construct was cloned into the
HindIII restriction site of pA3luc.
Similarly the pA3(mFPIV)luc promoter was
constructed by mutation of the core GHF-1 binding site ( 195 to 200)
within FPIV (41) from ATTAAT to a SalI site GTCGAC. Both
promoters were then sequenced to confirm the presence of the mutant EBS
or mutant GHF-1 binding site and verify that the promoters were
otherwise identical to pA3PRLluc. The
pA3rGHluc reporter containing a 593-base pair
fragment encompassing positions 528 to +65 of the rGH gene has been
described elsewhere (33). The plasmid
pA3rGH(RRE)luc was generated by PCR
site-directed mutagenesis to replace the distal GHF-1 footprint ( 135
to 113) of the rGH promoter (33) with the composite Ets/GHF-1 binding
site from the rPRL promoter ( 219 to 188). The PCR product was blunt
ended and cloned into SmaI-cut
pA3luc, and the entire promoter was
sequenced.
Electroporation
GH4 cells were harvested in
0.05% trypsin, 0.5 mM EDTA and resuspended in Dulbecco's
modified Eagle's medium supplemented with 10% fetal calf serum.
Aliquots of approximately 2-4 × 106 cells in 200 µl of medium were added to plasmid DNA and transfected by
electroporation (36) at 220 V and 500 µF using a Bio-Rad gene pulser
with 0.4-mm cuvettes. All transfections included pCMV as an
internal control for transfection efficiency. Total DNA was kept
constant, and nonspecific effects of viral promoters were controlled
for by using empty vector or pRSV -globin. Following transfection,
cells were plated in Dulbecco's modified Eagle's medium with 10%
fetal calf serum and incubated for 24 h. Electroporations were
performed in triplicate for each condition within a single experiment,
and experiments were repeated using different plasmid preparations of
each construct.
Luciferase and -Galactosidase Assays
Transfected cells
were harvested in phosphate-buffered saline (Life Technologies, Inc.)
containing 3 mM EDTA, and extracts were prepared by three
sequential freeze-thaw cycles in 100 mM potassium
phosphate, 1 mM dithiothreitol, pH 7.8. Cell lysis was
increased by vortexing between cycles. Cell debris was pelleted by
centrifugation at 10,000 × g for 10 min at 4 °C,
and aliquots of the supernatant were used in subsequent assays.
Luciferase was assayed as described previously, (31, 33), samples were
measured in duplicate using a Monolight 2010 luminometer (Analytical
Luminescence Laboratories, San Diego, CA). -Galactosidase activity
was determined spectrophotometrically using the chromogenic substrate
o-nitrophenyl- -D-galactopyranoside
essentially as described (31, 33). Total luciferase light units were
normalized to total -galactosidase activity. The normalized relative
luciferase activity for each control was set to 1, and results were
expressed as -fold rPRL promoter activation.
Electrophoretic Mobility Shift Assays
Whole cell extracts
were prepared by harvesting confluent GH4 cells in
phosphate-buffered saline containing 3 mM EDTA and
resuspending pellets in 50 mM Tris, 150 mM
NaCl, 5 mM MgCl2, 1 mM
phenylmethylsulfonyl fluoride, 1 mM dithiothreitol, and
0.1% Triton X-100, pH 7.4. Cells were lysed by sonication, and
extracts were clarified by centrifugation at 15,000 × g for 10 min at 4 °C. Extracts of DH5 E. coli expressing GST fusion proteins were prepared essentially as
described previously (42). Double-stranded oligonucleotides (see figure
legends) were labeled using T4 polynucleotide kinase or Klenow DNA
polymerase. Probes (~30,000 cpm, 0.2-0.5 ng) were incubated for 30 min at 4 °C, with the indicated E. coli or
GH4 cell extracts in 10 mM Hepes, 70 mM KCl, 4% glycerol, 1 mM EDTA, and 2 mM dithiothreitol, pH 7.9, containing 500 ng/ml sheared
herring sperm DNA or 1 mg/ml poly(dI,dC) in a final volume of 20 µl.
Loading buffer (2 µl of 25% Ficoll, 0.01% bromphenol blue) was
added, and the samples were electrophoresed on a 6% polyacrylamide,
4% glycerol gel in 0.25 × TBE (22.5 mM Tris borate,
0.5 mM EDTA) at 200 V for approximately 2 h. Gels were
dried, and DNA-protein complexes were detected by autoradiography.
Western Blots
Cell extracts were prepared from confluent
100-mm dishes. Cells were washed in cold phosphate-buffered saline and
harvested with Laemmli SDS sample buffer. Extracts were boiled for 5 min, and viscosity was reduced by shearing through a 22-gauge needle.
Samples were resolved on 10% SDS-polyacrylamide gels and transferred
to nitrocellulose in 192 mM glycine, 25 mM
Tris, 10% methanol at 100 mA for 16 h. Filters were blocked in
5% nonfat milk, 0.2% Tween 20, probed with antibodies to GHF-1
(BAbCO, Berkeley, CA) or c-Ets-1 (Santa Cruz Biotech, CA), and
developed using ECL (Amersham Corp.) according to the manufacturer's
protocols. Antibodies to Elk-1 and Net were generously provided by Dr.
B. Wasylyk (IGBMC, CNRS, Strasbourg).
RESULTS
Mapping of the Ras-responsive Element of the Rat PRL
Promoter
Both the rPRL and rGH genes require the
pituitary-specific POU homeodomain transcription factor GHF-1 for their
expression (35, 39), and the promoters of both genes contain multiple
GHF-1 binding sites (41). Previous studies have shown that the proximal
GHF-1 binding sites (Fig. 1) are required for activation
of the rPRL promoter in response to several hormones and growth factors
(35, 43). FPI and FPIII are necessary for activation of the rPRL
promoter by thyrotropin-releasing hormone (44), and FPI is also
critical to mediate cAMP induction of PRL transcription (36, 45, 46, 47).
Interestingly, these DNA cis-elements have also been
implicated in the response of the rPRL promoter to both EGF (44, 48)
and insulin (37, 49), both of which are known to transduce their
signals via the Ras pathway in other cell types (50, 51). Subsequent
studies indicate that insulin and EGF activation of the rPRL promoter
require the basal transcription element (BTE) and the adjacent
repressor binding site, FPII, respectively (see Fig. 1) (44, 49, 52,
53). To investigate the role of specific GHF-1 binding sites in the Ras
activation of the rPRL promoter, a series of rPRL promoter constructs
(47) that contain site-specific mutations in the proximal GHF-1 binding
sites (FPI and/or FPIII), were tested for their ability to respond to
the Ras signal. Similarly, to examine the contribution of F2F/FPII and
BTF/ BTE factors and binding sites to the Ras response, constructs
containing a site-specific mutation of FPII, alone or combined with a
deletion of the BTE (47), were also tested.
Fig. 1.
Effect of site-directed mutagenesis of the
proximal GHF-1 binding sites on Ras activation of the rPRL
promoter. GH4 cells were cotransfected with 0.5 µg
of pCMV and 5 µg of the indicated rPRL promoter constructs with
or without 2 µg of pSVras. GHF-1 binding sites (47) (FPI, FPIII, and
FPIV) are shown by the shaded rectangles. The FPII repressor
site and BTE are denoted by the oval and
triangle, respectively. The solid black bars
indicate site-specific mutations, and missing symbols denote
a deletion. Cells were harvested 24 h after transfection and
assayed for luciferase and -galactosidase activity. Ras activation
of each rPRL promoter construct is expressed as -fold increase over the
appropriate control. Results are the mean ± S.D. of three
transfections.
[View Larger Version of this Image (40K GIF file)]
Co-transfection experiments were completed with the site-specific and
5 -deletion mutant rPRL promoter constructs depicted in Fig. 1. The
data show that a site-specific mutation in the most proximal GHF-1
binding site, FPI ( 1), reduces the Ras activation of the rPRL
promoter by approximately 40%. The significance of any loss of the Ras
activation by mutation of FPI alone is unclear, since the 1,3
construct, which contains the same FPI mutation in combination with a
site-specific mutation in the next upstream GHF-1 site, FPIII, retains
a full Ras response (Fig. 1). Additionally, an rPRL promoter containing
an internal deletion overlapping FPI, from position 55 to 155, was
also fully responsive to Ras (data not shown). Of note, FPI has been
shown to bind GHF-1 with the highest affinity, followed by FPIII, with
the lowest affinity binding at FPIV (41). Mutation of FPII ( 2) had
no effect on Ras activation of the promoter, and similarly, the Ras
response is not affected by a BTE deletion ( 2D) in the region
extending from 80 to 112 in the 2 background (Fig. 1). Thus, of
the site-specific mutant rPRL promoter constructs tested, only 1
exhibited any decrease in the Ras response compared with the 425
control. The inability of FPII, FPIII, and BTE mutants to modulate the
Ras response demonstrates that these DNA sequences and the factors that
bind to them are not required for Ras activation of the rPRL promoter.
