INTRODUCTION

Laminins are adhesive glycoproteins found in basement membranes that promote diverse cellular responses. Cell adherence to laminin matrices plays an important role in maintaining normal tissue organization and in tissue renewal and repair. The interaction of cells with extracellular matrix macromolecules like laminins is mediated primarily by heterodimeric receptors from the integrin superfamily (reviewed in Ref. 1). Integrins provide linkage between the component elements of the extracellular matrix and the structural constituents inside the cell. Besides serving as adhesion receptors, integrins can transmit signals from the extracellular matrix to the cell interior that can activate several pathways, ultimately influencing an array of cellular properties including proliferation, differentiation, survival, and apoptosis (2).

Laminin 1 was the first fully characterized isoform and is composed of 1, 1, and 1 chains. This prototypic laminin is a large molecular weight trimer with multiple domains that are involved in cell adhesion and interactions with other basement membrane components such as nidogen, type IV collagen, and heparan sulfate proteoglycan (3). Several other laminin isoforms have been identified and include laminin 2 (211, merosin), laminin 3 (121, S-laminin), laminin 4 (221, S-merosin), laminin 5 (332, kalinin/nicein/epiligrin), and less well characterized laminins 6-10 (reviewed in Refs. 3, 4, 5). The different laminin isoforms are tissue-specific and are expressed in a developmentally regulated pattern. Laminin 1 contains multiple sites for integrin-mediated cell attachment, which is effectuated by several 1 integrins (5). Of these 31, 61, and 71 bind to the long arm fragment E8 of laminin, produced by elastase digestion. The 11 and 21 integrins, which both contain the I domain, bind to the cross-region of laminin represented by the short arm fragment.

The biological response to laminin appears to be cell type-specific, and this may be due in part to the specific integrin receptors expressed by individual cells. 71, originally found in melanoma cells, is a muscle-specific integrin (6) that binds to laminin (7, 8, 9). Although there is only one 7 gene, complicated splicing mechanisms result in several 7 isoforms. Several studies have shown that alternative splicing generates two isoform subsets: (i) X1 and X2 and (ii) A, B, and C, which differ at extracellular and cytoplasmic regions, respectively (10, 11, 12, 13). Upon terminal differentiation of myoblasts, isoform switching and up-regulation of 7 expression are detected. The extracellular variants have altered sequence in the ligand binding domain and may have different laminin isoform specificity or affinity. The cytoplasmic isoforms, which share the common extracellular and transmembrane domains but differ at the cytoplasmic region, may trigger different biological functions when cells interact with laminin.

In the present study, we have stably transfected MCF-7 carcinoma cells, which normally do not adhere to laminin 1, with mouse 7 cDNA. We also generated function-perturbing monoclonal antibodies to mouse 7 integrin to inhibit 7-extracellular matrix interactions. Using these approaches, we demonstrated that both 7A and 7B mediate adhesion and migration of MCF-7 transfectants on laminin 1 and laminin 2/4 substrates; however, 71 does not bind to laminin 5.

EXPERIMENTAL PROCEDURES

The human breast carcinoma cell line MCF-7 was from American Type Culture Collection and was grown in Dulbecco's modified Eagle's medium H-16 with 10% fetal bovine serum. Laminin 1 was purified from mouse Engelbreth-Holm-Swarm tumor as described previously (7). Human placental laminin was purchased from Life Technologies, Inc. and is known to be a mixture of laminin 2 and 4 (14, 15). Purified human laminin 5 was kindly provided by Dr. Robert Burgeson (Cutaneous Biology Research Center, Boston, MA). Human plasma fibronectin was purchased from Collaborative Biomedical Products (Bedford, MA).

