Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pearman, A. T.
Right arrow Articles by Partridge, N. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pearman, A. T.
Right arrow Articles by Partridge, N. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 271, Number 41, Issue of October 11, 1996 pp. 25715-25721
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

Parathyroid Hormone Induces c-fos Promoter Activity in Osteoblastic Cells through Phosphorylated cAMP Response Element (CRE)-binding protein Binding to the Major CRE*

(Received for publication, March 18, 1996, and in revised form, July 11, 1996)

A. Terrece Pearman , Wan-Yin Chou , Kimberly D. Bergman , Malini R. Pulumati and Nicola C. Partridge Dagger

From the Department of Pharmacological and Physiological Science, St. Louis University School of Medicine, St. Louis, Missouri 63104

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES


ABSTRACT

Many parathyroid hormone (PTH)-mediated events in osteoblasts are thought to require immediate early gene expression. PTH induces the immediate early gene, c-fos, in this cell type through a cAMP-dependent pathway. The present work investigated the nuclear mechanisms involved in PTH regulation of c-fos in the osteoblastic cell line, UMR 106-01. By transiently transfecting c-fos promoter 5' deletion constructs into UMR cells, we demonstrated that PTH induction of the c-fos promoter requires the major cAMP response element (CRE). Point mutations created in the major CRE within the largest construct inhibited both PTH-stimulated and basal expression. This element, therefore, performs concerted basal and PTH-responsive cis-acting functions. Gel retardation and Western blotting techniques revealed that CRE-binding protein (CREB) constitutively binds the major CRE but becomes phosphorylated at its cAMP-dependent protein kinase consensus recognition site following PTH treatment. CREB was functionally implicated in c-fos regulation by coexpressing a dominant CREB repressor, KCREB (killer CREB), with the c-fos promoter constructs. KCREB suppressed both basal and PTH-mediated c-fos induction. We conclude that PTH activates c-fos in osteoblasts through cAMP-dependent protein kinase-phosphorylated CREB interaction with the major CRE in the promoter region of the c-fos gene.


INTRODUCTION

We have shown previously that parathyroid hormone (PTH)1 stimulates c-fos transcription in the osteoblastic UMR 106-01 cell line through a cAMP-mediated pathway (1). However, the events that follow cAMP induction are less clear. The present work was undertaken to describe the nuclear mechanisms involved in PTH-mediated c-fos induction in osteoblasts. Many PTH-responsive genes in osteoblasts are thought to be secondary responses due to their delayed nature and requirement for ongoing protein synthesis (2, 3). By definition, these genes require the expression of primary response genes, such as c-fos, for their induction.

Several in vivo models have identified Fos as a player in bone biology. This factor was first linked to bone when it was discovered in a mouse osteosarcoma as the product of v-fos, the viral homolog of c-fos (4). Similarly, several groups have engineered mice that overexpress c-fos and display bone abnormalities including non-malignant bone neoplasms and collagenase-producing bone tumors (5, 6). Conversely, Fos null mice exhibit osteopetrosis and disorganized bone growth (7). Transgenic mice, which express a fos-lacZ fusion gene, also identified bone as one of the major sites for c-fos expression (8). In agreement with the rodent models, evidence for Fos involvement in human bone disease has been provided by high c-fos expression in Pagetic bone (9) and human osteosarcomas (10).

c-fos is regulated in a cell-specific manner through a variety of mechanisms. These signaling pathways most likely act through different combinations of highly conserved sites within the promoter region (11). The mechanism for c-fos induction in osteoblasts by the bone resorptive agent, PTH, has not yet been determined. Observations described in this and previous studies conducted in our laboratory (1) demonstrate that PTH activates c-fos transcription independent of de novo protein synthesis and mainly through increased intracellular cAMP. We therefore hypothesized that cAMP response element-binding protein (CREB) becomes phosphorylated by PKA allowing transcriptional activation through a cAMP response element (CRE). Current information supports this model because CREB is a constitutively expressed protein, which becomes activated upon phosphorylation within its P-box domain. CREB is then able to trans-activate genes that possess the CRE sequence. The c-fos 5' regulatory region has several imperfect CRE sequences. However, only one CRE markedly causes cAMP-dependent c-fos promoter activation in Balb/3T3 cells (12). This site has therefore been referred to as the major CRE and was the focus of our experimental approach.

We present a dissection of the PTH-responsive segment within the c-fos 5' regulatory region as well as describe the transcription factor activation mechanism. Specifically, the major CRE is required for PTH-mediated c-fos induction. This site confers basal expression through unphosphorylated CREB. However, PTH causes CREB to become phosphorylated within its PKA recognition site resulting in enhanced promoter function. These observations led to the following model. In unstimulated cells, CREB participates in basal c-fos expression through the major CRE. Upon PTH exposure, PKA phosphorylates, and thereby activates, CREB trans-activation functions. Increased Fos protein then participates in gene regulation in bone.


EXPERIMENTAL PROCEDURES

Materials

Radiolabeled [14C]chloramphenicol and enhanced chemiluminescence (ECL) reagents were obtained from Amersham Corp. DuPont NEN supplied [gamma -32P]ATP. Polyvinylidene difluoride membrane was purchased from Millipore (Bedford, MA). Oligonucleotides were synthesized by Midland Certified Reagent Co. (Midland, TX). Poly(dI-dC) was a product of Boehringer Mannheim. Tissue culture media and reagents were obtained from the Washington University Tissue Culture Center (St. Louis, MO). All other chemicals were obtained from Sigma or Fisher Scientific.

Antibodies

Anti-Fos antibodies were either purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA) or were a gift from Dr. Natalie Teich (Imperial Cancer Research Fund, London, United Kingdom). Anti-CREB antibody, raised against the P-box region of CREB (13), was a gift of Dr. Joel Habener (Massachusetts General Hospital and Howard Hughes Medical Institute, Harvard Medical School, Boston, MA). Antibodies to ATF-1 (hybridoma) and ATF-2 (mouse ascites) were gifts from Dr. James Hoeffler (University of Colorado Health Sciences Center, Denver, CO). Anti-phosphoCREB was purchased from Upstate Biotechnology Inc. (Lake Placid, NY). Horseradish peroxidase-conjugated goat anti-rabbit IgG was purchased from both Bio-Rad and Santa Cruz Biotechnology, Inc.