Thus, the two most proximal GHF-1 binding sites and other, previously
defined, proximal transcription factor binding sites are not the
primary cis-elements of the rPRL promoter targeted by the
Ras-initiated signal. Furthermore, these proximal elements alone are
not sufficient to mediate the Ras response. Consistent with these
results, the rGH promoter, which is also dependent upon GHF-1 and
contains multiple GHF-1 binding sites, is not activated by V-12 Ras
(31, 33). However, the possibility that factors that bind to FPI,
including GHF-1, may modestly contribute to the Ras response was not
ruled out.
The above experiments did not address the role of the most distal and
lowest affinity GHF-1 binding site, FPIV. Furthermore, we have
previously noted a significant decrease in basal rPRL promoter activity
upon removal of the region upstream of FPIV ( 425 to 212), despite
the fact that no factor binding footprints were detected in that span
of rPRL DNA using crude GH3 and GH4 extracts
(41). Therefore, it was postulated that this upstream DNA segment may
mediate a hormone (or growth factor)-regulated response (36). Sequence
examination of the rPRL promoter sequence revealed several potential
binding sites for members of the Ets family of transcription factors
(54, 55) in both this upstream region ( 425 to 212) and in the more
proximal promoter (Fig. 2). Although two noncanonical
AP-1 sites were also identified in this region, at 240 and 233, it
seemed highly unlikely that either of these functioned as a
Ras-responsive element, since neither is a consensus binding site and
c-Jun had been previously shown to be antagonistic to the rPRL promoter
Ras response (33, 34). In contrast, we have previously shown that
overexpression of a dominant-negative Ets factor (10) significantly
inhibits Ras activation of the rPRL promoter (32) and that
co-transfection of intact c-Ets-1 synergistically enhances the Ras
response (31), thus implicating an Ets-related factor as a nuclear
acceptor of the Ras signal.
Fig. 2.
Mapping of the Ras- and Raf-responsive
element of the proximal rPRL promoter. A, structure of the
proximal rPRL promoter. The region between nucleotides 425 and +73 is
depicted. GHF-1/Pit-1 binding sites (FPI, FPIII, and FPIV), as
determined by DNase protection (41), are indicated by the shaded
rectangles. Putative Ets binding sites, containing the core GGAA
motif, are shown by the white rectangles. The FPII repressor
site and BTE (47) are denoted by the stippled circle and
open triangle, respectively. Numbers in
boldface type indicate the 5 end points, shown by the
arrows, of the exonuclease III deletion
pA3PRLluc constructs. B, effect of
Ras and Raf on rPRL promoter deletions. GH4 cells were
cotransfected with 0.5 µg of pCMV and 5 µg of the indicated
rPRL promoter 5 deletion construct in the presence or absence of 2 µg of pSV Ras or 5 µg of pRSVBXB-Raf. PRL promoter activity was
determined as described under ``Experimental Procedures.'' Ras and
Raf -fold activation was calculated as in Fig. 1 and expressed as a
percentage of the -fold activation of the intact 425 rPRL promoter.
Mean Ras activation was 8.1-fold, and mean Raf activation was 20-fold
over basal. Results are the mean ± S.E. of nine
transfections.
[View Larger Version of this Image (36K GIF file)]
In order to more precisely map the cis-elements of the rPRL
promoter required for activation by Ras and to elucidate which of the
potential Ets binding sites were important, an exonuclease III deletion
procedure was used to generate a series of 5 rPRL promoter deletions.
Transfection experiments using this series of deletions, the 5 end
points of which are shown in Fig. 2A, were carried out to
determine the region(s) of the rPRL promoter necessary for Ras
responsiveness. We have previously identified the protein kinase Raf-1
(27) as a functional, downstream component of the Ras signaling pathway
leading to rPRL promoter activation (32). Thus, the indicated rPRL
promoter constructs were cotransfected in the presence or absence of
constitutively active forms of Ras (V-12 Ras) or the downstream
effector Raf-1 (Raf-BXB), since the Ras and Raf response elements
should co-localize. Fig. 2B illustrates that the 425 and
255 constructs are significantly activated by both Ras and Raf. In
fact, the 255 promoter was stimulated by Ras and Raf to a greater
extent than the intact ( 425) proximal rPRL promoter. In other
experiments, a 390 deletion also retained a full Ras response
comparable with the intact promoter (not shown). Possible structural
differences in the 255 construct may account for the increased
Ras/Raf activation; alternatively, there may be a yet undefined
inhibitory element in the 255 to 390 region of the rPRL promoter.
In contrast, 5 rPRL promoter downstream deletions at 212 and 189
show only a minimal Ras/Raf activation, and the Ras/Raf response is
eliminated by deletion to position 36 (Fig. 2B).
Similarly, 138, 125, and 54 rPRL promoter constructs exhibited no
significant activation by Ras or Raf (data not shown).
These results indicate that the Ras and Raf responses co-localize to an
element that lies within, or overlaps, the 212 to 255 region of the
rPRL promoter and clearly implicate the EBS, located between 217 and
209, immediately adjacent to FPIV ( 190 to 208) (Fig.
2A). Of note, in some cases a minimal residual Ras response
was seen using the 212 rPRL promoter (not shown), suggesting that the
adjacent GHF-1 binding site (FPIV) may also play a role in the Ras/Raf
response, forming a composite Ets/GHF response element. Consistent with
these observations, we have shown that overexpression of either c-Ets-1
or GHF-1 enhances Ras activation of the rPRL promoter and that optimal
Ras response requires both factors (31). Furthermore, an analogous
EBS/GHF composite element is not found in the rGH promoter, presenting
a potential explanation of the lack of Ras response in this closely
related promoter. Thus, the results from these studies map the Ras and
Raf responses to a single region of the rPRL promoter spanning the
217 to 190 region and further suggest that Ras and Raf activation
of the rPRL promoter is mediated via a unique composite Ets/GHF-1
binding site.
Site-directed Mutagenesis of the RRE
To verify the functional
role of the proposed composite RRE in the Ras activation of the rPRL
promoter, both GHF-1 and Ets binding sites were independently mutated,
as shown in Fig. 3A, using PCR site-directed
mutagenesis. The resulting pA3(mEBS)rPRLluc and
pA3(mFPIV)rPRLluc reporter constructs containing
mutations in the Ets and GHF-1 binding sites, respectively, were
transiently transfected in the presence of activated Ras or Raf to
determine the effect of the mutations on rPRL promoter activation. Fig.
3B shows that mutation of the EBS almost completely
abrogates both Ras and Raf responses. While there is a greater than
8-fold Ras activation of the 425 rPRL promoter, minimal 1.5-fold
activation is observed with the mutant EBS promoter. Similarly, Raf
activates the 425 rPRL promoter approximately 6-fold, whereas the
mutant EBS promoter exhibits no significant Raf response. Minimal Ras
responses of the mEBS promoter in some experiments suggest that the
mutation does not simply alter the promoter structure so greatly that
it is no longer active, and they are consistent with the residual Ras
response noted for the 212 rPRL deletion (31). Additionally, the mEBS
promoter retains a protein kinase A response comparable with the intact
rPRL promoter (not shown).
Fig. 3.
Site-directed mutagenesis of the Ets binding
site and the GHF-1 binding site of the rPRL promoter RRE significantly
reduces Ras and Raf activation. A, sequence of the rPRL
promoter Ras-responsive element. Site-directed mutations of the
Ets (EBS) and GHF-1 (FPIV) binding sites to generate the
pA3(mEBS)PRLluc and
pA3(mFPIV)PRLluc constructs, respectively, are
shown under the wild type sequence. B,
GH4 cells were cotransfected with 3 µg of wild type
pA3rPRLluc ( 425) or 3 µg of
mutant pA3(mEBS)PRLluc promoter
(mEBS) and 0.3 µg of pCMV in the presence or absence
of 2 µg of pSVras or 5 µg of pRSVBXB-Raf as indicated.
C, GH4 cells were cotransfected with 3 µg of
wild type pA3rPRLluc ( 425) or 3 µg of pA3(mFPIV)PRLluc mutant promoter
(mFPIV) and 0.3 µg of pCMV in the presence or absence
of 3 µg of pSVras or 10 µg of pRSVBXB-Raf as indicated. Promoter
activity was calculated as in Fig. 2. Luciferase activity was
normalized to -galactosidase, and the basal activity of each
promoter in the absence of Ras/Raf was set to 1. Results are expressed
as -fold activation over control and are the mean ± S.E. of nine
transfections.