Antibodies against integrin subunits included the rat anti-human 1 mAb¹ A2B2 and rat anti-human 5 mAb B2G2, kindly provided by Dr. Caroline Damsky (University of California, San Francisco, CA); mouse anti-human 2 mAb VM1, kindly provided by Dr. Vera Morhenn (SRI International, Menlo Park, CA). Anti-human 3 mAb P1B5 was purchased from Life Technologies, Inc.; rat anti-human 6 mAb GoH3 was purchased from AMAC (Westbrook, ME). The rabbit polyclonal antibody 22780 and 1211 were prepared in this laboratory against peptide sequences specific to 7A cytoplasmic region (NSPSSSFRTNYHR) and to 7B cytoplasmic region (GTIQRSNWGNSQWEGSDAH), respectively. The peptides coupled to keyhole limpet hemocyanin using carbodiimide were injected subcutaneously in New Zealand White rabbits. Serum titers were monitored and verified by immunoprecipitation and immunoblotting of 7A or 7B transfectants and of myoblasts and myotubes. Rat anti-mouse 7 mAbs CA5, CY4, and CY8 were also generated in our laboratory. Production and characterization of these monoclonal antibodies against 7 will be described in detail elsewhere.² CA5, CY4, and CY8 were used for immunoprecipitation and fluorescence-activated cell sorting; CY4 and CY8 were used for function-perturbing assays. Fluorescein-conjugated secondary antibodies were obtained from Jackson ImmunoResearch Laboratories (West Grove, PA). Streptavidin-horseradish peroxidase and ECL kit were purchased from Amersham Corp.

7 cDNA Constructs

The cDNA encoding the complete sequence of mouse 7 was amplified from reverse-transcribed cDNA and then subjected to polymerase chain reaction with primers AGAGCGTTGATCCC and CTGCTGTCCCAAG and ligated into Bluescript (Stratagene). For constructing 7A, the NsiI-XbaI fragment was amplified from a reverse transcription product of C2C12 mRNA with primers abtran (GCTGCTCAGAGATGCATCC) and NheI-XbaI (AGTAAGTTGCTAGCATACGTCTAGAGC) and ligated into pGEM 11f (Promega). The NsiI-EcoRI fragment from pGEM was cut and ligated into Bluescript containing the 7B sequence from which the NsiI-EcoRI cytoplasmic region had been deleted. Both 7A and 7B cDNA in Bluescript were further cloned into pRc/CMV (Invitrogen).

Transfection and Selection of 7 Transfectants

Transfection of MCF-7 cells was performed by the calcium phosphate precipitation method (Mammalian Transfection Kit, Stratagene). MCF-7 cells at 30% confluency in 10-cm plates were transfected with 25 µg DNA/plate. Cells subsequently were selected in growth medium containing 500 µg/ml G418. Individual clones were isolated after 2 weeks with cloning rings. At least 10 clones for each isoform were isolated and then tested for enhanced adhesion to immobilized laminin 1. Those showing positive results (~30%) were verified to express 7 subunits by Western blot with polyclonal antibody 1211 for 7B, and polyclonal antibody 22780 for 7A. Clone G, expressing a high level of 7B, and clone 114, expressing a comparable amount of 7A, were chosen for further studies.

Subconfluent cells were briefly trypsinized. Single-cell suspensions of 10⁶/ml were incubated with optimal concentrations of primary antibodies in wash buffer (2% normal goat serum in PBS) for 1 h on ice, washed three times, and incubated with the secondary fluorescein-labeled antibodies for 30 min on ice. After washing again three times, the cells were stained with propidium iodide (1 µg/ml) to identify nonviable cells. Flow cytometry was performed on a FACScan flow cytometer (Becton Dickinson). Control samples consisted of cells with or without secondary antibody binding. Any nonviable cells stained with propidium iodide were eliminated from the analysis.

Confluent cultures of cells were washed twice with PBS and then labeled with NHS-LC-Biotin (Pierce), 1 mg/ml in cold PBS at 4 °C for 90 min. Cells were washed twice with 50 mM glycine blocking buffer and incubated in this buffer for 10 min at 4 °C. The cells were lysed in lysis buffer (PBS with 0.1 M Tris, pH 7.5, 2% Nonidet P-40, 2 mM phenylmethylsulfonyl fluoride, and 1 mM N-ethylmaleimide). After preclearing with protein A beads, the lysate was mixed by rotation for 3 h with primary antibody and protein A beads. The beads were washed with the wash buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 1 mM MgCl₂, 0.5% Nonidet P-40, 0.1% BSA) three times and heated at 100 °C in SDS sample buffer for 5 min. The supernatant was divided into two aliquots: one for nonreducing samples and one for reducing with 2-mercaptoethanol. Samples were separated by 7.5% SDS-polyacrylamide gel electrophoresis under reduced and nonreduced conditions. The biotinylated proteins were detected by streptavidin-horseradish peroxidase and then ECL.

