INTRODUCTION

Members of the Ras superfamily regulate diverse signaling pathways. The prototype of this family, Ras, is involved in regulating cell growth and differentiation (1). The Rho subfamily (Rho, Rac, Cdc42) are also involved in regulating cell growth as well as controlling the formation of focal contacts and alterations in the actin cytoskeleton which occur upon growth factor stimulation (2, 3, 4, 5, 6, 7). Common to all Ras family members is their ability to cycle between inactive (GDP bound) and active (GTP bound) states. In this regard, these GTPases act as molecular switches, capable of processing information and then disseminating that information to control a specific pathway.

This property of cycling between GTP and GDP states has provided a means to identify and purify proteins that regulate the nucleotide state of Ras and Ras-related GTPases (1). By monitoring the hydrolysis of GTP to GDP, GTPase-activating proteins (GAPs)¹ have been characterized for many members of the Ras family (1, 8, 9). Guanine nucleotide dissociation inhibitors (GDIs) were identified based on their ability to inhibit the dissociation of GDP. It has subsequently been determined that they also bind to the GTP state, inhibiting the intrinsic and GAP-stimulated GTP hydrolysis (1). In general, GAPs and effectors have a high affinity for the GTP-bound state, while guanine nucleotide dissociation inhibitor proteins bind most tightly to the GDP-bound state. These properties have been exploited to purify effectors for Cdc42Hs (10, 11, 12), Ras (13, 14), and Rho (15, 16). An affinity approach has also been employed with Cdc42Hs-GTP and has led to the characterization of IQGAP1, a potential mediator for observed cytoskeletal events induced by Cdc42 (17).

A modification of this affinity approach can also be used to identify and purify guanine nucleotide exchange factors (GEFs). GEFs can be distinguished from other regulatory proteins by their ability to interact preferentially with the nucleotide-depleted state of G-proteins (18, 19). By stimulating the dissociation of GDP and subsequent binding of GTP, GEFs play an important role in the activation of Ras-like proteins. For example, Ras is converted to its GTP-bound form by the growth factor-stimulated translocation of Sos, a Ras-specific GEF (20). The characterization of GEFs that specifically activate Rho family members will help elucidate the signaling pathways in which these GTPases participate. This paper documents the affinity purification of a Rho-specific GEF. By incubating lysates with nucleotide-depleted Rho, we have purified a Rho-specific GEF and isolated a cDNA coding for the 115-kDa protein, which is homologous to the dbl (21) and lbc oncogenes (22).

MATERIALS AND METHODS

To identify Rho associated proteins, six 10-cm dishes of 70% confluent src-transformed NIH 3T3 cells were labeled overnight with 100 µCi/ml [³⁵S]methionine. Each plate was washed once with ice-cold phosphate-buffered saline and lysed with 1 ml of 20 mM Tris, pH 7.5, 100 mM NaCl, 2.5 mM MgCl₂, 1 mM dithiothreitol, 30 µg/ml leupeptin and aprotinin, 1 mM pefabloc, and 0.6% Triton X-100 (v/v). When phosphatase inhibitors were included in the lysis buffer, NaF and NaVO₄ were added to final concentrations of 20 and 1 mM, respectively. After preclearing with GSH-agarose, the supernatants were incubated with GSH-agarose coupled to 10 µg of E. coli expressed GST-RhoA prepared in nucleotide-depleted GDP or GTPS states (18). For the nucleotide-depleted condition, EDTA was added to the lysate to a final concentration of 10 mM. After a 2-h incubation at 4 °C, the beads were washed three times with phosphate-buffered saline containing 0.1% Triton X-100 and either 10 mM EDTA for the nucleotide-depleted condition or 5 mM MgCl₂ for the GDP/GTPS conditions and eluted with SDS sample buffer. The eluant was analyzed on an 8%-polyacrylamide SDS gel by autoradiography. For the purification presented in Fig. 1D, 10 ml of cytosol was prepared from 10 15-cm plates of COS cells, which were homogenized in a hypotonic lysis buffer (20 mM Tris, pH 7.5, 10 mM NaCl, 2.5 mM MgCl₂, 1 mM dithiothreitol, 30 µg/ml leupeptin and aprotinin, and 1 mM pefabloc). After centrifugation, Triton X-100 was added to a final concentration of 0.2%, and the lysate was then split into two aliquots, precleared with GSH-agarose, and incubated with 120 µg of either nucleotide-depleted or GDP-GST-RhoA coupled to GSH-agarose and then treated as described above. To obtain peptide sequence for p115, 200 µg of nucleotide-depleted GST-RhoA coupled to GSH-agarose was incubated with cytosol prepared from 25 15-cm plates of COS cells. Following SDS-polyacrylamide gel electrophoresis of the proteins eluted from the beads, the stained band corresponding to p115 was excised from the gel and treated with the protease endolys-C (23).