[View Larger Version of this Image (38K GIF file)]
In an analogous experiment, the rPRL promoter bearing a mutant FPIV
GHF-1 binding site exhibits a significantly attenuated Ras/Raf
response, less than 50% of the intact promoter (Fig. 3C).
However, in contrast to the pA3(mEBS) rPRLluc
construct, the pA3(mFPIV)rPRLluc promoter
retains significant residual activation by both Ras and Raf. Thus, the
17-fold Ras activation of the 425 promoter is reduced to 7.8-fold in
the FPIV mutant, and the 18-fold activation of the wild type promoter
by Raf is correspondingly diminished to 8-fold. The greater -fold
activation by Ras and Raf in this experiment reflects the increased
amounts of Ras and Raf transfected in order to clearly demonstrate the
decreased Ras/Raf activation of the
pA3(mFPIV)rPRLluc promoter.
The partial Ras/Raf response of the
pA3(mFPIV)rPRLluc promoter could possibly
reflect residual, reduced affinity binding of GHF-1. Thus, to assess
the ability of the mutant FPIV site to bind GHF-1, an electrophoretic
mobility shift assay using increasing amounts of a bacterial extract
expressing a GST-GHF-1 fusion protein was performed (Fig.
4). No specific complexes were observed in the presence
of bacterial extract expressing GST alone (lanes 2 and
8). Incubation of GST-GHF-1 with a radiolabeled probe
corresponding to the 190 to 220 sequence of the rPRL promoter (RRE)
reveals dose-dependent formation of a single major complex,
B1 (lanes 3-6). The faster migrating, minor DNA-protein
complexes B2 and B3 may be due to degradation products of GST-GHF-1
present in the extract. In contrast, no DNA-protein complexes are
formed in the presence of a probe containing the mutant (mFPIVRRE) FPIV
site (lanes 9-12). In a similar experiment, an excess of
unlabeled mutant oligonucleotide (mFPIVRRE) failed to compete with
GST-GHF-1 binding to the intact RRE (not shown). These data indicate
that the mutant pA3(mFPIV)rPRLluc promoter has
completely lost the ability to bind GHF-1 at this site. Thus, the
results of site-specific mutation of both elements of the composite RRE
suggest that, while the Ets binding site is required to mediate the Ras
response, the vicinal GHF-1 site is necessary but not sufficient for
full activation of the promoter by Ras or Raf. Similarly, the low basal
activity of the mutant EBS construct (not shown) suggests that binding
of an Ets factor at this site may also be required to maintain basal
rPRL promoter activity in pituitary cells.
Fig. 4.
Mutation of FPIV abolishes binding of GHF-1
to the rPRL promoter RRE. Probes corresponding to the wild type
RRE (rPRL 190 to 220, GCTGTAAAGGAAAACGACATTAATTAGTTTT (lanes
1-6)) or mFPIVRRE (rPRL 188 to 207, AACGACATCAGCTGGTTTTAGG
(lanes 7-12)) were incubated with 1, 2, 5, and 10 µg of
E. coli extract expressing a GST-GHF-1 fusion protein
(lanes 3-6 and 9-12). 10 µg of extract
expressing GST only was used as a control (lanes 2 and
8). DNA-protein complexes were analyzed by nondenaturing
polyacrylamide gel electrophoresis and detected by
autoradiography.
[View Larger Version of this Image (60K GIF file)]
Insertion of the RRE Renders the rGH Promoter Responsive to
Ras
We have previously shown that the GHF-1-dependent
rGH promoter, which is homologous to the rPRL promoter and contains
both GHF-1 binding sites and several potential Ets sites, does not
exhibit a Ras response (31, 33). We proposed that this lack of Ras
activation reflected the lack of a composite GHF-1/Ets-1 RRE. To
directly test this hypothesis and to verify the physiological role of
the rPRL RRE composite element, this RRE was inserted into the rGH
promoter. PCR site-directed mutagenesis was used to replace the distal
GHF-1 binding site ( 135 to 113) in the rGH promoter with the
composite Ets/GHF-1 binding sites derived from the rPRL promoter RRE
( 217 to 190). The resulting reporter construct, pA3rGH
(RRE)luc, was transiently transfected into GH4
cells to determine the effect of oncogenic Ras. As shown in Fig.
5, the PRL promoter exhibits a typical 8-fold Ras
response, whereas the rGH promoter is not activated by Ras. However
insertion of the composite RRE into the rGH promoter confers a 4-fold
Ras response. These results, in conjunction with the mutagenesis of the
RRE (Fig. 3), provide further evidence for the critical physiological
role of the composite Ets/GHF-1 rPRL promoter element ( 217 to 190)
in conferring cell type- and promoter-specific Ras activation of PRL
gene expression.
Fig. 5.
Insertion of the rPRL promoter RRE renders
the rGH promoter responsive to Ras. GH4 cells were
cotransfected with 3 µg of wild type
pA3rPRLluc (rPRL), 3 µg
pA3rGHluc (rGH) or 3 µg
pA3rGH(RRE)luc (rGH(RRE)) and 0.3 µg of pCMV in the absence (Control) or presence
(+Ras) of 2 µg of pSVras. Promoter activity was calculated
as in Fig. 2. Luciferase activity was normalized to -galactosidase,
and the basal activity of each promoter in the absence of Ras was set
to 1. Results are expressed as -fold activation over control and are
the mean ± S.E. of nine transfections.
[View Larger Version of this Image (34K GIF file)]
The rPRL Promoter Ras Response Is Not Transduced via Elk-1 or
Net
Members of the Ets family of transcription factors appear to
act via cooperative interactions with other transcription factors,
resulting in synergistic activation of transcription (54, 55). The
interaction of the Ets factor Elk-1 with SRF bound to a serum response
element (SRE), provides a classic example. This Elk-1/SRF functional
interaction is regulated by the Ras pathway via MAP kinase
phosphorylation of Elk-1 (12, 13, 56). Net is another member of the Elk
subfamily able to interact with SRF. In contrast to Elk-1, Net inhibits
transcription but is converted to an activator by Ras (16). Since we
have previously demonstrated a role for MAP kinase in the rPRL promoter
Ras response (32) and the FPIV region bears some similarity to the
AT-rich core of the palindromic SRE recognition element (CCTAATTAGG)
(57), the possible role of Elk-1 and Net in the Ras response of the
rPRL promoter was investigated. As shown in Fig. 6, and
consistent with our previous results (31), co-transfection of c-Ets-1
slightly increases basal rPRL promoter activity (1.5-fold) and enhances
the Ras response increasing it from 10.7- to over 15-fold. In contrast,
transient transfection of either Elk-1 or Net resulted in significant
inhibition of basal rPRL promoter activity (solid bars) and
actually reduced the Ras activation from 10.7-fold to 7.4- and
6.6-fold, respectively (shaded bars). Of note, transfection
of c-Ets-1, Elk-1, and Net into COS-1 cells resulted in similar levels
of protein expression of each factor, as detected by specific
antibodies (not shown). Thus, unlike Ets-1, neither Elk-1 nor Net is
likely to be a nuclear component of the Ras pathway leading to
activation of the rPRL promoter. Although Elk-1 and Net may compete
with c-Ets-1 for binding to the RRE, to inhibit both basal and
Ras-stimulated rPRL promoter activity, the precise mechanism of
negative modulation of the Ras signal by these Ets factors remains to
be investigated.
Fig. 6.
Effect of the Ets factors Ets-1, Elk-1, and
Net on Ras activation of the rPRL promoter. GH4 cells
were cotransfected with 3 µg of pA3rPRLluc and
0.3 µg of pCMV in the presence (shaded bars) or
absence (solid bars) of 2 µg of pSVras and either 10 µg
of pSG5 (Vector), 10 µg of pSG5c-Ets-1, 10 µg of pTL1Elk-1, or 10 µg of pTL2Net as indicated. PRL promoter activity was calculated as
described previously and expressed as -fold increase over control.
Numbers indicate the -fold activation of the promoter
induced by oncogenic Ras in each case. Results are the mean ± S.D. of three transfections.
[View Larger Version of this Image (35K GIF file)]
An Endogenous Ets-1-related Factor Is Present in GH4
Pituitary Cells
The studies presented here clearly show that an
Ets-1-like factor, rather than an Elk or Net factor, is a critical
component of the Ras signaling pathway leading to selective activation
of the rPRL promoter. We have previously documented, by gene transfer
experiments, that c-Ets-1, but not the related factor c-Ets-2,
activates the basal promoter and enhances the Ras response (Fig. 6 and
Ref. 31). Furthermore, c-Ets-1, but not c-Ets-2, functionally interacts
with GHF-1 to mediate Ras activation of the rPRL promoter (31).