Plasmids

Mouse fos-CAT 5' deletion constructs -56 fos-CAT, -71 fos-CAT, -151 fos-CAT, and -356 fos-CAT (14, 15, 16) were provided by Dr. Michael Gilman (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). KCREB expression plasmid (17) was a gift from Dr. John Chrivia (Saint Louis University School of Medicine, St. Louis, MO). pSV-beta -galactosidase control vector, pSV2CAT, and pSV0CAT plasmids were purchased from Promega Corp. (Madison, WI).

Cell Culture

UMR 106-01 cells were cultured as described previously (18). The treatment medium contained either 2% fetal bovine serum or 0.1% bovine serum albumin.

Western Blotting

For Fos detection, cell monolayers were washed with PBS (pH 7.6), scraped into PBS, and pelleted by centrifugation (200 × g, 10 min, room temperature). All further steps were conducted at 4 °C or on ice as rapidly as possible and in the presence of 0.2 phenylmethylsulfonyl fluoride because Fos protein is extremely labile in our hands. The cell pellets were resuspended in lysis buffer (25 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.5% Triton X-100, 0.5% sodium deoxycholate, 0.2% SDS) and sonicated. Equal amounts of total protein as determined by the Bradford (19) dye binding (Bio-Rad reagent) method were separated by SDS-polyacrylamide gel electrophoresis, electroblotted to polyvinylidene difluoride membrane, and blocked overnight in 1% bovine serum albumin, Tween-Tris-buffered saline (TTBS) (0.1% Tween 80, 138 mM NaCl, 5 mM KCl, and 25 mM Tris base). For phosphoCREB detection, cells were lysed in the culture dishes by scraping directly into sample buffer, centrifuged briefly, boiled, and loaded onto an SDS-polyacrylamide gel since phosphorylation was so labile. Antibodies were diluted in 1% TTBS. Dr. Teich's Fos antibody was diluted to 1:1000, Santa Cruz Fos antibody 1:500, Dr. Habener's CREB antibody 1:2000, and phosphoCREB 0.5 µg/ml and secondary antibody, in all cases, 1:5000. Exposure to primary antibody was for 1 h except for phosphoCREB antibody, which required only 30 min. Longer incubation with this antibody results in cross-reactivity with unphosphorylated CREB. The membranes were then washed with 0.1% TTBS three times for 5 min. Secondary antibody was applied for 30 min in all cases. Proteins were detected using ECL according to manufacturer's directions.

Transient Transfection

Cells were seeded at 106 cells/100-mm diameter Petri dish and transiently transfected the following day using a calcium phosphate coprecipitation method modified from Rosenthal (20). Briefly, DNA was added to 550 µl of a 0.25 M CaCl2 solution and mixed dropwise into 550 µl of 2 × HEPES buffered salt solution (560 mM NaCl, 100 mM HEPES, 3 mM Na2HPO4, pH 7.1) per dish. The solution was added to the media in the culture dishes, which were then incubated in 8% CO2 for 4 h. Following glycerol shock, the cells were returned to maintenance medium overnight, and then treated with the appropriate agent(s). A preliminary time course indicated that maximal c-fos promoter activity was detectable after 24 h of PTH treatment. Therefore, all treatments were for this duration. To harvest, the cells were washed four times with PBS and scraped into TEN (40 mM Tris-HCl, pH 7.5, 1 mM EDTA, 150 mM NaCl). The cells were then pelleted by centrifugation (1000 × g, 10 min, 4 °C) and resuspended in 150 µl of 0.25 M Tris, pH 8.0. Cell lysis was achieved by three freeze-thaw cycles. Endogenous acetylases were inactivated by incubating samples at 60 °C for 10 min (except samples to be assayed for beta -galactosidase activity) and debris removed by centrifugation (12,000 × g, 10 min, 4 °C). The supernatant was assayed for CAT activity by a modification of the Seed and Sheen (21) procedure. Separate plates were transfected with a beta -galactosidase expression plasmid to verify transfection uniformity from experiment to experiment and beta -galactosidase activity assayed. Transfection efficiency was so uniform that CAT activities from separate, individual experiments have been pooled and are shown in many figures as mean ± S.E. Background was defined as the activity of pSV0CAT and subtracted from that of the fos-CAT constructs. The pSV2CAT plasmid was transfected into separate plates as a positive control in all experiments.

Gel Mobility Shift Assay

Cell lysates were prepared by washing the cell monolayer with PBS and scraping into lysis buffer (buffer C from Dignam et al. (22), plus 100 nM okadaic acid, 100 nM phenylmethylsulfonyl fluoride, and 0.5 mM dithiothreitol). Cell debris was removed by brief centrifugation. Lysates (5 µl, approximately 7 µg of protein) were incubated in final volume of 20 µl containing binding buffer (final concentrations: 4% glycerol, 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM dithiothreitol, 50 mM NaCl, 10 mM Tris-HCl, pH 7.5), 100 ng of poly(dI-dC), and antisera or competitor DNA at room temperature for 10 min. Double-stranded, gamma -32P-labeled oligonucleotide was added to the reaction immediately following the above reagents. A preliminary time course demonstrated that protein:DNA interaction occurs instanteously. Therefore, 2 µl of 10 × gel loading dye was added immediately following the probe. The reactions were then applied to a 6% polyacrylamide gel. After electrophoresis in 0.25 mM Tris, 190 mM glycine, 1 mM EDTA running buffer, the gel was dried and complexes were visualized by autoradiography. The sequences of the oligonucleotide probes were as follows, with CREs underlined and mutations in bold.
<UP>Wild type mouse </UP>fos<UP>: TTCCGCCCAGTGACGTAGGAAGTCCAT</UP>
<UP>AAGGCGGGTC<UNL>ACTGCATC</UNL>CTTCAGGTA</UP>
Mut 1 mouse fos<UP>: TTCCGCCCAGTGA<B>A</B>GTAGGAAGTCCAT</UP>
<UP>AAGGCGGGTC</UP><UNL><UP>ACT<B>T</B>CATC</UP></UNL><UP>CTTCAGGTA</UP>
Mut 3 mouse fos<UP>: CCGCCCAGTG<B>CAT</B>TAGGAAGTCCATCC</UP>
<UP>GGCGGGTC</UP><UNL><UP>AC<B>GTA</B>ATC</UP></UNL><UP>CTTCAGGTAGG</UP>
<SC><UP>Sequences</UP></SC><UP> 1–3</UP>
The Primer Designer program was used to choose flanking sequences for the double-stranded oligonucleotides for mutagenesis.