A total of six peptides were sequenced, and one peptide, RQEVISELLVTEAAHV, was used for the purpose of obtaining a cDNA for p115. Using the rules for designing best guess oligonucleotides, the following probe, CGGCAGGAGGTGATCTCTGAGCTGCTGGTGACAGAGGCTGCCCATGT, was generated, end-labeled with polynucleotide kinase, and used to screen 2 × 10⁶ plaques from a Stratagene human fetal brain cDNA library (24). From this screening, a 3.0-kb cDNA was isolated and was found to encode a protein that contained three of the six isolated peptides. This clone, designated N-p115, was expressed in an in vitro TNT wheat germ lectin lysate system (Promega) and was found to encode an 85-kDa protein. To find the remaining 5-coding sequence of p115, a probe, raised against the 5 end of N-p115, was used to screen DR2 and GT11 human fetal brain cDNA libraries (Clontech). These screenings resulted in the isolation of overlapping 0.7-, 0.8-, 0.9-, and 3.0-kb cDNAs. The cDNAs were sequenced in both directions by cycle sequencing with Taq polymerase and analyzed on an ABI 373A DNA sequencer. To make a full-length p115 construct, the 0.7-and 3.0-kb cDNAs were digested with EcoRI and SfiI and subcloned into the EcoRI site of pGEM-11Zf (Promega). This construct was used for in vitro transcription and translation in a wheat germ lectin lysate (Fig. 2C).

For expression in the baculovirus/SF9 system, the original cDNA, N-p115, was subcloned as an EcoRV/XbaI fragment into the StuI-XbaI sites of a pAcO vector, which contains a 5 Glu-Glu tag. The expression and purification of the Glu-Glu-tagged protein was performed as described previously (24). For the foci formation assays, the various p115 cDNAs, lbc and dbl cDNAs were subcloned into an EXV-myc tag vector. The cDNA, which has been designated N-p115, codes for amino acids 249-913 and was subcloned as an EcoRV-XbaI fragment into complementary sites of the EXV-Myc vector. This construct was then used to make N-p115DH, in which DNA coding for amino acids 466-547 of the DH domain was deleted by digesting with SacI and SacII. The ends of the cut plasmid were then blunted with T4 DNA polymerase, and the vector was religated. N-p115C was made by digesting with RsrI and XbaI to remove DNA that coded for amino acids 803-913. The construct in which the PH domain was truncated (N-p115PH) was made by digesting with BalI and XbaI, resulting in the removal of sequence coding for amino acids 719-913. The methods used for making EXV-Myc dbl have been described elsewhere (5).

Using primers raised against the published sequence of the lbc oncogene (22), a 500-base pair fragment was amplified from a Stratagene heart cDNA library. This fragment was then used as a template to generate a radiolabeled probe by the polymerase chain reaction. A 1.8-kb cDNA was obtained by screening the Stratagene heart cDNA library. The 1.8-kb cDNA contained sequence for the lbc oncogene as well as unpublished sequence, which probably represents proto-lbc sequence. DNA sequence, which coded for amino acids 1-417, was amplified by the polymerase chain reaction using specific primers. The designed primers incorporated an EcoRV and a XbaI site at the 5 and 3 ends of the amplified DNA, which was then subcloned into the EXV-Myc vector.