Although c-Ets-1 was originally thought to be present predominantly in
hematopoietic and macrophage cells (55), more recent studies have shown
that this factor is more widely expressed (58, 59, 60). In order to confirm
that an endogenous Ets-1 like factor was present in GH4
pituitary cells, whole cell extracts were prepared, separated by
SDS-polyacrylamide gel electrophoresis, and analyzed by Western
blotting (Fig. 7). Blots were probed with an antibody
(ets1 N-276) that recognizes only the Ets-1 isoform (Santa Cruz
Biotechnology, CA). Fig. 7, lane 2, shows that
GH4 cells appear to contain an Ets-1-like protein,
indicated by the presence of a band of approximately 54 kDa, which is
consistent with the major Ets-1 isoform (p54). As a control, extracts
were also analyzed for the pituitary-specific factor GHF-1/Pit-1 using
a specific antibody (antipeptide 214-230; BAbCO) that recognizes a
protein of about 33 kDa (lane 1) corresponding to GHF-1.
Thus, in accordance with a composite Ets-1/GHF-1 element being
necessary for the Ras activation of the rPRL promoter, GH4
rat pituitary cells express both GHF-1 and an endogenous protein
homologous to the transcription factor c-Ets-1.
Fig. 7.
Detection of Ets-1 protein in GH4
cells extracts. GH4 whole cell extracts (100 µg)
were resolved on a 10% SDS-polyacrylamide gel and transferred to
Immobilon polyvinylidene difluoride membrane (Millipore Corp.).
Duplicate blots were probed with a 1:1000 dilution of anti-GHF-1
(214-230) antipeptide antibody (BAbCO) (lane 1) or a 1:1000
dilution of an Ets-1-specific antibody (ets1 N-276; Santa Cruz Biotech,
CA) (lane 2). Shown is an autoradiograph after detection by
enhanced chemiluminescence (ECL; Amersham) according to the
manufacturer's directions. Arrows indicate the position of
prestained RainbowTM (Amersham) molecular weight
standards.
[View Larger Version of this Image (24K GIF file)]
To further characterize the endogenous GH4 pituitary Ets
factors, electrophoretic mobility shift assays were performed using an
oligonucleotide probe containing a known consensus Ets binding site,
derived from the murine sarcoma virus long terminal repeat (MSV-EBS)
(61). As shown in Fig. 8, lane 2, a single
major complex (B1) is formed upon incubation of GH4 cell
extract with the consensus EBS. This binding is eliminated by the
addition of excess unlabeled MSV-EBS oligonucleotide (lanes
3 and 4). Complex formation is also abolished by an
excess of an oligonucleotide corresponding to the rPRL promoter
composite RRE ( 220 to 190) (lanes 7 and 8)
but is not affected when unlabeled rPRL RRE oligonucleotide competitor
containing a mutation in the EBS (mEBS RRE) is included (lanes
5 and 6). An oligonucleotide spanning the FPI high
affinity GHF-1 site (FPI), which does not contain an EBS, also fails to
compete with binding to the MSV-EBS probe. Together, these results show
that GH4 cells contain a factor homologous to c-Ets-1 (Fig.
7), show that a consensus EBS results in a single specific shifted
complex (Fig. 8), and suggest that this Ets factor is also able to
specifically bind to the EBS site within the rPRL promoter RRE (Fig.
8).
Fig. 8.
Electrophoretic mobility shift analysis of
GH4 cell extracts using a consensus Ets binding site.
Aliquots of GH4 whole cell extracts were incubated with a
32P-labeled double-stranded oligonucleotide encoding the
EBS (CTCGGAGAGCGGAAGCGCGCA) derived from the murine sarcoma virus long
terminal repeat (MSV-EBS). DNA-protein complex formation was competed
using oligonucleotides corresponding to the intact rPRL promoter RRE,
mEBSRRE containing a mutant Ets site, or FPI.
[View Larger Version of this Image (39K GIF file)]
An Ets Family Member Can Bind to the rPRL RRE
To directly
assess binding of an Ets family member to the putative ( 217 to 209)
EBS within the rPRL promoter RRE, we first performed a gel mobility
shift assay using an oligonucleotide encompassing the 220 to 190
region of the rPRL promoter and recombinant GST-Ets protein. Labeled
probe (RRE) was incubated with the highly conserved Ets DNA binding
domain, expressed as a GST fusion protein, as described under
``Experimental Procedures.'' The results of this assay are shown in
Fig. 9A. While a nonspecific complex (B3) is
observed in the presence of GST alone (lane 2), incubation
with the GST-Ets protein results in the formation of a major (B2) and a
minor (B1) complex with the RRE (lane 3). This GST-Ets·RRE
complex is abolished by the addition of an excess of unlabeled RRE
(lanes 6 and 7) but not by the same excess of an
oligonucleotide that has a mutation (mEBS RRE) in the consensus EBS
(lanes 4 and 5). Additionally, binding of GST-Ets
to the RRE is not significantly affected by the addition of excess FPI
oligonucleotide, which contains a strong GHF-1 binding site
(lanes 8 and 9). This indicates that GST-Ets is
not binding to the FPIV GHF-1 site within the RRE. Thus, a bacterial
GST-Ets fusion protein encoding the highly conserved DNA binding (ETS)
domain is able to specifically bind to the EBS within the rPRL promoter
RRE.
Fig. 9.
Binding of Ets to the rPRL promoter RRE.
A, a radiolabeled probe (RRE) derived from the rPRL promoter
( 190 to 220) was incubated with 5 µg of E. coli
extract expressing the GST-Ets fusion protein in the presence or
absence of the indicated excesses of unlabeled competitor
oligonucleotides RRE, mEBSRRE, and FPI as in Fig. 8. Extract (5 µg)
from E. coli expressing GST alone was used as a control.
B, a double-stranded probe (TCGACCAGCAAAAGGAAATGAGA)
encompassing 220 to 203 of the rPRL promoter (EBS) was incubated
with 3 µg of GH4 nuclear extract in the presence or
absence of an excess of unlabeled competitor (EBS) or an excess of
oligonucleotide containing a mutation in the core GGAA Ets binding site
(mEBS). DNA-protein complexes were analyzed by nondenaturing
polyacrylamide gel electrophoresis and detected by
autoradiography.
[View Larger Version of this Image (32K GIF file)]
In order to determine whether the EBS within the RRE binds an
endogenous Ets factor, contained in GH4 cell extracts, we
used a double-stranded DNA oligonucleotide probe spanning positions
220 to 203 of the rPRL promoter (EBS) and incubated it with
GH4 nuclear extract (Fig. 9B). Although major
(B3) and minor (B2) nonspecific bands are noted, a faint band (B1) that
reveals specificity is also evident (lane 2). Formation of
the B1 complex is selectively inhibited by an excess of unlabeled EBS
probe (lanes 3 and 4), whereas a similar EBS
probe mutated in the core GGAA Ets binding motif (mEBS) fails to
interfere with B1 complex formation (lanes 5 and
6). Additionally, the irrelevant FPI probe does not compete
the B1 complex (data not shown).
Together, the results of these gel mobility shift assays (Figs. 8 and
9) confirm that GH4 cells contain an endogenous Ets-1-like
factor that is able to bind specifically to the EBS within the PRL
promoter RRE. Although we have as yet been unable to demonstrate
formation of a stable ternary complex, this RRE is also able to bind
GHF-1 (Ref. 41 and Fig. 4), indicating that it serves as a composite
signaling element. The juxtaposition of factor binding sites
facilitates the functional interaction of an Ets-1-like factor, with a
tissue-specific transcription factor, GHF-1, thereby allowing the
ubiquitous Ras signal transduction pathway to be harnessed in a
pituitary-specific manner (31).
DISCUSSION
Identification of the Functionally Relevant Ras Response Element of
the rPRL Gene
Although significant progress has been made in the
identification of RREs in proto-oncogenes and oligonucleotide sequences
fused to minimal promoters, a similar characterization of naturally
occurring RREs in cellular genes is generally lacking. In this report,
we provide detailed characterization of a functionally relevant RRE in
a highly specialized, tissue-specific, cellular gene, rPRL. We used a
combination of 5 deletion and site-specific mutagenesis in the context
of an intact, proximal rPRL promoter, to localize the RRE to a
composite element composed of an EBS and a vicinal GHF-1/Pit-1 binding
site spanning positions 217 to 190. We have previously shown that,
at the trans-acting factor level, a functional interaction
of c-Ets-1 and GHF-1 is required to obtain optimal Ras and Raf
responses (31). Here we verify that, at the cis-level, each
unit of the composite element contributes to the Ras and Raf responses
of the rPRL promoter. Although site-specific mutation of the EBS
essentially eliminates both Ras and Raf effects, a similar mutation in
the adjacent GHF-1 binding site (FPIV) results in a marked reduction,
but not complete elimination, of the Ras/Raf responses (Fig. 3). These
data suggest that a c-Ets-1-like factor is the critical nuclear
component governing Ras/Raf responses of the rPRL gene, whereas GHF-1
DNA-binding is necessary but not sufficient to mediate Ras-inducible
gene transcription. A recent report describes a composite Ets/GHF-1
element encompassing most of FPIII ( 165 to 150), which is
sufficient to confer multihormonal responses, including Ras, when fused
to a minimal heterologous promoter (40). However, this report did not
include 5 deletion or site-specific mutations of putative RREs in the
context of the intact rPRL promoter. By contrast, in our studies, in
the context of an intact proximal rPRL promoter, this FPIII composite
element was functionally irrelevant for the Ras and Raf responses.