Site-directed Mutagenesis

Mutant -356 fos CAT constructs were generated with the Chameleon double-stranded, site-directed mutagenesis kit (Stratagene) according to manufacturer's instructions. Mut 1 was created using a 20-mer mutagenesis oligonucleotide complementary to the major CRE-containing region with a single point mutation: 5'-TGGACTTC<UNL>CTAC<B>T</B>TCA</UNL>CTGG-3'. As above, the CRE is underlined and the substituted base in bold. Mut 3 was similarly developed with the following oligonucleotide: 5'-GGATGGACTTC<UNL>CTA<B>ATG</B>CA</UNL>CTGGGCGGAACTGG-3'. The selection primer (Stratagene) changed the AlwNI site to NruI.


RESULTS

PTH Increases Fos Protein Levels through a Mechanism That is Dependent on Time, PTH Concentration, and Intracellular cAMP

We have previously demonstrated that the c-fos gene transcription rate and steady state mRNA levels increase in UMR 106-01 cells after PTH treatment in a time- and dose-dependent manner (1). However, Fos protein is the final determinant in AP-1-mediated gene activation. To assess the time course of PTH-induced Fos accumulation, UMR 106-01 cells were treated for the indicated time periods with 10-8 M PTH (Fig. 1A). Fos protein levels were noticeably elevated after 30 min, becoming maximal by 60 min. The effect was transient with Fos returning to basal levels approximately 2 h after PTH treatment. Previously, work in our laboratory revealed that c-fos mRNA accumulation was dependent on PTH concentration (1). In order to determine whether Fos protein accumulated in the same PTH dose-dependent manner, UMR cells were treated with media containing the indicated PTH concentrations (Fig. 1B) and Fos protein levels measured. Fos protein accumulation was found to be PTH dose-dependent, with an increase first observed following 10-10 M PTH treatment for 1 h. Maximal stimulation was achieved with 10-8 M PTH treatment. This relationship is in agreement with that of c-fos mRNA accumulation.


Fig. 1. Characterization of PTH-induced Fos protein accumulation. UMR 106-01 cells were treated as indicated and subjected to Western blot analysis. All blots are representative of three independent experiments. A, UMR 106-01 cells were treated for the indicated time points with control- or PTH-containing (10-8 M) media. The left panel was detected with anti-Fos antibody (from Dr. Natalie Teich) and the right with preimmune rabbit serum. B, UMR 106-01 cells were treated with the indicated PTH concentration for 60 min. The left panel was detected with anti-Fos antibody (Santa Cruz) and the center panel with rabbit nonimmune IgG. The right panel had been treated with anti-Fos antibody, which was preadsorbed with the peptide against which it was raised. C, UMR 106-01 cells were treated with control medium (C), PTH (10-8 M), 8-Br-cAMP (5 × 10-3 M), or PMA (2.6 × 10-7 M) either individually or in the indicated combinations. The left panel was detected with anti-Fos antibody (Santa Cruz), the center panel with anti-Fos antibody that had been preadsorbed with the peptide against which it was raised, and the right panel with nonimmune rabbit IgG.
[View Larger Version of this Image (70K GIF file)]

PTH increases intracellular cAMP (23) and calcium (24) as well as phosphatidylinositol hydrolysis (25) in osteoblastic cells. In order to dissect the second messenger(s) responsible for PTH-induced Fos in this cell type, UMR cells were treated with PTH, 8-Br-cAMP, or PMA, either individually or combined, as indicated in Fig. 1C. All treatments caused an increase in Fos protein. Alone or combined, 8-Br-cAMP and PTH-induced Fos to the same extent, while PMA exceeded the maximal PTH response. We also noted that either PTH or 8-Br-cAMP combined with PMA resulted in a synergistic effect on Fos protein accumulation. However, the response is in excess of the maximal PTH-induced Fos level, indicating an alternate signaling mechanism. It should be noted that we have shown previously that activation of the protein kinase C pathway is not necessary for PTH stimulation of c-fos mRNA (1). We postulate that the synergism results from the combined effect of PKA- and protein kinase C-mediated phosphate addition to a transcription factor or factors.

Mouse c-fos Promoter Constructs Require the Major CRE-containing Region for PTH and 8-Br-cAMP-mediated Gene Expression

We have thus far made it clear that PTH increases Fos levels in UMR cells through a cAMP-dependent pathway. However, the mechanistic description is incomplete without mapping the minimal PTH-responsive region within the c-fos promoter region and identifying the cis- and trans-acting elements responsible for transcriptional activation. To this end, mouse c-fos promoter 5' deletion constructs -356, -151, -71, and -56 fos-CAT (Fig. 2A) (14, 15, 16) were transiently transfected into UMR cells. These constructs include several highly conserved regions, which respond to different agonists in other cell types. Upon PTH treatment, -356, -151, and -71 were stimulated 2.6-, 2.8-, and 4.6-fold, respectively (Fig. 2B). Conversely, -56 fos-CAT, which is deleted 3' to the main CRE was unaffected by PTH treatment. It is worth emphasizing that the shortest of the three CRE-containing constructs (-71 fos-CAT) gave the highest fold stimulation although basal expression sharply decreased (Fig. 2B, inset). However, there was no difference between PTH induction of -151 and -356 fos-CAT. Human c-fos promoter CAT constructs responded similarly to PTH when transfected into UMR cells (data not shown). PTH dose-response experiments showed that -71 fos-CAT displayed a PTH concentration dependence similar to the endogenous gene (Fig. 2C). Increased promoter activity was first detected following 10-10 M PTH treatment. Maximal stimulation was detected after 10-8 M PTH, and half-maximal response was calculated to occur with 5.5 × 10-10 M PTH.