Microtiter plates (96-well Immulon plates, Dynatech) were coated with matrix proteins at the indicated concentrations in PBS for 1 h at 37 °C in a humidified atmosphere. Plates were washed with PBS and incubated with medium containing 0.1% BSA for 60 min in a CO₂ incubator to block nonspecific adhesion. Single-cell suspensions were prepared in Dulbecco's modified Eagle's medium with 0.1% BSA at 4 × 10⁵ cells/ml, added in triplicate to 96-well plates, and then incubated for 30-90 min at 37 °C. Nonadherent cells were removed by shaking on a titer plate shaker (Lab-line Instruments) and washing with PBS. Cells were fixed with 1% formaldehyde, stained with 1% crystal violet, solublized in 2% SDS, and then read at 562 nm. Cells bound to wheat germ agglutinin (10 µg/ml) or collagen type I (100 µg/ml) on a separate 96-well plate were used to indicate 100% attachment. Background cell adhesion to 1% BSA-coated wells was subtracted. The effect of specific antibody was tested by preincubating the cells with the hybridoma supernatants or dilutions of purified antibody on ice for 30 min prior to the assay.

Cell migration was assayed in a modified Boyden chamber (Neuroprobe, Bethesda, MD) as described previously (16). Briefly, an 8-µm porosity polyvinylpyrolidone-free polycarbonate filter (Nucleopore, Pleasanton, CA) was precoated with ligand at the indicated concentration. The lower well of the chamber was filled with serum-free medium containing 0.1% BSA. In some studies, the lower chamber contained medium with or without basic fibroblast growth factor as indicated. Cell suspensions were prepared from subconfluent cultures and resuspended to a final concentration of 4 × 10⁵ cells/ml in serum-free medium containing 0.1% BSA. A 50-µl aliquot of cell suspension was added to the upper chamber and then incubated for the indicated time at 37 °C. Cells on the top of the filter were removed by wiping, and the filter was then fixed in 1% formaldehyde in PBS. Migrating cells were stained with 1% crystal violet, and nine randomly chosen fields from triplicate wells were counted at 400× magnification.

RESULTS

Generation of Stable Transfectants Expressing High Levels of 7A and 7B

To analyze 7 function, we generated 7-transfected expressers from cells that lack endogenous functional laminin 1-binding integrins. We transfected cDNA encoding the 7A or 7B subunits into MCF-7 cells. MCF-7 cells normally adhere poorly to laminin 1 (17). At least 10 clones of each transfectant were isolated and characterized, and several high expressing clones were obtained for both 7A and 7B. High expressers for 7A (clone 114) and 7B (clone G) were chosen for further analysis. Fluorescence-activated cell sorting analysis with mAbs against different laminin-binding integrins showed that one of the high 7A-expressing cell lines, clone 114, expresses moderate levels of 2, 3, and 6 and high amounts of 7 that correspond to means of fluorescence intensity of 84.8, 34.1, 35.9, and 645.3, respectively (Fig. 1A). For the parental MCF-7, 2 (104.1) and 6 (25.4) levels were similar, but 3 was expressed at a mean fluorescence intensity of 67.0. We also found that the 1 integrin level was increased in clone 114 in compensation to the increased level of 7 on the cell surface (data not shown).

Analysis of laminin-binding integrins in 7 transfectants.