Specifically, site-specific mutation of the GHF-1 binding sites in
FPIII does not interfere with the Ras response (Fig. 1), and an intact
FPIII region in the 212 and 189 rPRL promoter constructs failed to
confer a response to either Ras or Raf (Fig. 2). Also, a single copy of
the 220/ 190 RRE mapped here was sufficient to confer Ras activation
to an otherwise unresponsive rGH promoter (Fig. 5). Nevertheless, the
report of Howard and Maurer (40) stressed the importance of an
Ets-related factor for the Ras response, and in this point we are in
complete agreement. Together, these data are consistent with our
hypothesis that a c-Ets-1-like factor is the nuclear target of the
Ras/Raf/MAP kinase pathway and that it is likely to be phosphorylated
via this pathway at a consensus MAP kinase site, threonine 82, since
site-specific mutation of this amino acid results in a loss of the Ras
effect (62).2
Although we have not yet identified the precise endogenous Ets factor
in GH4 pituitary cells that binds to the RRE, biochemical
and functional evidence presented indicate that it is related to Ets-1.
For example, Western blot analysis with an Ets-1-specific anitbody
reveals that GH4 cells contain c-Ets-1 (Fig. 7) and that
GH4 nuclear extracts contain an Ets protein that binds the
MSV-EBS and the rPRL EBS in the RRE (Figs. 8 and 9). While we have not
yet unambiguously shown that c-Ets-1 is the specific Ets factor in the
DNA complexes shown in Figs. 8 and 9, it is clear from the functional
data presented here (Fig. 6) and that reported previously by us (31)
and others (40), that c-Ets-1 is able to enhance the Ras response,
whereas the Ets members c-Ets-2, Elk-1, and Net are unable to do so and
in some cases even interfere with the Ras response.
The precise role of Ets factors in mediating other hormonal responses
of the rPRL promoter remains unresolved and is under current
investigation. For example, we have shown that a dominant-negative Ets
construct does not interfere with the EGF-mediated stimulation of the
intact proximal rPRL promoter (52), whereas a site-specific mutation in
the FPIII EBS in the context of a heterologous promoter does result in
a loss of EGF response (40). Additionally, a DNA region encompassing
the BTE, which contains an EBS (Fig. 2A), has been shown to
contribute to the cAMP activation of the human PRL gene (63), and this
same BTE-EBS has been shown to be critical for insulin activation of
the rPRL promoter (49, 53, 64). Moreover, a dominant-negative Ets
construct inhibits the insulin response of the rPRL promoter, and the
Ets-related factors Elk-1 and Sap-1 were shown to bind to an
oligonucleotide spanning positions 106 to 97, encompassing the BTE
(53). Although the reports of Jacob et al. and others have
not identified the precise Ets member that is functionally relevant in
mediating the specific hormonal response being studied, a role for
Elk-1 has been suggested (40, 53). Additionally, a recent report
suggests that GABP mediates the insulin response of the rPRL promoter
via the BTE site (65). Here we show that site-specific deletion of the
BTE does not interfere with the Ras activation of the proximal rPRL
promoter (Fig. 1) and that expression of Elk-1 or Net may actually
inhibit the Ras response (Fig. 6). Taken together, it is clear that
distinct Ets family members may play different roles in mediating
diverse hormonal responses of the rPRL promoter.
The RRE Is a Composite Ets/GHF-1 Binding Site
Previously
defined Ras response elements have typically included an AP-1 site,
either alone or in combination with an EBS (2, 18, 19, 20, 27, 29, 30).
Additionally, CRE and SRE control elements have been shown to mediate
the Ras response in certain promoters (24, 25, 26, 28). Although composite
elements have been previously defined as RREs, the factors that bind to
the specific sites have been ubiquitously expressed proteins. In the
case of the rPRL promoter, it is the precise juxtaposition of binding
sites for both a c-Ets-1-like factor, and the pituitary-specific
factor, GHF-1, that is required for an optimal Ras response. Indeed,
the rGH promoter, which is also GHF-1-dependent and
contains core Ets binding sites (GGAA), fails to respond to Ras or Raf,
most likely because the GHF-1 and Ets binding sites are not in the
appropriate vicinal arrangement found in the rPRL promoter (31).
However, upon substitution of the distal rGH GHF-1 site with the
composite EBS/GHF-1 RRE, the rGH promoter gains Ras responsiveness
(Fig. 5). Thus, the requirement for a tripartite regulatory unit,
composed of a c-Ets-1-like factor, GHF-1, and a composite
cis-acting DNA element, provides an elegant mechanism by
which tissue-specific transcription factors, such as GHF-1, serve as
signal integrators for generalized signaling pathways and by which only
a subset of GHF-1-dependent genes are selected to respond
to the Ras pathway. In certain respects, this is reminiscent of the SRE
in the c-Fos promoter, which requires the interaction of the Ets
member, Elk-1, with SRF in order to achieve a growth factor response
(12, 13). However, in the case of the rPRL gene, GHF-1 appears to
function as a ``cell-specific SRF.''
GHF-1 Functions as a Cell-specific Signal Integrator
We (31,
43) and others (66) have proposed a hypothesis whereby homeodomain
proteins, such as GHF-1, target signal transduction pathways to
selected tissue-specific genes by functionally interacting with a
variety of signal-dependent transcription factors, such as
Ets-1, AP-1, CREB, thyroid receptor (TR), estrogen receptor
(ER), or retinoid receptor (RXR), at composite
DNA-regulatory elements (Fig. 10). Synergistic
interactions between GHF-1 and other factors may also determine cell
phenotype and regulate proliferation during pituitary organogenesis
(67). Several examples of such interactions, in addition to the
Ets-1/GHF-1 interaction at the composite RRE discussed in this
manuscript, can be found among GHF-1-dependent genes,
including the GHF-1, GH, PRL, and thyrotropin- genes. For example,
the murine GHF-1 enhancer contains an atypical, cell-specific retinoic
acid response element, composed of adjacent GHF-1 and retinoid receptor
binding sites, and both GHF-1 and retinoic acid receptor are required
to confer retinoid induction of GHF-1 gene transcription (68).
Additionally, the coordinate actions of GHF-1 and CREB/ATF-1-related
factors, at a cAMP response unit comprising a GHF-1 site flanked by
CREs, are necessary to mediate the effects of cAMP on the human GH gene
(69). Similarly, the rGH gene is synergistically activated by GHF-1 and
thyroid receptor via relatively closely spaced DNA binding sites (70),
and direct protein-protein interaction between GHF-1 and thyroid
receptor has been demonstrated.3
Cooperation of GHF-1 and estrogen receptor is required for rPRL distal
enhancer activity, and the binding of both factors, at adjacent
elements, is required for the estradiol response (71). Finally, an
AP-1-like factor functionally cooperates with GHF-1 to mediate
forskolin and phorbol-ester activation of the human thyrotropin-
gene (72). In this case, binding sites for GHF-1 and AP-1 are located
somewhat further apart. However, the authors note that both AP-1 and
GHF-1 can induce DNA bending, which may facilitate synergistic
interactions (72). It is noteworthy that in most of these cases,
mutation of the GHF-1 binding site, adjacent to the hormone response
element, results in loss of the specific hormonal effect. Thus, in many
GHF-1-dependent promoters, the inductive effects of
extracellular signals require binding of both GHF-1 and the
signal-dependent co-activator at composite DNA binding
sites. Specifically, in the context of our model (Fig. 10), we
hypothesize that GHF-1 either recruits an Ets-1-like factor or
stabilizes its binding to the adjacent EBS and that the actual Ras/Raf
response is transduced via a MAP kinase phosphorylation of the highly
conserved threonine 82 in the Ets-1 protein.2 In summary,
we propose that GHF-1 functions as a cell-specific integrator of
hormonal and growth factor signaling, resulting in distinct patterns of
GHF-1-dependent gene expression in pituitary development,
differentiation, and proliferation. Finally, these results imply that
other homeodomain proteins may function in a similar manner, providing
a novel paradigm that should be considered in future studies of
hormonal regulation of tissue-specific gene expression.
Fig. 10.