Antibodies specific to p115 were raised in rabbits against a fragment of purified recombinant p115. N-p115 (amino acids 249-913 was expressed as a Glu-Glu epitope-tagged protein in the baculovirus insect cell system and purified by affinity chromatography on anti-Glu-Glu-Sepharose (24). Seven milligrams of Glu-Glu-tagged N-p115 were then coupled to CNBr-activated Sepharose and incubated with 10 ml of serum from rabbits injected with N-p115. The antibodies were then eluted with 0.2 M glycine, pH 2.5, and neutralized with 1 M K₂HPO_4. For immunoblotting, affinity-purified N-p115 antibodies were used at a final concentration of 1 µg/ml. Blots were incubated overnight, washed three times with 25 mM Tris, pH 8.0, 150 mM NaCl, 0.05% Tween 20, and then developed with Goat anti-rabbit IgG conjugated to horseradish peroxidase followed by ECL detection. Monoclonal antibodies for phosphotyrosine, p190-RhoGAP and rasGAP (Transduction Laboratories, Inc.) were used at final concentrations of 1 µg/ml. Cross-reactivity on immunoblots was detected with goat anti-mouse IgG conjugated to horseradish peroxidase.

RESULTS

In order to identify proteins capable of interacting with Rho, GST-Rho was coupled to GSH-agarose, prepared to exist in nucleotide-depleted GDP and GTPS states, and incubated with lysates from src-transformed NIH 3T3 cells metabolically labeled with [³⁵S]methionine. The associated proteins were eluted from the agarose beads with SDS, electrophoresed on acrylamide gels, and analyzed by autoradiography. By using this approach, four Rho-interacting proteins were identified: p190, p120, p130, and p115 (Fig. 1A). Two proteins, p190 and p120, interacted only with GDP and GTPS states. These two proteins were observed only when the purification was performed in the presence of phosphatase inhibitors (Fig. 1A). Anti-phosphotyrosine Western analysis revealed that both p190 and p120 are tyrosine-phosphorylated (Fig. 1B). Subsequent analysis with specific monoclonal antibodies demonstrated that p190 was p190-RhoGAP (Fig. 1C) and p120 was RasGAP (data not shown). The affinity of p190-RhoGAP for Rho-GDP/GTPS appears to be dramatically enhanced in the presence of phosphatase inhibitors. RasGAP is also found associated with the GDP/GTPS states, presumably via its interaction with p190-RhoGAP (25). Two more proteins, p130 and p115, also bound to Rho, but they interacted only with the nucleotide-depleted (ND) state (Fig. 1A). The interaction with p130 could only be detected when phosphatase inhibitors were included in the lysis buffer, while p115 interacted with Rho independently of phosphatase inhibitors. By virtue of the ability of p130 and p115 to bind to the nucleotide-depleted state of Rho, it is possible that these two proteins may be GEFs for the Rho GTPase.

Using this affinity approach, p115 was purified from COS cell cytosol on a GST-Rho(ND) column (Fig. 1D). Quantities of p115 sufficient for amino acid microsequencing were gel-purified and proteolytically digested. Six peptides were isolated and sequenced. A nucleotide probe based on the sequence of one peptide was used to isolate a 3.0-kb cDNA from a human fetal brain cDNA library. Subsequent screenings resulted in the identification of three overlapping 0.7-, 0.8-, 0.9-, and 3.0-kb cDNAs. An alignment of these sequences revealed a contiguous 3.2-kb cDNA (Fig. 2A), which contained an open reading frame coding for a predicted protein of 104 kDa. Northern analysis of the expression of p115 identified two predominant transcripts with sizes of 7.0 and 3.4 kb. P115 appears to be ubiquitously expressed in human tissues but is most highly expressed in peripheral blood leukocytes, thymus, and spleen (Fig. 2B). When the 3.2-kb cDNA for p115 was expressed in vitro, the protein product migrated with a molecular mass of 115 kDa (Fig. 2C). An affinity-purified polyclonal antibody raised against amino acids 249-913 of p115 recognized a protein with an identical molecular weight in COS and porcine atrial endothelial (PAE) cells (Fig. 2C). P115 was also detected in many human tumor cell lines (Fig. 2C).