Fig. 2. PTH activation of mouse c-fos-CAT 5' promoter deletion constructs. A, diagram of c-fos-CAT promoter 5' deletion constructs. All base pair positions are relative to the transcriptional start site, which is indicated by an arrow. Promoter regions are linked at position +109 to a CAT reporter gene. Regulatory elements are labeled and include a sis-inducible element (SIE), a serum response element (SRE), a Fos activator protein 1 site (FAP), a glucocorticoid response element (GRE), and several nonconsensus cAMP response elements (CRE). The major CRE is nearest the start site within the large box, while minor CREs are further upstream and distinguished by smaller boxes. Two minor CREs overlap the SRE and FAP sites. B, all constructs described in Fig. 2A were transiently transfected into UMR 106-01 cells and treated with or without PTH (10-8 M) for 24 h. Activity is expressed as fold stimulation. Basal activity is shown in the inset. C, UMR 106-01 cells were transiently transfected with -71 fos-CAT and treated with the indicated PTH concentrations. The results are shown as CAT activity. D, following transient transfection with -71 and -356 fos-CAT, cells were treated with control medium (C), PTH (10-8 M), 8-Br-cAMP (5 × 10-3 M), or PMA (2.6 × 10-7 M) either individually or in the indicated combinations. Basal activities in the control groups were 141 ± 32 and 1879 ± 503 pmol/h/mg of protein for the -71 and -356 fos-CAT constructs, respectively. All results are shown as -fold stimulation and represent the mean ± S.E. of four to six separate experiments.
[View Larger Version of this Image (36K GIF file)]

Elegant experiments utilizing mice that express a fos-lacZ fusion gene established that different combinations of regulatory elements interact to control c-fos in different systems (8). In order to determine if the same element and second messenger pathway activate -71 as do -356 fos-CAT, these constructs were transiently transfected into UMR 106-01 cells followed by treatment with PTH, 8-Br-cAMP, and PMA either alone or in combination (Fig. 2D). An identical pattern would signify that both constructs activate transcription through the same region. The response pattern was similar for both enhancer regions. Like the Fos protein measurements, the PTH effect was mimicked by 8-Br-cAMP with -71 fos-CAT producing the highest fold stimulation, although lowest basal expression. PTH in combination with 8-Br-cAMP activated both constructs to nearly the same extent as either agent alone, suggesting a common signaling pathway. While -356 fos-CAT was slightly responsive to PMA, this agent alone had no effect on -71 fos-CAT. However, analogous to Fos protein measurements, PMA, when combined with either PTH or 8-Br-cAMP, increased CAT activity synergistically. This synergism was not abolished by pretreating with either PMA or myristoylated protein kinase C inhibitor peptide, possibly due to the extended length of time that transfected cells must be treated with the agents (data not shown). However, as stated above, we have previously ruled out diacylglycerol-inducible protein kinase C as a participant in PTH-induced c-fos expression (1).

Point Mutations within the Major CRE Decrease Both Basal and PTH-induced c-fos Gene Expression

In order to more directly assess the impact of the c-fos major CRE, a single point mutation was created in this element within -356 fos-CAT. Shown as Mut 1 in Fig. 3A, this base pair change has been shown previously to inhibit CREB interaction with a consensus CRE (26). The point mutation resulted in near abolition of the PTH effect on the promoter (from 3.2- to 1.7-fold) (Fig. 3B). However, with a single point mutation, we speculated that the remaining PTH-induced activity could be mediated through residual protein:CRE interaction. We therefore substituted 3 bases within the major CRE of -356 fos-CAT, hence creating Mut 3. As with Mut 1, Mut 3 transfection into UMR 106-01 cells reduced fold stimulation in response to PTH to 1.7-fold. However, this mutation drastically reduced basal expression (Fig. 3B, inset). Mut 3 had lower basal activity than Mut 1, illustrating that the more bases altered the less basal activity remains.


Fig. 3. PTH activation of -356 fos-CAT with mutations in the major CRE. A, schematic diagram of mutant constructs. All components are as depicted in Fig. 2A except for mutations in the major CRE. B, wild type and mutant constructs were transfected into UMR 106-01 cells and treated with PTH (10-8 M). Basal activity is shown (inset). Values represent the mean ± S.E. of three separate experiments.
[View Larger Version of this Image (20K GIF file)]

CREB Constitutively Binds the c-fos Major CRE but Becomes Phosphorylated at the Protein Kinase A Consensus Site upon PTH Treatment

Having defined the major CRE as necessary for PTH-stimulated c-fos activation, gel retardation techniques were employed to assess the interaction of proteins from UMR 106-01 cells at this site. Proteins in cell lysates from both control and PTH-treated cells bound the mouse major CRE (TGACGTAG), creating an identical shift pattern (Fig. 4). Titration with cold probe demonstrated that a 5-fold molar excess efficiently competed for all protein-DNA complexes, while 25-fold excess oligonucleotide containing a CTF/NF1 element did not. This titration also revealed that the lower shifted band is less efficiently competed for by cold probe, indicating a lower relative affinity than the upper bands. Other experiments revealed that other non-CRE elements (AP-1, GRE, SP-1) were unable to compete (data not shown) for binding.


Fig. 4. PTH effect on UMR 106-01 cell protein binding to the mouse major CRE. UMR 106-01 cells were treated with control medium (C) or PTH (10-8 M) for 20 min and a cell lysate prepared. Protein binding to a double-stranded 27-mer oligonucleotide, which included the c-fos major CRE, was assessed by gel mobility shift analysis. Three separate experiments were performed with similar results. The fold excess of unlabeled oligonucleotides included in the binding reaction is indicated.
[View Larger Version of this Image (59K GIF file)]

The unaltered shift pattern following PTH treatment is in agreement with current thinking that CREB binds to the consensus CRE with equal affinity regardless of its phosphorylation state but activates transcription only when phosphorylated (27, 28). To determine if our system fits this model, we included an antibody that interacts with CREB only if the latter is phosphorylated at Ser133 within the PKA consensus phosphorylation site. This antibody supershifted the upper bands only when protein was derived from PTH-treated cells (Fig. 5A). A nondiscriminating anti-CREB antibody supershifted these bands independent of PTH treatment (data not shown). Likewise, phosphorylation without change in CREB protein abundance was confirmed by Western blot. In this experiment, PTH did not alter the total CREB signal as visualized with CREB antibody while phosphoCREB was detected only in PTH-treated cells (Fig. 5B). The band running below the CREB containing complex in gel shift experiments appears to be ATF-1 since it was abolished by antibody to ATF-1. c-Jun antibody had no effect on any protein-DNA complex.


Fig. 5. PTH effect on CREB phosphorylation. A, protein from control- and PTH (10-8 M)-treated UMR cells was subjected to gel mobility shift analysis using mouse c-fos major CRE-containing oligonucleotide probe. Antibodies against phosphorylated CREB (P-CREB), ATF-1, and c-Jun were included in the indicated reactions. B, UMR 106-01 cells were treated with control medium (C) or PTH (10-8 M) for 20 min, a cell lysate prepared, and subjected to Western blot analysis. The panel on the left was detected with anti-phosphoCREB antibody, the middle panel with anti-CREB antibody, and the right panel with nonimmune rabbit IgG. Results are representative of three separate experiments.
[View Larger Version of this Image (73K GIF file)]

During the course of this study, the rat c-fos promoter region was published (11) and shown to be very similar to the human and mouse promoters. Rat c-fos bears the same nonconsensus major CRE as mouse but with different flanking sequences. Because UMR 106-01 cells are rat-derived, we assayed UMR 106-01 proteins binding to rat fos CRE in its native context. Similar to the mouse sequence, this element bound protein from both control- and PTH-treated UMR 106-01 cells equally, creating a shifted complex that could be supershifted by CREB antibody (data not shown).