Model for pituitary-specific signal
integration by the homeodomain protein GHF-1/Pit-1. Extracellular
signals are targeted to nuclear co-activators such as CREB, the Jun/Fos
family (AP-1), members of the Ets family of transcription factors
(ETS), thyroid receptor (TR), estrogen receptor
(ER), or retinoid receptor (RXR). Such inductive
signals alter the transactivation potential of these co-activators.
Functional interaction of these signal-dependent
co-activators (SDCs), e.g. Ets-1, with GHF-1, at
a composite GHF-1/Co-activator DNA binding site, forms a tripartite
response unit, which permits highly specific pituitary transcriptional
responses to general signaling pathways. Thus, GHF-1 functions as a
cell-specific nuclear integrator of diverse extracellular
hormone/growth factor signals.
[View Larger Version of this Image (24K GIF file)]
FOOTNOTES
*
This research was supported by American Cancer Society Grant
BE-199, National Institutes of Health Grant DK 46868 (to A. G.-H.),
and Small Business Innovative Research contract N43-DK-2-2214 (to
BAbCO). Partial support was also provided by the Lucille P. Markey
Charitable Trust. The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
``advertisement'' in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Present address: Stratagene, La Jolla, CA 92037.
To whom correspondence should be addressed: Dept. of Medicine,
University of Colorado Health Sciences Center, 4200 E. Ninth Ave., Box
B-151, Denver, CO 80262. Tel.: 303-270-8443; Fax: 303-270-4525; E-mail:
Arthur.Gutierrez-Hartmann{at}UCHSC.edu.
1
The abbreviations used are: RRE, Ras/Raf
response element; CRE, cAMP response element; CREB, CRE-binding
protein; AP-1, activating protein-1; ATF, activation transcription
factor; SRF, serum response factor; SRE, serum response element; PRL,
prolactin; rPRL, rat PRL; GHF, growth hormone factor; EBS, Ets binding
site; mEBS, mutated EBS; GST, glutathione S-transferase;
PCR, polymerase chain reaction; GH, growth hormone; rGH, rat GH; FPI,
FPII, FPIII, and FPIV, footprint I, II, III, and IV, respectively; BTE,
basal transcription element; MSV, murine sarcoma virus; EGF, epidermal
growth factor.
2
B. Wasylyk and A. Gutierrez-Hartmann,
unpublished results.
3
F. Schaufele, personal communication.
Acknowledgments
We thank M. E. Reyland, J. J. Tentler, L. Wolfe, and W. M. Wood for discussions and comments on the manuscript,
B. Wasylyk and M. Karin for plasmids, and J. Wagner and K. Fantle for
technical assistance.
REFERENCES
-
Barbacid, M.
(1987)
Annu. Rev. Biochem.
56,
779-827
[CrossRef][Medline]
[Order article via Infotrieve]
-
Gutman, A.,
Wasylyk, B.
(1991)
Trends Genet.
7,
49-54
[Medline]
[Order article via Infotrieve]
-
Karin, M.
(1994)
Curr. Opin. Cell Biol.
6,
415-424
[CrossRef][Medline]
[Order article via Infotrieve]
-
Feig, L. A.
(1993)
Science
260,
767-768
[Free Full Text]
-
Wittinghofer, A.,
Herrmann, C.
(1995)
FEBS Lett.
369,
52-56
[CrossRef][Medline]
[Order article via Infotrieve]
-
Avvedimento, V. E.,
Musti, A. M.,
Ueffing, M.,
Obici, S.,
Gallo, A.,
Sanchez, M.,
DeBrasi, D.,
Gottesman, M. E.
(1991)
Genes & Dev.
5,
22-28
[Abstract/Free Full Text]
-
Lacal, J. C.,
Cuadrado, A.,
Jones, J. E.,
Trotta, R.,
Burstein, D. E.,
Thomson, T.,
Pellicer, A.
(1990)
Mol. Cell. Biol.
10,
2983-2990
[Abstract/Free Full Text]
-
Nakagawa, T.,
Mabry, M.,
deBustros, A.,
Ihle, J. N.,
Nelkin, B. D.,
Baylin, S. B.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
5923-5927
[Abstract/Free Full Text]
-
Galang, C.,
Der, C.,
Hauser, C.
(1994)
Oncogene
9,
2913-2921
[Medline]
[Order article via Infotrieve]
-
Langer, S. J.,
Bortner, D. M.,
Roussel, M. F.,
Sherr, C. J.,
Ostrowski, M. C.
(1992)
Mol. Cell. Biol.
12,
5355-5362
[Abstract/Free Full Text]
-
Wasylyk, C.,
Maira, S.-M.,
Sobieszczuk, P.,
Wasylyk, B.
(1994)
Oncogene
9,
3665-3673
[Medline]
[Order article via Infotrieve]
-
Janknecht, R.,
Ernst, W. H.,
Pingoud, V.,
Nordheim, A.
(1993)
EMBO J.
12,
5097-5104
[Medline]
[Order article via Infotrieve]
-
Marais, R.,
Wynne, J.,
Treisman, R.
(1993)
Cell
73,
381-393
[CrossRef][Medline]
[Order article via Infotrieve]
-
Brunner, D.,
Ducker, K.,
Oellers, N.,
Hafen, E.,
Scholz, H.,
Klambt, C.
(1994)
Nature
370,
386-389
[CrossRef][Medline]
[Order article via Infotrieve]
-
O'Neill, E. M.,
Rebay, I.,
Tjian, R.,
Rubin, G. M.
(1994)
Cell
78,
137-147
[CrossRef][Medline]
[Order article via Infotrieve]
-
Giovane, A.,
Pintzas, A.,
Maira, S.-M.,
Sobieszcuk, P.,
Wasylyk, B.
(1994)
Genes & Dev.
8,
1502-1513
[Abstract/Free Full Text]
-
Sgouras, D.,
Athanasiou, M.,
Beal, G.,
Fisher, R.,
Blair, D.,
Mavrothalassitis, G.
(1995)
EMBO J.
14,
4781-4793
[Medline]
[Order article via Infotrieve]
-
Owen, R. D.,
Bortner, D. M.,
Ostrowski, M. C.
(1990)
Mol. Cell. Biol.
10,
1-9
[Abstract/Free Full Text]
-
Owen, R. D.,
Ostrowski, M. C.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
3866-3870
[Abstract/Free Full Text]
-
Yamaguchi-Iwai, Y.,
Satake, M.,
Murakami, Y.,
Sakai, M.,
Muramatsu, M.,
Ito, Y.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
8670-8674
[Abstract/Free Full Text]
-
Binétruy, B.,
Smeal, T.,
Karin, M.
(1991)
Nature
351,
122-127
[CrossRef][Medline]
[Order article via Infotrieve]
-
Deng, T.,
Karin, M.
(1994)
Nature
371,
171-175
[CrossRef][Medline]
[Order article via Infotrieve]
-
Lloyd, A.,
Yancheva, N.,
Wasylyk, B.
(1991)
Nature
352,
635-638
[CrossRef][Medline]
[Order article via Infotrieve]
-
Galien, R.,
Mercier, G.,
Garcette, M.,
Emanoil-Ravier, R.
(1991)
Oncogene
6,
849-855
[Medline]
[Order article via Infotrieve]
-
Kedar, P. S.,
Lowy, D. R.,
Widen, S. G.,
Wilson, S. H.
(1990)
Mol. Cell. Biol.
10,
3852-3856
[Abstract/Free Full Text]
-
Ginty, D.,
Bonni, A.,
Greenberg, M.
(1994)
Cell
77,
713-725
[CrossRef][Medline]
[Order article via Infotrieve]
-
Bruder, J. T.,
Heidecker, G.,
Rapp, U. R.
(1992)
Genes & Dev.
6,
545-556
[Abstract/Free Full Text]
-
Gutman, A.,
Wasylyk, C.,
Wasylyk, B.
(1991)
Mol. Cell. Biol.
11,
5381-5387
[Abstract/Free Full Text]
-
Reddy, M. A.,
Langer, S. J.,
Colman, M. S.,
Ostrowski, M. C.
(1992)
Mol. Endocrinol.
6,
1051-1060
[Abstract/Free Full Text]
-
Wasylyk, B.,
Wasylyk, C.,
Flores, P.,
Begue, A.,
Leprince, D.,
Stehelin, D.
(1990)
Nature
346,
191-193
[CrossRef][Medline]
[Order article via Infotrieve]
-
Bradford, A. P.,
Conrad, K. E.,
Wasylyk, C.,
Wasylyk, B.,
Gutierrez-Hartmann, A.
(1995)
Mol. Cell. Biol.
15,
2849-2857
[Abstract]
-
Conrad, K. E.,
Oberwetter, J. M.,
Vallaincourt, R.,
Johnson, G. L.,
Gutierrez-Hartmann, A.