3

The immunoprecipitation analysis of surface biotinylated parental MCF-7 cells and clone 114 cells verified specificity of the mAb and in addition showed that 71 integrin was expressed in transfectants but was not detectable in the parental cells (Fig. 1B). Immunoprecipitation of cell lysates with CY8, a mAb against the extracellular domain of 7, yielded the 7 subunit in clone 114; as expected for this integrin under nonreducing conditions, the 1 subunit partner comigrated with the 7 subunit (Fig. 1B, lane 2) (7, 18). Following reduction, the 1 subunit exhibited decreased mobility, whereas the 7 subunit was cleaved to yield a 100-kDa fragment and an ~30-kDa fragment containing the cytoplasmic tail (Fig. 1B, lane 3). The 71 bands were also detected by using polyclonal antibody 22780 to 7A and polyclonal antibody 1211 to 7B in clone 114 and clone G, respectively (data not shown). In other studies, we have found that transfection of MCF-7 cells with cDNA of 6 integrin leads to significant expression of the 64 complex.³ In the case of MCF-7 cells transfected with 7, the integrin does not associate with 4 but preferentially pairs with the 1 subunit. This is interesting in view of the fact that 6 and 7 have high amino acid sequence homology (6, 10).

Adhesion of 7 Transfectants to Laminin

We initially assessed the ligand specificity of 7A and 7B by testing the transfectants in standard adhesion assays with laminin 1 and its fragments as substrates. Both the MCF-7 7A-transfectant clone 114 and 7B-transfectant clone G adhered effectively to laminin 1 and its E8 fragment. In contrast, the parental MCF-7 cells did not adhere to laminin 1 or the E8 fragment (Fig. 2A). As expected, neither the parental cells nor transfectants attached to laminin 1 fragments E4, E1, or P1, which lack the E8 region containing the 7 binding site. The adhesion of 7A-expressing clone 114 cells to laminin 1 was further evaluated using function-perturbing mAbs to 7 and other potential laminin-binding integrins. Whereas mAbs to 2, 3, and 6 integrins failed to inhibit the strong laminin 1-binding activity of these cells, mAbs to 7 (CY4, CY8) completely blocked adhesion (Fig. 2B). A nonfunction-perturbing mAb to 7 (CA5) had no effect on adhesion. CY4 and CY8 had a similar blocking effect on 7B-transfectant clone G cells (data not shown). These results confirm that 7 expressed in MCF-7 cells effectively binds to laminin 1 and the E8 fragment and that both 7 isoforms show similar activities for these ligands.

Adhesion of 7A and 7B MCF-7 transfectants on laminin 1 and laminin 2/4. A, adhesive properties of clone 114 expressing 7A and clone G expressing 7B to laminin 1 and laminin 1 fragments. Parental MCF-7 cells served as a control. Cells (2 × 10⁴) were resuspended in culture medium and added to laminin-coated plates as described under ``Experimental Procedures.'' Laminin 1 and its fragments were coated at 10 µg/ml. Adherence of cells in 1% BSA-coated wells was treated as background binding and subtracted. In A-C, data are presented as percentages of the total cells added to each well. Values are the means of triplicate wells; bars show standard deviation. B, inhibition of clone 114 attachment to 10 µg/ml laminin 1 by mAbs CY4 and CY8 to the 7 integrin subunit. Assays were done as in A except that the indicated samples were preincubated with 10 µg/ml mAbs to integrin subunits. CY4 and CY8 mAbs inhibited adherence of the transfectants to laminin 1 to the same extent as A2B2 (anti-1). No inhibition by VM1 (anti-2), P1B5 (anti-3), or GoH3 (anti-6) was detected. Nonfunction-perturbing mAb CA5 (anti-7) is a control for CY4 and CY8 (anti-7) function-perturbing mAbs. C, inhibition of clone 114 attachment to human placental merosin (a mixture of laminin 2 and 4) by function-perturbing mAbs to integrins. Optimal concentrations of the blocking antibodies were predetermined by adhesion assay of MCF-7 parental cells for 2, 3, and 6. Both MCF-7 parental and clone 114 cells adhered well to 30 µg/ml laminin 2/4. VM1 (anti-2), P1B5 (anti-3), and GoH3 (anti-6) function-perturbing mAbs were used individually or in combination with (2+3+6+7) or without (2+3+6) CY8 to determine whether these integrins contribute to the adhesion on laminin 2/4. A2B2 (anti-1 mAb) completely inhibited adhesion of both cell lines.