Gel mobility shift experiments, which included a mutant CRE-containing oligonucleotide probe, confirmed the loss of CREB-containing bands (Fig. 6). The mutations were those incorporated into Mut 1 and Mut 3. This experiment confirmed our speculation that a single point mutation within the major CRE allows residual protein binding as determined by overexposing the film (data not shown). Residual CREB interaction with the mutant CREs was inversely proportional to basal expression of Mut 1 and Mut 3 constructs. Conversely, ATF-1 binding was not altered.


Fig. 6. UMR 106-01 cell protein binding to mutant c-fos major CREs. UMR 106-01 cells were treated with control medium (C) or PTH (10-8 M) for 20 min. Cells were lysed and the soluble proteins subjected to gel mobility shift analysis. Probes consist of 27-mer oligonucleotides containing wild type mouse CRE or the mutant CREs, which were incorporated into the constructs described above. Three separate experiments were performed with similar results.
[View Larger Version of this Image (65K GIF file)]

The Dominant CREB Inhibitor KCREB Suppresses PTH Induction of Mouse c-fos-CAT Constructs

KCREB (killer CREB) is a dominant inhibitor of CREB function (17). The protein product has an amino acid substitution within the leucine zipper, which results in KCREB-CREB heterodimers with no DNA binding function. We cotransfected a KCREB expression plasmid along with the mouse fos-CAT constructs into UMR 106-01 cells and treated the cells with control- or PTH-containing media. KCREB inhibited PTH-mediated activation of both -71 and -356 fos-CAT promoter constructs by 60% (Fig. 7). Conversely, expression of -56 fos-CAT, which lacks the major CRE as well as PTH responsiveness, was unaffected by KCREB (data not shown).


Fig. 7. The effect of the dominant inhibitor, KCREB, on PTH activation of the c-fos promoter constructs. KCREB (5 µg) or equimolar vector was cotransfected with the indicated c-fos-CAT construct (5 µg) and treated with control medium or PTH (10-8 M). All plates were normalized with respect to total DNA mass transfected by the addition of pBluescript DNA. Values represent the mean ± S.E. of three separate experiments. Basal activity is shown (inset). *, statistically significant compared to the same construct without KCREB by one-tailed paired t test (-71 fosCAT, p = 0.0293; -356 fosCAT p = 0.0035)
[View Larger Version of this Image (20K GIF file)]


DISCUSSION

The data presented in this work identify three steps in the mechanism through which PTH induces c-fos gene expression in osteoblastic cells. (i) PTH induces c-fos expression using cAMP as a second messenger. (ii) Activated PKA catalytic subunit phosphorylates CREB at Ser133 within the P-box. (iii) Phosphorylated CREB bound to the major CRE in the c-fos 5' regulatory region results in transcriptional activation.

Despite causing increased intracellular calcium and phosphoinositide turnover, PTH induces many osteoblastic responses through cAMP-dependent mechanisms (3). Accordingly, our observation that a cAMP analog mimics the effect of PTH on both c-fos promoter activation and Fos protein accumulation is in agreement with this pattern. In addition, failure of maximal concentrations of 8-Br-cAMP and PTH in combination to significantly increase their effect on c-fos further supports this interpretation. This is because each agent maximally activates the same pathway making additional c-fos expression through this mechanism impossible. Although PMA induced Fos protein both alone and combined with PTH or 8-Br-cAMP, the response was always in excess of the maximal PTH induction. This point, coupled with convincing experiments performed by Clohisy et al. (1), refutes any protein kinase-C involvement in the PTH-induced transduction of c-fos. Therefore, all available evidence identifies cAMP as the major functional second messenger in this and many other PTH-mediated responses in osteoblasts.

We have previously defined PTH-induced c-fos expression as a primary response (1). De novo synthesized transcriptional activators are, by definition, not participants in this mechanism. Therefore, post-translational modification must be involved. Partridge et al. (29) have demonstrated PKA activation in response to PTH. These findings combined with the current data are in agreement with the classical CREB-mediated pathway. Specifically, constitutively expressed CREB is phosphorylated at Ser133 by PKA. CREB is then activated, and as a dimer bound to a CRE, can activate gene transcription (for review, see Ref. 30). Our observations that CREB is necessary for the full PTH response coupled with PTH-induced PKA activity and CREB phosphorylation at the PKA consensus site are in complete support of this mechanism. It should be noted that Ca2+/calmodulin-dependent protein kinases types II and IV have also been shown to phosphorylate CREB at Ser133. However, we have clearly eliminated calcium involvement in induction of c-fos by PTH (1).

While Ser133 phosphorylation is required for CREB activity, additional kinases may also participate in CREB activation (28). Accordingly, PKA-mediated phosphorylation is required to create a casein kinase II consensus site, which, upon phosphorylation, activates CREB in vitro (31). The latter and similar observations involving other kinases have resulted in a hierarchical phosphorylation model (32). This states that, although CREB remains inactive without phosphorylation at the PKA site, the differential action of kinases on additional residues is required for its full activation and allows for cell-specific regulation. In this mechanism, Ser133 phosphorylation may cause a conformational change in the CREB protein, making other phosphorylated residues available for protein-protein interaction or exposing other residues to kinases. Work is currently in progress to identify any additional phosphorylation events that may be part of the PTH-mediated signal transduction pathway in osteoblasts. In fact, we postulate that this mechanism causes the synergism that we observed between PMA and 8-Br-cAMP.

Proteins other than CREB are able to interact with the CRE sequence. However, this report clearly establishes CREB as one, if not the only, of these factors active and required at the c-fos major CRE. Gel shift assays combined with transfected fos-CAT constructs containing mutant CREs provide the most direct proof. Although ATF-1 interaction with the major CRE was visualized by gel mobility shift, we reject this factor as a candidate for four reasons. (i) ATF-1 binding was not altered by CRE mutations that inhibited PTH induction of -356 c-fos-CAT. (ii) Although the P-CREB antibody cross-reacts with a homologous site on ATF-1, we did not see ATF-1 phosphorylation. (iii) ATF-1 bound the major CRE with a lower affinity than CREB. (iv) No CREB-ATF-1 dimers bound to the major CRE.