(1994)
Mol. Cell. Biol.
14,
1553-1565
[Abstract/Free Full Text]
-
Conrad, K. E.,
Gutierrez-Hartmann, A.
(1992)
Oncogene
7,
1279-1286
[Medline]
[Order article via Infotrieve]
-
Oberwetter, J. M.,
Conrad, K. E.,
Gutierrez-Hartmann, A.
(1993)
Mol. Endocrinol.
7,
915-923
[Abstract/Free Full Text]
-
Elsholtz, H. P.
(1992)
Semin. Reprod. Endocrinol.
10,
183-195
[CrossRef]
-
Keech, C. A.,
Gutierrez-Hartmann, A.
(1989)
Mol. Endocrinol.
3,
832-839
[Abstract/Free Full Text]
-
Keech, C. A.,
Gutierrez-Hartmann, A.
(1991)
Mol. Cell. Endocrinol.
78,
55-60
[CrossRef][Medline]
[Order article via Infotrieve]
-
Castrillo, J. L.,
Theill, L. E.,
Karin, M.
(1991)
Science
253,
197-199
[Abstract/Free Full Text]
-
Ingraham, H. A.,
Chen, R. P.,
Mangalam, H. J.,
Elsholtz, H. P.,
Flynn, S. E.,
Lin, C. R.,
Simmons, D. M.,
Swanson, L.,
Rosenfeld, M. G.
(1988)
Cell
55,
519-529
[CrossRef][Medline]
[Order article via Infotrieve]
-
Howard, P. W.,
Maurer, R. A.
(1995)
J. Biol. Chem.
270,
20930-20936
[Abstract/Free Full Text]
-
Gutierrez-Hartmann, A.,
Siddiqui, S.,
Loukin, S.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
5211-5215
[Abstract/Free Full Text]
-
Smith, D. B.,
Johnson, K. S.
(1988)
Gene (Amst.)
67,
31-40
[CrossRef][Medline]
[Order article via Infotrieve]
-
Gutierrez-Hartmann, A.
(1994)
Mol. Endocrinol.
8,
1447-1449
[Free Full Text]
-
Berwaer, M.,
Peers, B.,
Nalda, A. M.,
Monget, P.,
Davis, J. R. E.,
Belayew, A.,
Martial, J. A.
(1993)
Mol. Cell. Endocrinol.
92,
1-7
[CrossRef][Medline]
[Order article via Infotrieve]
-
Iverson, R. A.,
Day, K. H.,
d'Emden, M.,
Day, R. N.,
Maurer, R. A.
(1990)
Mol. Endocrinol.
4,
1564-1571
[Abstract/Free Full Text]
-
Peers, B.,
Monget, P.,
Nalda, M. A.,
Voz, M. L.,
Berwaer, M.,
Belayew, A.,
Martial, J. A.
(1991)
J. Biol. Chem.
266,
18127-18134
[Abstract/Free Full Text]
-
Rajnarayan, S.,
Chiono, M.,
Alexander, L. M.,
Gutierrez-Hartmann, A.
(1995)
Mol. Endocrinol.
9,
502-512
[Abstract/Free Full Text]
-
Elsholtz, H. P.,
Mangalam, H. J.,
Potter, E.,
Albert, V. R.,
Supowit, S.,
Evans, R. M.,
Rosenfeld, M. G.
(1986)
Science
234,
1552-1557
[Abstract/Free Full Text]
-
Stanley, F. M.
(1992)
J. Biol. Chem.
267,
16719-16726
[Abstract/Free Full Text]
-
Karin, M.
(1992)
FASEB J.
6,
2581-2590
[Abstract]
-
Pazin, M. J.,
Williams, L. T.
(1992)
Trends Biochem. Sci.
17,
374-378
[CrossRef][Medline]
[Order article via Infotrieve]
-
Pickett, C.,
Gutierrez-Hartmann, A.
(1995)
Mol. Cell. Biol.
15,
6777-6784
[Abstract]
-
Jacob, K.,
Ouyang, L.,
Stanley, F. M.
(1995)
J. Biol. Chem.
270,
27773-27779
[Abstract/Free Full Text]
-
Janknecht, R.,
Nordheim, A.
(1993)
Biochim. Biophys. Acta
1155,
346-356
[Medline]
[Order article via Infotrieve]
-
Wasylyk, B.,
Hahn, S. H.,
Giovane, A.
(1993)
Eur. J. Biochem.
211,
7-18
[Medline]
[Order article via Infotrieve]
-
Whitmarsh, A.,
Shore, P.,
Sharrocks, A.,
Davis, R.
(1995)
Science
269,
403-407
[Abstract/Free Full Text]
-
Pellegrini, L.,
Tan, S.,
Richmond, T.
(1995)
Nature
376,
489-498
-
Fleischman, L.,
Holtzclaw, L.,
Russell, J.,
Mavrothalassitis, G.,
Fisher, R.
(1995)
Mol. Cell. Biol.
15,
925-931
[Abstract]
-
Kola, I.,
Brookes, S.,
Green, A. R.,
Garber, R.,
Tymms, M.,
Papas, T. S.,
Seth, A.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
7588-7592
[Abstract/Free Full Text]
-
Wernert, N.,
Raes, M.-B.,
Lassalle, P.,
Dehouck, M.-P.,
Gosselin, B.,
Vandenbunder, B.,
Stehelin, D.
(1992)
Am. J. Pathol.
140,
119-127
[Abstract]
-
Wasylyk, C.,
Gutman, A.,
Nicholson, R.,
Wasylyk, B.
(1991)
EMBO J.
10,
1127-1134
[Medline]
[Order article via Infotrieve]
-
Yang, B.-S.,
Hauser, C.,
Henkel, G.,
Colman, M.,
Van Beveren, C.,
Stacey, K.,
Hume, D.,
Maki, R.,
Ostrowski, M.
(1996)
Mol. Cell. Biol.
16,
538-547
[Abstract]
-
Peers, B.,
Nalda, A. M.,
Monget, P.,
Voz, M. L.,
Belayew, A.,
Martial, J. A.
(1992)
Eur. J. Biochem.
210,
53-58
[Medline]
[Order article via Infotrieve]
-
Jacob, K. K.,
Stanley, F. M.
(1994)
J. Biol. Chem.
269,
25515-25520
[Abstract/Free Full Text]
-
Ouyang, L.,
Jacob, K. K.,
Stanley, F. M.
(1996)
J. Biol. Chem.
271,
10425-10428
[Abstract/Free Full Text]
-
Grueneberg, D.,
Simon, K.,
Brennan, K.,
Gilman, M.
(1995)
Mol. Cell. Biol.
15,
3318-3326
[Abstract]
-
Anderson, B.,
Rosenfeld, M. G.
(1994)
J. Biol. Chem.
269,
29335-29338
[Free Full Text]
-
Rhodes, S.,
Chen, R.,
DiMattia, G.,
Scully, K.,
Kalla, K.,
Lin, S.-C.,
Yu, V.,
Rosenfeld, M.
(1993)
Genes & Dev.
7,
913-932
[Abstract/Free Full Text]
-
Shepard, A. R.,
Zhang, W.,
Eberhardt, N. L.
(1994)
J. Biol. Chem.
269,
1804-1814
[Abstract/Free Full Text]
-
Schaufele, F.,
West, B. L.,
Baxter, J. D.
(1992)
Mol. Endocrinol.
6,
656-665
[Abstract/Free Full Text]
-
Day, R. N.,
Koike, S.,
Sakai, M.,
Muramatsu, M.,
Maurer, R. A.
(1990)
Mol. Endocrinol.
4,
1964-1971
[Abstract/Free Full Text]
-
Kim, M. K.,
McClaskey, J. H.,
Bodenner, D. L.,
Weintraub, B. D.