Next, we tested the adherence of parental MCF-7- and 7-expressing clone 114 cells on preparations of human placental merosin (laminin 2 and 4) and purified human laminin 5. Human placental merosin contains primarily laminin 4 (221, S-merosin) with lesser amounts of laminin 2 (211, merosin) (14, 15); the laminin 5 preparation, isolated from conditioned medium of human keratinocytes, consists of laminin chains 332 (19). Both parental MCF-7 cells and 7 transfectants adhered to laminin 2/4. However, analysis of adhesion to this mixture of laminins is complicated by the presence of 2, 3, and 6 integrins. The adhesion of both parental and 7-transfected cells to laminin 2/4 was partially blocked by anti-2 mAb (VM1) and anti-3 mAb (P1B5). The combination of function-perturbing mAbs anti-2 (VM1), anti-3 (P1B5), and anti-6 (GoH3) completely blocked attachment of parental cells but only partially inhibited attachment of the 7 transfectants (Fig. 2C). Interestingly, 7-transfectant adhesion to laminin 2/4 was inhibited by nearly 80% with 7-perturbing mAb CY8; and the combination of anti-2 (VM1), anti-3 (P1B5), anti-6 (GoH3), and anti-7 (CY8) completely blocked the adhesion of 7 transfectants to laminin 2/4 substrates. Thus, 7 can clearly bind to and mediate adhesion to laminin 2/4.

In adhesion assays with laminin 5, we used as a positive control a human squamous carcinoma cell line (HSC-3) that binds strongly to laminin 5 via the 3 integrin, which is highly expressed in these cells (16). At laminin 5 concentrations from 0.3 to 3 µg/ml, HSC-3 cells showed a dose-dependent increase in adhesion, whereas MCF-7 parental cells showed only moderate binding efficiency (Fig. 3A). However, the 7-transfected clone 114 cells bound poorly to the laminin 5 substrate. Under the same assay conditions, HSC-3 and clone 114 cells adhered efficiently to laminin 1 in a dose-dependent fashion, whereas the MCF-7 parental cells did not (Fig. 3B). In other studies with MCF-7 parental cells and 7 transfectants, adhesion to laminin 5 could be totally blocked with mAb against 3 (data not shown). As mentioned above, analysis of integrin profile indicates that in the 7-transfected clone 114 cells, 31 levels are decreased ~50% compared with that of the parental cell population. Thus, there is a correlation between adhesion to laminin 5 and expression of 3. This clearly demonstrates that 7 integrin in MCF-7 cells binds to laminin 1 and laminin 2/4 but cannot efficiently mediate binding to laminin 5. 

7 transfectants adhere poorly to laminin 5.

Laminin Induces Motility in 7 Transfectants

We next examined the locomotive response of parental MCF-7 cells and 7 transfectants to laminin 1 (Fig. 4, A and B) and laminin 2/4 (Fig. 4C) substrates in a modified Boyden chamber assay. The parental MCF-7 cells are known to be poorly migratory on laminin 1 (20), and several growth factors have been shown to stimulate their motility on other ligands (21, 22). However, both of the 7-transfected clones (114 and G) showed an enhanced motile response on laminin 1 compared with the parental cells; furthermore, in the presence of basic fibroblast growth factor (1 ng/ml) as a stimulant the motile response was enhanced. These results established that transfection of 7A or 7B is sufficient to convert MCF-7 cells into migratory cells on laminin 1. In addition, motility of clone 114 cells on this substrate was completely blocked by CY8 monoclonal antibody to 7 (Fig. 4B).

Migration of 7 transfectants on laminin 1 and laminin 2/4.

2+3+6+7

2+3+6

On laminin 2/4, both parental MCF-7 cells and clone 114 cells were motile (Fig. 4C). Function-perturbing antibody to 7 blocked the motility of clone 114 cells by more than 50%. In the presence of a combination of function-perturbing antibodies to 2, 3, and 6, migration of parental MCF-7 cells was completely inhibited, but there was little effect on clone 114 cells (Fig. 4C). Finally the combination of anti-2, -3, -6, and -7 mAb or anti-1 completely blocked the motility of both parental and clone 114 cells. These results clearly show that the 7 integrin binds and promotes motility on laminin 1 and laminin 2/4 substrates.