CREB activity at the major CRE is in agreement with earlier c-fos promoter characterization, which assigns most of the cAMP-mediated c-fos induction to this element (12). Similar responses of -71 and -356 fos-CAT refute the possibility of other PTH responsive elements 5' to the major CRE. Basal activity accompanying induced promoter activation is also characteristic of the CRE. For example, CREB has been shown to enhance both basal and glucocorticoid-induced phosphoenolpyruvate carboxykinase gene expression through a 5' CRE (33).

In summary, we demonstrate that PTH induces c-fos transcription primarily through the cAMP/PKA pathway. This event requires that CREB becomes phosphorylated by PKA at Ser133 and acts at the major CRE within the c-fos promoter region. This is the first demonstration that PTH induces gene transcription through phosphorylation of a constitutively expressed transcription factor and completes the signaling pathway from the cell membrane to the nucleus.


FOOTNOTES

*   This work was supported in part by National Institutes of Health Grants AR39743, DK47420, and DK48109 (to N. C. P). The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    To whom correspondence should be addressed: Dept. of Pharmacological and Physiological Science, St. Louis University School of Medicine, 1402 S. Grand Blvd., St. Louis, MO 63104. Tel.: 314-577-8239; Fax: 314-577-8233; E-mail: partrinc{at}sluvca.slu.edu.
1   The abbreviations used are: PTH, parathyroid hormone; ATF, activating transcription factor; AP-1, activator protein-1; CRE, cyclic AMP response element; CREB, CRE-binding protein; CAT, chloramphenicol acetyltransferase; PMA, phorbol 12-myristate 13-acetate; CTF/NF1, CAAT transcription factor/nuclear factor-1; PKA, cAMP-dependent protein kinase; PBS, phosphate-buffered saline; 8-Br-cAMP, 8-bromo-cAMP.

REFERENCES

  1. Clohisy, J. C., Scott, D. K., Brakenhoff, K. D., Quinn, C. O., Partridge, N. C. (1992) Mol. Endocrinol. 6, 1834-1842 [Abstract/Free Full Text]
  2. Noda, M., Rodan, G. A. (1989) J. Cell Biol. 108, 713-718 [Abstract/Free Full Text]
  3. Scott, D. K., Brakenhoff, K. D., Clohisy, J. C., Quinn, C. O., Partridge, N. C. (1992) Mol. Endocrinol. 6, 2153-2159 [Abstract/Free Full Text]
  4. Curran, T., Teich, N. M. (1982) J. Virol. 42, 114-122 [Abstract/Free Full Text]
  5. Gack, S., Vallon, R., Schaper, J., Ruther, U., Angel, P. (1994) J. Biol. Chem. 269, 10363-10369 [Abstract/Free Full Text]
  6. Rüther, U., Garber, C., Komitowski, D., Miller, R., Wagner, E. F. (1987) Nature 325, 412-416 [CrossRef][Medline] [Order article via Infotrieve]
  7. Grigoriadis, A. E., Wang, Z. Q., Cecchini, M. G., Hofstetter, W., Felix, R., Fleisch, H. A., Wagner, E. F. (1994) Science 266, 443-448 [Abstract/Free Full Text]
  8. Robertson, L., Kerpolla, T. K., Vendrell, M., Luk, D., Smeyne, R. J., Bocchiaro, C., Morgan, J. I., Curran, T. (1995) Neuron 14, 241-252 [CrossRef][Medline] [Order article via Infotrieve]
  9. Hoyland, J., Sharpe, P. T. (1994) J. Bone Miner. Res. 9, 1191-1194 [Medline] [Order article via Infotrieve]
  10. Wu, J.-X., Carpenter, J. M., Gresens, C., Keh, R., Niman, H., Morris, J. W. S., Mercola, P. (1990) Oncogene 59, 89-1000
  11. Wang, W. W., Howells, R. D. (1994) Gene (Amst.) 143, 261-264 [CrossRef][Medline] [Order article via Infotrieve]
  12. Berkowitz, L. A., Riabowol, K. T., Gilman, M. Z. (1989) Mol. Cell. Biol. 9, 4272-4281 [Abstract/Free Full Text]
  13. Waeber, G., Meyer, T. E., LeSieur, M., Herman, H. L., Gerard, N., Habener, J. F. (1991) Mol. Endocrinol. 5, 1418-1430 [Abstract/Free Full Text]
  14. Gilman, M. Z., Wilson, R. N., Weinberg, R. A. (1986) Mol. Cell. Biol. 6, 4305-4316 [Abstract/Free Full Text]
  15. Gilman, M. (1988) Genes Dev. 2, 394-402 [Abstract/Free Full Text]
  16. Graham, R., Gilman, M. (1991) Science 251, 189-192 [Abstract/Free Full Text]
  17. Walton, K. M., Rehfuss, R. P., Chrivia, J. C., Lochner, J. E., Goodman, R. H. (1992) Mol. Endocrinol. 6, 647-655 [Abstract/Free Full Text]
  18. Omura, T. H., Noguchi, A., Johanns, C. A., Jeffrey, J. J., Partridge, N. C. (1994) J. Biol. Chem. 269, 24994-24998 [Abstract/Free Full Text]
  19. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254 [CrossRef][Medline] [Order article via Infotrieve]
  20. Rosenthal, N. (1987) Methods Enzymol. 152, 704-720 [Medline] [Order article via Infotrieve]
  21. Seed, B., Sheen, J.-Y. (1988) Gene (Amst.) 67, 271-277 [CrossRef][Medline] [Order article via Infotrieve]
  22. Dignam, J. D., Lebovitz, R. M., Roeder, R. G. (1983) Nucleic Acids Res. 11, 1475-1488 [Abstract/Free Full Text]
  23. Chase, L. R., Aurbach, G. D. (1970) J. Biol. Chem. 245, 1520-1526 [Abstract/Free Full Text]
  24. Reid, I. R., Civitelli, R., Halstead, L. R., Avioli, L. V., Hruska, K. A. (1987) Am. J. Physiol. 253, E45-E51 [Abstract/Free Full Text]
  25. Civitelli, R., Reid, R. I., Westbrook, S., Avioli, L. V., Hruska, K. A. (1988) Am. J. Physiol. 225, E660-E667
  26. Andrisani, O., Pot, D. A., Zhu, Z., Dixon, J. E. (1988) Mol. Cell. Biol. 8, 1947-1956 [Abstract/Free Full Text]
  27. Yamamoto, K. K., Gonzalez, G. A., Biggs, W. H., Montminy, M. R. (1988) Nature 334, 494-498 [CrossRef][Medline] [Order article via Infotrieve]
  28. Lee, C. Q., Yun, Y., Hoeffler, J. P., Habener, J. F. (1990) EMBO J. 9, 4455-4465 [Medline] [Order article via Infotrieve]
  29. Partridge, N. C., Kemp, B. E., Veroni, M. C., Martin, T. J. (1981) Endocrinology 108, 220-225 [Abstract/Free Full Text]
  30. Meyer, T. E., Habener, J. F. (1993) Endocrine Rev. 12, 269-290
  31. Fiol, C. J., Williams, J. S., Chou, C.-H., Wang, Q. M., Roach, P. J., Andrisani, O. M. (1994) J. Biol. Chem. 269, 32187-32193 [Abstract/Free Full Text]
  32. Roach, P. J. (1991) J. Biol. Chem. 266, 14139-14142 [Abstract/Free Full Text]
  33. Xing, L., Quinn, P. G. (1993) Mol. Endocrinol. 7, 1484-1494 [Abstract/Free Full Text]