(1993)
J. Biol. Chem.
268,
23366-23375
[Abstract/Free Full Text]
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
D. Giacomini, M. Paez-Pereda, J. Stalla, G. K. Stalla, and E. Arzt
Molecular Interaction of BMP-4, TGF-{beta}, and Estrogens in Lactotrophs: Impact on the PRL Promoter
Mol. Endocrinol.,
July 1, 2009;
23(7):
1102 - 1114.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Zhu, A. S. Gleiberman, and M. G. Rosenfeld
Molecular Physiology of Pituitary Development: Signaling and Transcriptional Networks
Physiol Rev,
July 1, 2007;
87(3):
933 - 963.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. L. Duval, M. D. Jonsen, S. E. Diamond, P. Murapa, A. Jean, and A. Gutierrez-Hartmann
Differential Utilization of Transcription Activation Subdomains by Distinct Coactivators Regulates Pit-1 Basal and Ras Responsiveness
Mol. Endocrinol.,
January 1, 2007;
21(1):
172 - 185.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Liu, R. E. Baker, W. Chow, C. K. Sun, and H. P. Elsholtz
Epigenetic Mechanisms in the Dopamine D2 Receptor-Dependent Inhibition of the Prolactin Gene
Mol. Endocrinol.,
July 1, 2005;
19(7):
1904 - 1917.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A L Ferry, D M Locasto, L B Meszaros, J C Bailey, M D Jonsen, K Brodsky, C J Hoon, A Gutierrez-Hartmann, and S E Diamond
Pit-1{beta} reduces transcription and CREB-binding protein recruitment in a DNA context-dependent manner
J. Endocrinol.,
April 1, 2005;
185(1):
173 - 185.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. L. Duval, A. Jean, and A. Gutierrez-Hartmann
Ras Signaling and Transcriptional Synergy at a Flexible Ets-1/Pit-1 Composite DNA Element Is Defined by the Assembly of Selective Activation Domains
J. Biol. Chem.,
October 10, 2003;
278(41):
39684 - 39696.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. E. Schweppe, A. A. Melton, K. S. Brodsky, L. D. Aveline, K. A. Resing, N. G. Ahn, and A. Gutierrez-Hartmann
Purification and Mass Spectrometric Identification of GA-binding Protein (GABP) as the Functional Pituitary Ets Factor Binding to the Basal Transcription Element of the Prolactin Promoter
J. Biol. Chem.,
May 2, 2003;
278(19):
16863 - 16872.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. D. Augustijn, D. L. Duval, R. Wechselberger, R. Kaptein, A. Gutierrez-Hartmann, and P. C. van der Vliet
Structural characterization of the PIT-1/ETS-1 interaction: PIT-1 phosphorylation regulates PIT-1/ETS-1 binding
PNAS,
October 1, 2002;
99(20):
12657 - 12662.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Liu, R. E. Baker, C. Sun, V. C. Sundmark, and H. P. Elsholtz
Activation of Go-coupled Dopamine D2 Receptors Inhibits ERK1/ERK2 in Pituitary Cells. A KEY STEP IN THE TRANSCRIPTIONAL SUPPRESSION OF THE PROLACTIN GENE
J. Biol. Chem.,
September 20, 2002;
277(39):
35819 - 35825.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Kanasaki, T. Yonehara, H. Yamamoto, Y. Takeuchi, K. Fukunaga, K. Takahashi, K. Miyazaki, and E. Miyamoto
Differential Regulation of Pituitary Hormone Secretion and Gene Expression by Thyrotropin-Releasing Hormone. A Role for Mitogen-Activated Protein Kinase Signaling Cascade in Rat Pituitary GH3 Cells
Biol Reprod,
July 1, 2002;
67(1):
107 - 113.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. L. Duval and A. Gutierrez-Hartmann
Editorial: PRL-Releasing Peptide Stimulation of PRL Gene Transcription--Enter AKT
Endocrinology,
January 1, 2002;
143(1):
11 - 12.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Hayakawa, M. Ohmichi, K. Tasaka, Y. Kanda, K. Adachi, Y. Nishio, K. Hisamoto, S. Mabuchi, S. Hinuma, and Y. Murata
Regulation of the PRL Promoter by Akt through cAMP Response Element Binding Protein
Endocrinology,
January 1, 2002;
143(1):
13 - 22.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Kievit, J. D. Lauten, and R. A. Maurer
Analysis of the Role of the Mitogen-Activated Protein Kinase in Mediating Cyclic-Adenosine 3',5'-Monophosphate Effects on Prolactin Promoter Activity
Mol. Endocrinol.,
April 1, 2001;
15(4):
614 - 624.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
R. E. Schweppe and A. Gutierrez-Hartmann
Pituitary Ets-1 and GABP bind to the growth factor regulatory sites of the rat prolactin promoter
Nucleic Acids Res.,
March 1, 2001;
29(5):
1251 - 1260.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Andersen and M. G. Rosenfeld
POU Domain Factors in the Neuroendocrine System: Lessons from Developmental Biology Provide Insights into Human Disease
Endocr. Rev.,
February 1, 2001;
22(1):
2 - 35.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S.-I. Jang, N. Karaman-Jurukovska, M. I. Morasso, P. M. Steinert, and N. G. Markova
Complex Interactions between Epidermal POU Domain and Activator Protein 1 Transcription Factors Regulate the Expression of the Profilaggrin Gene in Normal Human Epidermal Keratinocytes
J. Biol. Chem.,
May 12, 2000;
275(20):
15295 - 15304.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. P. Bradford, K. S. Brodsky, S. E. Diamond, L. C. Kuhn, Y. Liu, and A. Gutierrez-Hartmann
The Pit-1 Homeodomain and beta -Domain Interact with Ets-1 and Modulate Synergistic Activation of the Rat Prolactin Promoter
J. Biol. Chem.,
February 4, 2000;
275(5):
3100 - 3106.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Kimura, M. Ohmichi, K. Tasaka, Y. Kanda, H. Ikegami, J. Hayakawa, K. Hisamoto, K.-i. Morishige, S. Hinuma, H. Kurachi, et al.
Prolactin-releasing Peptide Activation of the Prolactin Promoter Is Differentially Mediated by Extracellular Signal-regulated Protein Kinase and c-Jun N-terminal Protein Kinase
J. Biol. Chem.,
February 4, 2000;
275(5):
3667 - 3674.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. K. Jacob and F. M. Stanley
CCAAT/Enhancer-Binding Protein {alpha} Is a Physiological Regulator of Prolactin Gene Expression
Endocrinology,
October 1, 1999;
140(10):
4542 - 4550.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
Y.-H. Wang and R. A. Maurer
A Role for the Mitogen-Activated Protein Kinase in Mediating the Ability of Thyrotropin-Releasing Hormone to Stimulate the Prolactin Promoter
Mol. Endocrinol.,
July 1, 1999;
13(7):
1094 - 1104.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
H. Kanasaki, K. Fukunaga, K. Takahashi, K. Miyazaki, and E. Miyamoto
Mitogen-Activated Protein Kinase Activation by Stimulation with Thyrotropin-Releasing Hormone in Rat Pituitary GH3 Cells
Biol Reprod,
July 1, 1999;
61(1):
319 - 325.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. S. Fliss, P. M. Hinkle, and C. Bancroft
Expression Cloning and Characterization of PREB (Prolactin Regulatory Element Binding), a Novel WD Motif DNA-Binding Protein with a Capacity to Regulate Prolactin Promoter Activity
Mol. Endocrinol.,
April 1, 1999;
13(4):
644 - 657.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. E. Diamond, M. Chiono, and A. Gutierrez-Hartmann
Reconstitution of the Protein Kinase A Response of the Rat Prolactin Promoter: Differential Effects of Distinct Pit-1 Isoforms and Functional Interaction with Oct-1
Mol. Endocrinol.,
February 1, 1999;
13(2):
228 - 238.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
R. N. Day, J. Liu, V. Sundmark, M. Kawecki, D. Berry, and H. P. Elsholtz
Selective Inhibition of Prolactin Gene Transcription by the ETS-2 Repressor Factor
J. Biol. Chem.,
November 27, 1998;
273(48):
31909 - 31915.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. N. Yager, H.-O. Lee, D. L. Nagle, and J. E. Zimmerman
Analysis of fluG Mutations That Affect Light-Dependent Conidiation in Aspergillus nidulans
Genetics,
August 1, 1998;
149(4):
1777 - 1786.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Yang, L. H. Shapiro, M. Rivera, A. Kumar, and P. K. Brindle
A Role for CREB Binding Protein and p300 Transcriptional Coactivators in Ets-1 Transactivation Functions
Mol. Cell. Biol.,
April 1, 1998;
18(4):
2218 - 2229.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
R. E. Schweppe, A. A. Frazer-Abel, A. Gutierrez-Hartmann, and A. P. Bradford
Functional Components of Fibroblast Growth Factor (FGF) Signal Transduction in Pituitary Cells. IDENTIFICATION OF FGF RESPONSE ELEMENTS IN THE PROLACTIN GENE
J. Biol. Chem.,
December 5, 1997;
272(49):
30852 - 30859.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. F. Gordon, S. R. Lewis, B. R. Haugen, R. A. James, M. T. McDermott, W. M. Wood, and E. C. Ridgway
Pit-1 and GATA-2 Interact and Functionally Cooperate to Activate the Thyrotropin beta -Subunit Promoter
J. Biol. Chem.,
September 26, 1997;
272(39):
24339 - 24347.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. Diamond and A. Gutierrez-Hartmann
The Pit-1beta Domain Dictates Active Repression and Alteration of Histone Acetylation of the Proximal Prolactin Promoter
J. Biol. Chem.,
September 29, 2000;
275(40):
30977 - 30986.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1996 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|