Protein homology searches revealed that p115 contains a DH domain, which is followed by a PH domain (Fig. 3). The DH domain of p115 is 33.5, 32.3, and 22.9% identical to analogous regions found in the Lfc, Lbc, and Dbl oncoproteins, respectively. The PH domain of p115 is most similar to the PH domains found in Lfc and Lbc (29.5 and 26.6% identical) and is only 9% identical to the PH domain of Dbl. The NH₂-terminal amino acid sequence is homologous to coiled-coil-containing proteins such as collagen (not shown).

As p115 contains a domain that is homologous to the Dbl and Lbc exchange factors, we next performed experiments to characterize the potential GEF activity of p115. Rho was prebound with [³H]GDP or GTPS and incubated with a purified recombinant form of p115 which lacked amino-terminal sequence (N-p115). The N-p115 was more efficient in promoting the dissociation of GDP than GTPS from RhoA and did not promote GDP dissociation from Cdc42Hs, Rac1, or K-Ras (Fig. 4, A and B). Under the conditions described for Fig. 4B, the intrinsic dissociation of GDP from RhoA is stimulated 10-fold by 1 µM N-p115. The specificity of GEF activity correlated with the ability of N-p115 to physically associate with the nucleotide depleted state of GST-Rho (Fig. 4C). N-p115 did not interact with GST-Cdc42, GST-Rac (Fig. 4C), or K-Ras (data not shown). Kinetic analysis of p115-catalyzed GEF activity on Rho revealed a K_m for Rho of 1.35 µM and a V_max of 0.031 pmol of incorporated GTP/min/pmol of N-p115 (Fig. 4D).

Since a number of Dbl-like proteins (Dbl, Lbc, Ost), which activate Rho (18, 26, 27), have been shown to be transforming, we tested the transforming potentials of various Myc-tagged p115 constructs, lbc and dbl (Fig. 5, Table I). The amount of DNA used for foci formation assays in NIH 3T3 cells was normalized based on levels of protein expression as determined by Western analysis with an anti-Myc tag monoclonal antibody (data not shown). A nearly full-length form of p115 (amino acids 83-913) was not transforming. However, when the NH₂ terminus was further truncated, N-p115 was capable of inducing focus formation in NIH 3T3 cells. If this p115 construct was further truncated just COOH-terminal to the PH domain, N-p115C became more transforming. When a deletion was made inside the DH domain (N-p115DH) or if the PH domain was partially truncated (N-p115PH), N-p115 was no longer transforming (Table I). These data are consistent with previous observations that Dbl-like proteins require intact DH and PH domains for their transforming activity (18, 26, 28). The transforming potentials of Myc-tagged lbc and Myc-tagged dbl were also tested. The results from these experiments suggest that dbl is more transforming than p115 and lbc.

N-p115DH

N-p115DH

N-p115

Table I. Comparisons of the abilities of p115 constructs, lbc and dbl, to promote foci formation in NIH 3T3 cells Constructsa Average number of foci per 10-cm plateb 1. p115(83-1019) 0 2. N-p115 9  ± 1 3. N-p115C 106  ± 5 4. N-p115PH 1  ± 1 5. N-p115DH 0 6. lbc 123  ± 4 7. dbl 318  ± 8 a  The following amounts of plasmid DNA were used: 1) p115(83-913), 5 µg; 2) N-p115, 0.2 µg; 3) N-p115C, 0.2 µg; 4) N-p115PH, 0.5 µg; 5) N-p115DH, 2 µg; 6) lbc, 0.2 µg; 7) dbl, 0.1 µg. b  The number of foci shown represents the average of three independent experiments, which were performed in duplicate. Foci formation assays were performed as described in Qiu et al. (31).

It has been shown that an activated version of rho, rhoV14, also induces focus formation in NIH 3T3 cells and that the morphology of these foci differs from that of ras-induced foci (29, 30). This difference presumably stems from a bifurcation in the transformation pathway downstream of Ras (31). Consistent with this interpretation, the activation of one arm of the pathway via rhoV14 synergizes with the activation of a second arm using an activated form of raf, raf-CAAX (30). The phenotype of the foci induced by N-p115 is similar to that observed with rhoV14 and lbc (Fig. 6A, panels a-c). These foci contain rounded, densely packed cells. The morphology of ras or rafCAAX-induced foci have a swirling pattern, which contain spindle shaped cells (30) (Fig. 6A, panel d). When rhoV14 or N-p115 are co-transfected with raf-CAAX, the majority of these foci have a morphology that is intermediate between those observed on expression of either rhoV14 or N-p115 and expression of raf-CAAX. The foci from the rhoV14/raf-CAAX and the p115/raf-CAAX co-transfections are dense in the middle and fusiform on the periphery (Fig. 6A, panels e and f) (30). Like rhoV14, N-p115 can synergize with the constitutively active raf-CAAX in focus formation assays (Fig. 6B) (30). These observations are consistent with p115 acting in vivo as a GEF for Rho.

Synergy of N-p115 with rafCAAX.

N-p115

N-p115

N-p115

mycN-p115

DISCUSSION

The Rho GTPase regulates the formation of actin cytoskeletal structures and other events that are important in regulating cell growth. Rho has been shown to induce the formation of stress fibers and is involved in mediating the ability of LPA and growth factors to promote stress fiber formation and the formation of focal adhesions (6). Rho appears to also control the assembly of integrin adhesion complexes that are involved in cell-cell aggregation of B-lymphocytes (32) and chemoattractant-activated leukocyte adhesion (33). Furthermore, Rho acts as a mediator of LPA and AlF₄-activated transcription (3) and can regulate cell growth by promoting progression through the G₁ phase of the cell cycle (7). The manner by which Rho induces changes within the cell is currently unknown. However, recently identified potential effectors for Rho (ROK, PKN, Rhophilin, and phospholipase D (15, 16, 34, 35)) may mediate the observed effects of Rho on cell morphology and transcriptional activation.

Using an affinity approach, we have been able to detect the association of four proteins with specific nucleotide states of Rho. p190-RhoGAP interacted with the GTPS state of Rho when lysates were prepared in the absence of phosphatase inhibitors (Fig. 1C). However, if phosphatase inhibitors were included in the lysis buffer, there was a significant increase in the amount of p190 associated with the GTPS as well as the GDP states. Under these conditions, RasGAP, which was presumably complexed to p190, was also found to be associated with the GTPS and GDP states. The mechanism for this apparent increase in affinity of p190 for Rho is not known. It is possible that the binding of RasGAP to p190 increases its affinity for Rho. Experiments performed by McGlade et al. (36) may provide in vivo evidence to support this idea. Expression of the NH₂ terminus of RasGAP (GAP-N, containing the SH3 and two SH2 domains) resulted in the formation of a stable complex with p190. Cells expressing GAP-N displayed disorganized stress fibers, bound poorly to fibronectin, and had reduced focal adhesions. In these cells, the stable interaction of GAP-N with p190 may be promoting its RhoGAP activity, leading to the disappearance of cytoskeletal structures normally induced by the activation of Rho. More recently, Chang et al. (37) demonstrated that epidermal growth factor treatment of cells overexpressing c-Src induced a rapid dissolution of actin stress fibers and the appearance of p190 and RasGAP in arc-like structures that surrounded the nucleus. This suggests that p190, which is a preferred substrate for c-Src (38), is responsible for the epidermal growth factor-induced reduction of stress fibers. These results and those of Fig. 1 are consistent with a model in which tyrosine phosphorylation and RasGAP association activate the RhoGAP activity of p190.

Two other proteins, which bound to the GST-Rho affinity column, were p115 and p130. These two proteins interacted only with the nucleotide-depleted state of Rho p115 was purified from COS cell lysates, cloned from a human fetal brain cDNA library, and found to encode a new member of the growing family of Dbl homology domain-containing proteins. Accordingly, an NH₂-terminal truncated version of p115 (N-p115) stimulated the dissociation of GDP from Rho, but not from Cdc42, Rac, or K-Ras. When lysates were prepared in the presence of phosphatase inhibitors, a second protein, p130, was also identified. p130 may represent another Rho-GEF, which may function only when phosphorylated. Alternatively, p130 may interact indirectly with Rho by coupling, in a phosphorylation-dependent manner, to p115. p130 is not a hyperphosphorylated form of p115, since an antibody raised against p115 does not cross-react with p130 (data not shown).

Since the initial discovery that the Dbl oncoprotein acted as a GEF for Cdc42Hs (39), a large number of proteins and oncogenes have been shown to contain Dbl homology (DH) domains. A feature common to all DH-containing proteins is the pleckstrin domain located immediately COOH-terminal to the DH domain. Members of the pleckstrin family interact with the subunits of heterotrimeric G-proteins (40) or acidic phopholipids (41, 42). The IRS-1 PTB domain structurally resembles PH domains and can interact with tyrosine-phosphorylated peptides (43). Thus, PH domains may have a wide variety of cellular ligands, which may provide a mechanism of localizing Dbl-like proteins to membranes. The high degree of homology between the PH domains of Lbc and Lfc suggests they may share a common ligand, whereas the p115 PH domain deviates considerably from these sequences, suggesting it may bind to a separate ligand. A similar trend is also noted for the DH domain. Throughout this domain, Lbc and Lfc share much higher sequence identity to each other than to the DH domain of p115. Therefore, it may be appropriate to consider Lbc/Lfc and p115 as two distinct subclasses of Rho-specific GEFs. From the transformation assays performed in this paper, it is apparent that dbl is more transforming than p115. This could reflect differences in PH domain ligands, differences in GEF potencies, or perhaps differences in specificity versus Rho family members.

In this study, a variety of p115 constructs were tested for their transforming potential. A nearly full-length form of p115 (amino acids 83-913) was not transforming. However, expression of a further NH₂-terminal truncated version (N-p115) in NIH 3T3 cells promoted the formation of foci that were similar in phenotype to those induced by rhoV14 and also, like rhoV14, N-p115 synergized with raf-CAAX in focus formation assays. When N-p115 was truncated at the COOH terminus (N-p115C), the transforming potential of p115 was further increased, suggesting that the NH₂ and COOH termini may negatively regulate p115 function in cells. N-p115 and N-p115C were tested for GEF activity and were found to possess the same levels of intrinsic GEF activities (data not shown). Therefore, a COOH-terminal truncation may increase the transforming potential of p115 by more fully exposing its PH domain, allowing for a more efficient interaction of the PH domain with a specific ligand. Since full-length p115 has not been tested for GEF activity, it is not possible to discuss whether its inability to transform cells is due to a lack of GEF activity or due to an unexposed, sterically hindered PH domain. Nevertheless, its lack of transforming potential suggests that important regulatory signals may be required in order for p115 to become a fully functional Rho-specific GEF in cells.

The increasing number of Dbl-like proteins, which contain a variety of structural motifs, suggests that there may be specific mechanisms to selectively regulate GEFs. Many of these motifs are involved in protein-protein interactions (44). For example, proto-Vav contains SH2 and SH3 domain (45); FGD1 (46), which is involved in Aarskog-Scott syndrome, has two potential SH3 binding sites; and ORFP (accession number D25304[GenBank]), which was cloned from a human immature myeloid cell line (KG1) cDNA library (17), has an SH3 domain. By coupling to other proteins, these motifs may provide a mechanism to focus the Rho-like GTPase to function in a particular cellular enviroment. Rho has been shown to participate in receptor tyrosine kinase pathways, as well as pathways, such as the LPA and formylmethionylleucylphenylalanine pathways, which activate heterotrimeric G-proteins. Since p115 is expressed in many cultured cell lines, p115 may represent an ideal candidate to begin addressing the mechanisms that may regulate a Rho-type GEF. Considering the rather limited tissue distribution of Lbc (22), it is intriguing to speculate that p115 may mediate Rho-dependent effects in many cell types. Future studies will be aimed at determining the signaling pathways in which p115 participates, how p115 may be regulated, and the proteins or lipids with which it may associate.