©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Y. Wu, L. E. Purton, S. J. Rodda, M. Chen, L. S. Weinstein, A. P. McMahon, D. T. Scadden, and H. M. Kronenberg
Osteoblastic regulation of B lymphopoiesis is mediated by Gs{alpha}-dependent signaling pathways
PNAS, November 4, 2008; 105(44): 16976 - 16981.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Shimada, P. A. Greer, A. P. McMahon, M. L. Bouxsein, and E. Schipani
In Vivo Targeted Deletion of Calpain Small Subunit, Capn4, in Cells of the Osteoblast Lineage Impairs Cell Proliferation, Differentiation, and Bone Formation
J. Biol. Chem., July 25, 2008; 283(30): 21002 - 21010.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Yu, R. T. Franceschi, M. Luo, X. Zhang, D. Jiang, Y. Lai, Y. Jiang, J. Zhang, and G. Xiao
Parathyroid Hormone Increases Activating Transcription Factor 4 Expression and Activity in Osteoblasts: Requirement for Osteocalcin Gene Expression
Endocrinology, April 1, 2008; 149(4): 1960 - 1968.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. J. Raggatt, L. Qin, J. Tamasi, S. C. Jefcoat Jr., E. Shimizu, N. Selvamurugan, F. Y. Liew, L. Bevelock, J. H. M. Feyen, and N. C. Partridge
Interleukin-18 Is Regulated by Parathyroid Hormone and Is Required for Its Bone Anabolic Actions
J. Biol. Chem., March 14, 2008; 283(11): 6790 - 6798.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
D. Merciris, C. Marty, C. Collet, M.-C. de Vernejoul, and V. Geoffroy
Overexpression of the Transcriptional Factor Runx2 in Osteoblasts Abolishes the Anabolic Effect of Parathyroid Hormone in Vivo
Am. J. Pathol., May 1, 2007; 170(5): 1676 - 1685.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Chen, J.-C. Dai, S. A. Orellana, and E. M. Greenfield
Endogenous Protein Kinase Inhibitor {gamma} Terminates Immediate-early Gene Expression Induced by cAMP-dependent Protein Kinase (PKA) Signaling: TERMINATION DEPENDS ON PKA INACTIVATION RATHER THAN PKA EXPORT FROM THE NUCLEUS
J. Biol. Chem., January 28, 2005; 280(4): 2700 - 2707.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
X. Xu, W. Zhang, and B. C. Kone
CREB trans-activates the murine H+-K+-ATPase {alpha}2-subunit gene
Am J Physiol Cell Physiol, October 1, 2004; 287(4): C903 - C911.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Chen, A. J. Koh, N. S. Datta, J. Zhang, E. T. Keller, G. Xiao, R. T. Franceschi, N. J. D'Silva, and L. K. McCauley
Impact of the Mitogen-activated Protein Kinase Pathway on Parathyroid Hormone-related Protein Actions in Osteoblasts
J. Biol. Chem., July 9, 2004; 279(28): 29121 - 29129.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Jiang, R. T. Franceschi, H. Boules, and G. Xiao
Parathyroid Hormone Induction of the Osteocalcin Gene: REQUIREMENT FOR AN OSTEOBLAST-SPECIFIC ELEMENT 1 SEQUENCE IN THE PROMOTER AND INVOLVEMENT OF MULTIPLE SIGNALING PATHWAYS
J. Biol. Chem., February 13, 2004; 279(7): 5329 - 5337.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Sowa, H. Kaji, M. F. Iu, T. Tsukamoto, T. Sugimoto, and K. Chihara
Parathyroid Hormone-Smad3 Axis Exerts Anti-apoptotic Action and Augments Anabolic Action of Transforming Growth Factor {beta} in Osteoblasts
J. Biol. Chem., December 26, 2003; 278(52): 52240 - 52252.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Samoto, E. Shimizu, Y. Matsuda-Honjyo, R. Saito, S. Nakao, M. Yamazaki, S. Furuyama, H. Sugiya, J. Sodek, and Y. Ogata
Prostaglandin E2 Stimulates Bone Sialoprotein (BSP) Expression through cAMP and Fibroblast Growth Factor 2 Response Elements in the Proximal Promoter of the Rat BSP Gene
J. Biol. Chem., August 1, 2003; 278(31): 28659 - 28667.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q. Fu, R. L. Jilka, S. C. Manolagas, and C. A. O'Brien
Parathyroid Hormone Stimulates Receptor Activator of NFkappa B Ligand and Inhibits Osteoprotegerin Expression via Protein Kinase A Activation of cAMP-response Element-binding Protein
J. Biol. Chem., December 6, 2002; 277(50): 48868 - 48875.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
X. Chen, J.-C. Dai, and E. M. Greenfield
Termination of immediate-early gene expression after stimulation by parathyroid hormone or isoproterenol
Am J Physiol Cell Physiol, November 1, 2002; 283(5): C1432 - C1440.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-L. Chen, B. Demiralp, A. Schneider, A. J. Koh, C. Silve, C.-Y. Wang, and L. K. McCauley
Parathyroid Hormone and Parathyroid Hormone-related Protein Exert Both Pro- and Anti-apoptotic Effects in Mesenchymal Cells
J. Biol. Chem., May 24, 2002; 277(22): 19374 - 19381.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. R. Tyson, J. T. Swarthout, S. C. Jefcoat, and N. C. Partridge
PTH Induction of Transcriptional Activity of the cAMP Response Element-Binding Protein Requires the Serine 129 Site and Glycogen Synthase Kinase-3 Activity, But Not Casein Kinase II Sites
Endocrinology, February 1, 2002; 143(2): 674 - 682.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
L. Thommesen, E. Hofsli, R. H. Paulssen, M. W. Anthonsen, and A. Lagreid
Molecular mechanisms involved in gastrin-mediated regulation of cAMP-responsive promoter elements
Am J Physiol Endocrinol Metab, December 1, 2001; 281(6): E1316 - E1325.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Mestas and C. C. W. Hughes
Endothelial Cell Costimulation of T Cell Activation Through CD58-CD2 Interactions Involves Lipid Raft Aggregation
J. Immunol., October 15, 2001; 167(8): 4378 - 4385.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
R. Shenkar, H.-K. Yum, J. Arcaroli, J. Kupfner, and E. Abraham
Interactions between CBP, NF-{kappa}B, and CREB in the lungs after hemorrhage and endotoxemia
Am J Physiol Lung Cell Mol Physiol, August 1, 2001; 281(2): L418 - L426.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. K. Mccauley, A. J. Koh-Paige, H. Chen, C. Chen, C. Ontiveros, R. Irwin, and L. R. Mccabe
Parathyroid Hormone Stimulates fra-2 Expression in Osteoblastic Cells in Vitro and in Vivo
Endocrinology, May 1, 2001; 142(5): 1975 - 1981.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
S. Tetradis, O. Bezouglaia, and A. Tsingotjidou
Parathyroid Hormone Induces Expression of the Nuclear Orphan Receptor Nurr1 in Bone Cells
Endocrinology, February 1, 2001; 142(2): 663 - 670.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
W.-X. Gu, P. H. Stern, L. D. Madison, and G.-G. Du
Mutual Up-Regulation of Thyroid Hormone and Parathyroid Hormone Receptors in Rat Osteoblastic Osteosarcoma 17/2.8 Cells
Endocrinology, January 1, 2001; 142(1): 157 - 164.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Selvamurugan, M. R. Pulumati, D. R. Tyson, and N. C. Partridge
Parathyroid Hormone Regulation of the Rat Collagenase-3 Promoter by Protein Kinase A-dependent Transactivation of Core Binding Factor alpha 1
J. Biol. Chem., February 18, 2000; 275(7): 5037 - 5042.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
D. Thomas, A Sunters, A Gentry, and A. Grigoriadis
Inhibition of chondrocyte differentiation in vitro by constitutive and inducible overexpression of the c-fos proto-oncogene
J. Cell Sci., January 2, 2000; 113(3): 439 - 450.
[Abstract] [PDF]