DISCUSSION

In this study, we have demonstrated that the 71 integrin can mediate adhesion and migration on a restricted number of laminin isoforms. We used two approaches successfully: (i) a gain of function approach by transfecting 7 cDNA into MCF-7 cells and (ii) a loss of function approach by using function-perturbing antibodies against 7 on cells expressing this integrin. Evidence obtained from these approaches clearly shows that exogenously expressed 7 confers on MCF-7 cells both the ability to bind and the ability to migrate on laminins. While this work was in preparation, Echtermeyer et al. (9) reported that transfection of mouse 7 cDNA into the human 293 embryonic kidney cells conferred a motile phenotype on laminin 1. Interestingly, this enhancement in motility occurred even though the parental cells expressed additional laminin 1-binding receptors.

We examined the ligand specificity of the 7 receptor using available laminin isoforms. In MCF-7 7 transfectants, 71 mediated binding to preparations of laminin 1 and to human placental laminins (a mixture of laminin 2 and 4). In contrast, laminin 5 was a poor substrate for 7-expressing cells. Eventually, when pure preparations are available, the functions of 7 should be tested on additional members of the laminin superfamily, especially laminin 2 (merosin), which is present in the basement membrane surrounding adult skeletal myofibers where 7 normally is detected. It is interesting that another laminin-binding integrin, 61, sharing high amino acid sequence homology with 7, not only binds to laminin 1 and human placental merosins (laminin 2 and 4) but also binds efficiently to laminin 5 (23). In addition, 6 can pair with 1 or 4 subunit, whereas as we show here in the MCF-7 transfectants, 7 pairs only with 1 subunit. Thus, even though 6 and 7 share strong amino acid sequence identity, there must be distinct domains that define both ligand specificity and pairing preferences. In the parental MCF-7 or transfectants, moderate levels of 2, 3, and 6 are expressed, yet these integrins are not capable of mediating adhesion or migration on laminin 1. It appears that this set of integrins, in contrast to 7, is not constitutively active for laminin 1. However, on laminin 2/4, this same set of integrins in the parental MCF-7 cells can mediate both adhesion and motility, yet in the transfectants is not fully competent for these adhesive interactions.

It is interesting that 7 transfection appeared to decrease the ability of existing integrins on the MCF-7 cells to interact with laminin 2/4 and with laminin 5. One possibility for the decrease in the activity of integrins 2 and 3 is due to a decrease in their expression. Fluorescence-activated cell sorting analysis confirms that the high expression of 7 caused a modest decrease in the expression level of 3. Another contributing factor may be that the high 7 expression produces a dominant negative effect that down-regulates the activity of the other integrins. Studies have suggested that certain integrins can produce a modulating effect on the function of other integrins. For example, in lymphocytes activation of LFA-1 can down-regulate 4 activity (24). A different phenomenon is observed in the 5-deficient CHO cells where full activity of v3 receptor requires the presence of transfected 5 integrin (25). Thus an integrin may induce down-regulation of another integrin's function, or alternatively two integrins may cooperate with each other to modulate function.

It is conceivable that the cytoplasmic variants of 7 function differently. RNA alternative splicing events in the  cytoplasmic region have been detected in several integrin molecules, including 3, 6, and 7 (10, 11, 12, 26, 27, 28, 29). However, functional significance of the  chain-cytoplasmic isoforms has not been well established. Results from recent studies searching for functional differences between 6A and 6B are still controversial (23, 30, 31, 32, 33). Our results indicate that 7A and 7B receptors are equally active in their adhesive or migratory activities. It is possible that 7A/B, a muscle-specific integrin, will show differential activities only in the context of a muscle-specific environment.

In summary, the results presented here show that 71 can mediate both cell adhesion and migration on laminin 1 and laminin 2/4. Importantly, we have demonstrated that 7 can interact with these different laminin substrates but not with epithelial cell-specific laminin 5. These results strongly support the role of the 7 receptor in mediating interactions with specific laminin isoforms. The tissue-specific expression of different family members of integrins and laminins (e.g. 71 and merosins in skeletal muscle (13, 34)) suggests that there is a selective interaction that may be important in both embryonic development and tissue homeostasis.