Home page
J Biomol ScreenHome page
S. E. Hahn, M. Yu, S. Tong, A. A.T. Geisterfer-Lowrance, D. Sindrey, and D. K.H. Lee
Development of an In Vitro Screening Assay for Compounds that Increase Bone Formation
J Biomol Screen, December 1, 1999; 4(6): 363 - 371.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
N. Franchimont, D. Durant, S. Rydziel, and E. Canalis
Platelet-derived Growth Factor Induces Interleukin-6 Transcription in Osteoblasts through the Activator Protein-1 Complex and Activating Transcription Factor-2
J. Biol. Chem., March 5, 1999; 274(10): 6783 - 6789.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. R. Tyson, J. T. Swarthout, and N. C. Partridge
Increased Osteoblastic c-fos Expression by Parathyroid Hormone Requires Protein Kinase A Phosphorylation of the Cyclic Adenosine 3',5'-Monophosphate Response Element-Binding Protein at Serine 133
Endocrinology, March 1, 1999; 140(3): 1255 - 1261.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
H. J. Armbrecht, T. L. Hodam, M. A. Boltz, N. C. Partridge, A. J. Brown, and V. B. Kumar
Induction of the Vitamin D 24-Hydroxylase (CYP24) by 1,25-Dihydroxyvitamin D3 Is Regulated by Parathyroid Hormone in UMR106 Osteoblastic Cells
Endocrinology, August 1, 1998; 139(8): 3375 - 3381.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Selvamurugan, W.-Y. Chou, A. T. Pearman, M. R. Pulumati, and N. C. Partridge
Parathyroid Hormone Regulates the Rat Collagenase-3 Promoter in Osteoblastic Cells through the Cooperative Interaction of the Activator Protein-1 Site and the runt Domain Binding Sequence
J. Biol. Chem., April 24, 1998; 273(17): 10647 - 10657.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Tintut, F. Parhami, K. Bostrom, S. M. Jackson, and L. L. Demer
cAMP Stimulates Osteoblast-like Differentiation of Calcifying Vascular Cells. POTENTIAL SIGNALING PATHWAY FOR VASCULAR CALCIFICATION
J. Biol. Chem., March 27, 1998; 273(13): 7547 - 7553.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. K. McCauley, A. J. Koh, C. A. Beecher, and T. J. Rosol
Proto-Oncogene c-fos Is Transcriptionally Regulated by Parathyroid Hormone (PTH) and PTH-Related Protein in a Cyclic Adenosine Monophosphate-Dependent Manner in Osteoblastic Cells
Endocrinology, December 1, 1997; 138(12): 5427 - 5433.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Tetradis, C. C. Pilbeam, Y. Liu, H. R. Herschman, and B. E. Kream
Parathyroid Hormone Increases Prostaglandin G/H Synthase-2 Transcription by a Cyclic Adenosine 3',5'-Monophosphate-Mediated Pathway in Murine Osteoblastic MC3T3-E1 Cells
Endocrinology, September 1, 1997; 138(9): 3594 - 3600.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Bernal-Mizrachi, B. Wice, H. Inoue, and M. A. Permutt
Activation of Serum Response Factor in the Depolarization Induction of Egr-1 Transcription in Pancreatic Islet beta -Cells
J. Biol. Chem., August 11, 2000; 275(33): 25681 - 25689.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. M. Ionescu, E. M. Schwarz, C. Vinson, J. E. Puzas, R. Rosier, P. R. Reynolds, and R. J. O'Keefe
PTHrP Modulates Chondrocyte Differentiation through AP-1 and CREB Signaling
J. Biol. Chem., April 6, 2001; 276(15): 11639 - 11647.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pearman, A. T.
Right arrow Articles by Partridge, N. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pearman, A. T.
Right arrow Articles by Partridge, N. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1996 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement