![]()
|
|
||||||||
(Received for publication, June 13, 1996, and in revised form, August 7, 1996)
From the Department of Microbiology and Molecular Genetics, College
of Medicine, University of California, Irvine, California 92697
The leucine-responsive regulatory protein (Lrp)
regulates the expression of many operons in Escherichia coli
including several involved in the metabolism of the
branched-chain amino acids, L-isoleucine,
L-valine, and L-leucine. The ilvGMEDA
operon contains the genes for four of the five enzymes of the
common pathway for the biosynthesis of these amino acids. A high
affinity, consensus-like Lrp-DNA binding site has been identified at an
unusual position in the leader region of this operon 226 base pairs
downstream of the transcriptional initiation site between the
attenuator and the ilvG gene. Binding to this site
facilitates the cooperative binding of a second Lrp protomer to an
adjacent, upstream, secondary site. At higher Lrp concentrations,
binding to a third site is observed. Chemical, enzymatic, and
alkylation protection and interference footprinting experiments
demonstrate that the Lrp homodimer contacts the DNA helix at
symmetrical half-sites present in adjacent major grooves and that the
primary and secondary binding sites are separated by one helical turn
and aligned along the same face of the DNA helix. In vivo,
Lrp represses transcription through the leader-attenuator region
of the ilvGMEDA operon. Lrp-dependent
production of attenuated RNA transcripts is also observed in
vitro. No transcriptional effects are observed, in vivo
or in vitro, in the absence of an intact Lrp primary
binding site. A possible physiological role for Lrp in the regulation
of ilvGMEDA operon expression is discussed.
The leucine-responsive regulatory protein,
Lrp,1 is a global regulatory protein of
Escherichia coli that affects the expression of many operons
(reviewed in Refs. 1 and 2). The expression of some target operons is
activated by Lrp, while the expression of others is repressed. In
addition, the free amino acid, L-leucine, acts as an
effector ligand of Lrp; and, at some DNA target sites,
L-leucine is required for Lrp binding. At other sites,
L-leucine can antagonize or have no effect on Lrp-DNA
interactions. In most cases, the physiological role of Lrp is to
activate biosynthetic operons and to repress degradative ones.
Therefore, it has been suggested that Lrp and L-leucine
might function to coordinate metabolic shifts between nutritional feast
and famine conditions. However, the metabolic coherence of the operons
regulated by Lrp remains unclear.
The structural gene for Lrp was initially identified as a mutation in a
regulatory gene, livR, for the branched-chain amino acid
(L-leucine, L-isoleucine, and
L-valine) transport system (3). Subsequently, additional
mutations in this gene that affected the biosynthesis of
L-leucine were identified (4). Further studies showed that
the protein product of this gene (now referred to as lrp)
activates transcription of the ilvIH operon, which encodes
one of the three acetohydroxy acid synthase (AHAS) isozymes required
for the first step in the biosynthesis of the three branched-chain
amino acids (4). Interestingly, many of the other operons regulated by
Lrp are involved in either the production or the dissimilation of the
carbon substrates, pyruvate and
In E. coli, the biosynthesis of the branched-chain amino
acids occurs via a parallel pathway catalyzed by several bifunctional
enzymes (Fig. 1) (9). The genes encoding these enzymes are specified by
four separate operons (ilvBN, ilvGMEDA, ilvYC, and
ilvIH). The ilvBN and ilvIH operons
encode the genes for the subunits of the AHAS I and AHAS III isozymes,
respectively (10). The ilvGMEDA operon encodes four of the
five enzymes required for the biosynthesis of L-isoleucine
and L-valine (11). The ilvGM genes encode the
subunits of AHAS I, while the remaining genes encode two other enzymes
of the common pathway, dihydroxy-acid dehydratase (ilvD) and
transaminase B (ilvE), and one enzyme specific to the
biosynthesis of L-isoleucine, L-threonine
deaminase (ilvA). The In this report, we show that Lrp does, in fact, bind to a high
affinity, consensus-like site located between the attenuator and the
first structural gene of the ilvGMEDA operon. We further
report the biochemical characterization of the Lrp-DNA interactions at
this target site and its in vitro and in vivo
effects on the expression of this operon. A possible physiological role
for Lrp in the regulation of branched-chain amino acid metabolism is
discussed.
All chemical reagents were purchased
from Sigma. Restriction endonucleases, T4 DNA ligase,
and T4 polynucleotide kinase were purchased from New England Biolabs.
E. coli RNA polymerase, pancreatic RNasin, and DNase I were
purchased from Boehringer Mannheim Biochemicals. Shrimp alkaline
phosphatase was purchased from U. S. Biochemical Corp. Radiolabeled
nucleotides were purchased from DuPont NEN. DNA oligonucleotides were
synthesized by Operon Technologies. Site-directed mutagenesis was
performed using the oligonucleotide-directed in vitro
mutagenesis kit, version 2.0, from Amersham Corp. DNA sequencing was
performed using the Sequenase kit from U. S. Biochemical Corp. The Lrp
used in the experiments reported here is a 6-His-tagged derivative of
Lrp containing 12 extra amino acids at the NH2 terminus and
was purified to near homogeneity in this laboratory according to the
methods of Cui et al. (12). Protein concentrations were
measured according to the methods of Bradford (13) using the Bio-Rad DC
Protein Assay Kit.
Plasmid DNA isolation and
all recombinant DNA manipulations were carried out by standard methods
(14). Plasmids pUCR1TQ and pIS2 were used to generate the DNA fragments
(containing ilvGMEDA sequence from base pair position +6
+278 or ilvGMEDA sequence from bp 110-278, respectively)
used in the binding and chemical footprinting experiments described
below. Plasmid pUCR1TQ was constructed by subcloning a 288-bp
EcoRI-TaqI restriction fragment derived from the
vector pJP16 (15) into the the EcoRI and AccI
restriction sites of pUC19. Plasmid pIS2 was created by cloning a
polymerase chain reaction-amplified DNA fragment (containing
ilvGMEDA sequence from base pair positions 110-278, flanked
by HindIII and BamHI restriction endonuclease
sites, respectively) into the HindIII and BamHI
sites of pUC19. Plasmid pDHWT, used for the in vitro
transcription reactions, was constructed by ligating an end-filled
515-bp EcoRI-BamHI DNA fragment containing a
494-bp ilvGMEDA-derived HinfI fragment (base pair
position Gel retardation assays were performed as
described by Wang and Calvo (21). Radiolabeled DNA fragments used in
these experiments were present at a final concentration of 1 × 10 DNase I footprinting
reactions were performed as described by Wang and Calvo (25) using
uniquely 5 Hydroxyl radical
footprinting was performed as described by Tullius and Dombroski (27)
using the same DNA fragments (<1 × 10 DMS protection experiments were
performed essentially as described by Siebenlist and Gilbert (28) and
Winkelman and Hatfield (29). Lrp-DNA binding reactions were performed
under equilibrium binding conditions, using uniquely
5 DMS interference assays were
performed according to the methods of Wissmann and Hillen (30). The
5 In vitro
transcription reactions were performed using the closed-circular
supercoiled plasmid pDHWT (described above), in the absence and
presence of purified Lrp, according to the procedures of Hauser et al.
(32). RNA polymerase-plasmid DNA complexes were formed by preincubating
0.1 unit (0.24 pmol) of RNA polymerase and 100 ng of plasmid DNA (0.16 pmol) in a 20-µl reaction mixture (0.04 M Tris-HCl (pH
8.0), 0.1 M KCl, 0.01 M MgCl2, 1.0 mM dithiothreitol, 0.1 mM EDTA, 200 µM CTP, 20 µM UTP, 10 µCi of
[ Cells were grown in logarithmic
phase to a culture density of 0.5-0.7 A600
units in M63 minimal salts media containing 0.4% glucose (20). Cell
growth was arrested by chilling the culture on ice. Cui et al. (33) have used a
reiterative polymerase chain reaction-mediated SELEX technique to
define a high affinity, consensus, DNA-binding site for Lrp (Fig.
2). A DNA sequence containing a 13 of 15 match to this
palindromic sequence was identified in the leader region of the
ilvGMEDA operon (Fig. 2). According to the methods of Cui
et al. (33), this site scores 4.81 arbitrary units of
predicted binding energy (sites with values >3 are predicted to be
specific binding sites for Lrp). This binding site is located between
base pair positions +226 and +240 relative to the transcriptional start
site of the ilvPG promoter and lies 40 bp
downstream of the transcriptional termination site of the
ilvGMEDA attenuator located at base pair position +186 and
30 bp upstream of the beginning of the ilvG gene at base
pair position +271. Since the palindromic Lrp consensus sequence is
degenerate at several positions, it can be asymmetrical. Because of
this asymmetry, the consensus-like DNA sequence on the transcribed
strand of the ilvGMEDA leader region matches the consensus
sequence better (13 of 15) than the DNA sequence of the nontranscribed
strand (12 of 15).
DNA sequence analyses show that this site is highly conserved with
respect to DNA sequence and position (relative to the transcriptional
termination site of the attenuator) in the closely related enteric
bacteria, Salmonella typhimurium, Edwardsiella tarda, Serratia
marscescens, and Klebsiella aerogenes (Fig. 2).
Furthermore, the preferred sequence alignment of these sites on the
transcribed DNA strand is also conserved in these organisms. The
functional significance of these conserved features is emphasized by
the facts that (i) little sequence conservation is observed in other
noncoding regions of the ilvGMEDA operons of E. coli and S. typhimurium (11) and (ii) both of these
organisms encode highly conserved lrp genes (34).
To assess the
ability of Lrp to recognize the consensus-like site centered around
base pair position +233 in the ilvGMEDA leader region, gel
mobility shift assays were performed under equilibrium binding
conditions (21, 35). The autoradiogram in Fig. 3 shows
that Lrp binds with high affinity to a DNA fragment (ilv
base pair positions 6-278) containing this site. This gel mobility
shift experiment also showed that Lrp binding to this DNA fragment
results in the formation of three complexes. At an Lrp concentration of
1 × 10
At Lrp concentrations as high as 1 × 10 Since no secondary Lrp binding sites with similarities to
the consensus-like DNA sequence could be identified on the DNA fragment
used in the gel mobility shift experiment described above, the presence
of multiple Lrp-DNA complexes observed in Fig. 3 might, alternatively,
be explained by protein aggregation at high Lrp concentrations. If this
were the case, then multiple complexes would be expected when high
concentrations of Lrp are bound to only a single site contained on a
small, double-stranded, DNA oligonucleotide. Cui et al. (12)
have shown that double-stranded DNA oligonucleotides containing five
base pairs flanking a consensus Lrp binding site are sufficent for
site-specific, high affinity, Lrp-DNA interactions. Therefore, a 33-bp,
double stranded, DNA oligonucleotide containing the 15-bp,
consensus-like, Lrp binding site in the ilvGMEDA leader
region flanked on each side by an additional five ilv
specific base pairs was synthesized (Fig. 5 legend). The autoradiogram
in Fig. 5 shows that Lrp forms a single complex with
this DNA oligonucleotide. However, over the same Lrp concentration
range, multiple Lrp-DNA complexes are observed with a larger
ilv DNA fragment (ilv base pair positions 6-278;
Fig. 3). Thus, the appearance of the multiple complexes observed in
Fig. 3 is not the consequence of protein aggregation at high Lrp
concentrations. Instead, these experiments suggest that secondary
Lrp-binding sites not clearly identifiable by sequence analysis are
present in the ilvGMEDA leader region which give rise to
complexes 2 and 3. The apparent affinity of Lrp for the single binding
site in the double-stranded DNA oligonucleotide is greater than 1 order
of magnitude less than the affinity of Lrp for the larger DNA fragment
also containing the secondary binding sites. This result suggests that
high affinity binding of Lrp to the consensus-like site in the
ilvGMEDA operon requires additional 5
DNase I, hydroxyl radical, and DMS
protection and interference footprinting techniques were performed to
determine the positions of the Lrp-binding sites and base-specific
Lrp-DNA contacts in the leader region of the ilvGMEDA
operon. DNase I footprinting experiments were performed using DNA
fragments uniquely 5
Since the DNase I-protected sites 1, 2, and 3 and the Lrp-DNA complexes
1, 2, and 3 observed with the gel mobility shift assays (Fig. 3) appear
at nearly the same Lrp concentrations, these results suggest that the
gel shift complexes 1, 2, and 3 are Lrp-DNA complexes containing 1, 2, and 3 Lrp protomers per DNA fragment, respectively. The regions of
increased DNase I sensitivity suggest Lrp-induced changes in the
structure of the DNA helix.
To more accurately determine the base pair-specific interactions
between Lrp and the DNA helix, hydroxyl radical footprinting
experiments were performed using DNA fragments uniquely
5
To identify base-specific contacts between Lrp and its binding sites in
the ilvGMEDA leader region, DMS protection assays were
performed on DNA fragments uniquely 5
Alkylation interference experiments were performed to identify
additional nucleotide positions important for the binding of Lrp to its
target site(s) within the ilvGMEDA leader region and to
complement the results of the alkylation protection experiments
described above. To perform these experiments, DNA fragments uniquely
5
In summary, the results of the DNase I and hydroxyl radical
footprinting experiments demonstrate that Lrp binds sequentially to
three adjacent sites in the leader region of the ilvGMEDA
operon (Fig. 10). The results of the DMS protection
experiments show that the Lrp protomer binds to adjacent major grooves
on the same face of the DNA helix at its primary binding site (site 1).
The position of the DMS protection in site 2 at base pair position 199, three and four integral turns of the DNA helix away from the DMS
protection sites in site 1 at base pair positions 229 and 238, suggests
that Lrp molecules bound to sites 1 and 2 are separated by one helical
turn and are aligned along the same face of the DNA helix. The hydroxyl
radical and DNase I protection data suggest that site 3 is separated
from site 2 by another turn of the DNA helix and are consistent with
the possibility that site 3 is also aligned along the same face of the
DNA helix as sites 1 and 2. The regions of Lrp-induced DNase I
sensitivity suggest that Lrp alters the structure of the DNA helix in
and around its primary and secondary binding sites (Fig. 6).
To determine the in
vivo consequence of Lrp-DNA interactions in the
ilvGMEDA leader region, the expression of a reporter gene
(lacZ) transcriptionally fused to the
ilvPG promoter-regulatory region at base pair
position 249 and integrated in single copy into the bacterial
chromosome of lrp+ and
lrp
In vivo effect of Lrp on transcription through the ilvGMEDA
leader-attenuator region
Volume 271, Number 43,
Issue of October 25, 1996
pp. 26499-26507
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

-ketobutyrate, of the AHAS isozymes
required for branched-chain amino acid biosynthesis (Fig.
1). For example, Lrp regulates the serA and
sdaA genes involved in the production of pyruvate and the
tdh and kbl genes, which affect the in
vivo levels of L-threonine and
-ketobutyrate (5,
6). Also, Lrp regulates the expression of the leucine biosynthetic
operon, leuABCD (7), and the expression of the
branched-chain amino acid transport genes livJ and
livKHMG (8). Thus, it appears that Lrp plays an important
role in the maintenance of appropriate in vivo levels of the
branched-chain amino acids. Such a role for Lrp in branched-chain amino
acid metabolism is further underscored by the partial auxotrophy for
the branched-chain amino acids observed in a
lrp
strain of E. coli K12 (1).
Fig. 1.
Lrp-regulated genes involved in the
biosynthesis of the branched chain amino acids and their substrates,
pyruvate and
-ketobutyrate. Genes repressed by Lrp are shown in
bold type. Genes activated by Lrp are underlined. In each
case, leucine acts as a regulatory antagonist. OAA,
oxaloacetate; PEP, phosphoenolpyruvate; mTHF,
methylenetetrahydrofolate; 3-PHP, 3-phosphohydroxypyruvate;
3-PS, 3-phosphoserine;
-KB,
-ketobutyrate;
AHB, acetohydroxybutyrate; DHMV,
dihydroxymethylvalerate; DHIV, dihydroxyisovalerate;
-KMV,
-ketomethylvalerate;
-KIV,
-ketoisovalerate; AHAS, acetohydroxy-acid synthase;
IR, isomeroreductase; DH, dihydroxy-acid
dehydratase; TrB, transaminase B; TD, threonine
deaminase. Gene products: tdh, threonine dehydrogenase;
kbl, glycine acetyltransferase; ilvA,
L-threonine deaminase; ilvGM, AHAS II;
ilvBN, AHAS I; ilvIH, AHAS III; ilvC,
ketoacid reductoisomerase; ilvD, dihydroxy-acid dehydratase;
ilvE, transaminase B; leuABCD, leucine
biosynthetic operon; serA, 3-phosphoglycerate dehydrogenase;
serB, phosphoserine phosphatase; serC,
3-phosphoserine aminotransferase; sdaA/sdaB, serine
deaminase; glyA, serine hydroxymethyltransferase.
[View Larger Version of this Image (24K GIF file)]
-keto acid precursor for
L-valine,
-ketoisovalerate, is a branch point
intermediate for the biosynthesis of L-leucine by the
enzymes encoded in the leuABCD leucine-biosynthetic operon.
Thus, the enzymes encoded by the ilvGMEDA operon are used
for the production of all three branched-chain amino acids. Therefore,
since Lrp is involved in the regulation of other operons involved in
branched-chain amino acid metabolism, it might be expected that it
would modulate the expression of this central operon.
Chemicals and Reagents
245 to +249) into the BamHI restriction site
(end-filled) of the plasmid pDD3 (16). The BamHI site in
pDD3 is flanked by tandem rrnB T1 transcriptional terminator
sequences. Strain IH-RS551 was created by integrating the
transcriptional fusion vector, pRS551
(17), lacking a promoter
insert, into the bacterial chromosome of the polA-deficient
strain, NO3434 (18), as described previously (19). Strain IH-G2490 was
constructed by ligating a 515-bp EcoRI-BamHI DNA
fragment containing a 494-bp ilvGMEDA-derived
HinfI fragment (base pair position
245 to +249) into the
EcoRI and BamHI sites of the
lacZ-truncated transcriptional fusion plasmid pRS551
(17)
(yielding the reporter plasmid pRSG2490) and integrating this reporter
plasmid construct into the bacterial chromosome of the
polA-deficient strain, NO3434 (18), as described previously
(19). Strain IH-G2492 was created by site-directed mutagenesis of the
515-bp EcoRI-BamHI DNA fragment containing a
494-bp ilvGMEDA-derived HinfI fragment (base pair
position
245 to +249) of the reporter plasmid pRSG2490 (yielding a
mutated consensus-like Lrp-binding site with a DNA sequence on the
nontranscribed strand that reads
5
GTGCACCCGATTGAG3
) and subsequent integration
of this altered DNA fragment in pRSG2490 (pRSG2492) into the bacterial
chromosome of the polA-deficient strain, NO3434, in single
copy as described previously (19). An isogenic lrp
derivative of strain IH-G2490 was created by generalized P1
transduction of the lrp-35::Tn10 allele (4) into
this strain according to the methods of Miller (20) to yield strain
IH-G2491.
11 M to ensure that the final free
concentration of Lrp present in the binding reaction was essentially
equivalent to the total Lrp concentration. Free and bound DNA fragments
were visualized by autoradiography following the exposure of the dried
gels to Kodak XAR-5 film overnight at 25 °C. Quantitation of band
intensity was performed utilizing the public domain NIH IMAGE gel
quantitation software. Macroscopic equilibrium dissociation constants
(KD) were determined as described by Senear and
Brenowitz (22). According to this method, the binding curve is
described by the Langmuir isotherm, Y = k(P)/1 + k(P). The equilibrium
binding data were analyzed by a nonlinear least squares parameter
estimation method. The algorithm for this analysis (23) uses a
variation of the Gauss-Newton procedure (24) to determine the best fit,
model-dependent, parameter values corresponding to a
minimum in the variance of each data point. The confidence levels for
the curve fits reported correspond to ~1 S.D. (65% confidence). In
fitting the data to the equations, the substitution,
G =
RT ln K, was made so
that the
G values for each experiment were the actual
curve fit parameters.
-32P-end-labeled DNA fragments (<1 × 10
10 M) containing ilvGMEDA base
pair positions 6-278 and 110-278, derived from plasmids pUCR1TQ and
pIS2, respectively. Binding reactions were performed under equilibrium
binding conditions, and DNase I treatment was restricted to 1 min at
25 °C to assure single hit kinetics. Conditions of single hit
kinetics were verified by measuring the radioactivity of the remaining
uncleaved DNA fragments by Cerenkov counting and demonstrating that
this population of DNA fragments represented >70% of the total
radioactivity included in the reaction (26). Samples were resolved by
electrophoresis on an 8% denaturing polyacrylamide gel (7.6%
acrylamide, 0.4% N,N
-methylenebisacrylamide) containing 8 M urea in TBE (14) and visualized by autoradiography
following the exposure of the gels to Kodak XAR-5 film at
70 °C in
the presence of a Cronex Quanta III intensifying screen (Dupont).
10
M) as in the DNase I footprinting reactions. Binding
reactions were performed under equilibrium binding conditions as
described above with the exception that glycerol was omitted from the
reaction mixture. Samples were treated with hydroxyl radical for 2 min
at 25 °C and quenched with the addition of 20 µl of 0.2 M thiourea to ensure conditions of single hit kinetics as
described above. Reaction products were resolved by electrophoresis on
a 10% denaturing polyacrylamide gel (7.6% acrylamide, 0.4%
N,N
-methylenebisacrylamide) containing 8 M urea
in TBE (14) and visualized by autoradiography as described above. Data
were analyzed by utilizing the public domain NIH IMAGE gel quantitation
software. Regions of protection were determined by comparing the
relative peak heights of each integrated band obtained from an
integration of the band intensities of a digital image of each
lane.
-32P-end-labeled DNA fragments (<1 × 10
10 M) described above, and reacted with DMS
at a final concentration of 26.5 mM for 5 min at 25 °C
and quenched with the addition of 0.25 volume of 1.5 M
sodium acetate, 1.0 M 2-mercaptoethanol, and 0.1 mg/ml
carrier tRNA. Reaction products were separated by electrophoresis on an
8% denaturing polyacrylamide gel (7.6% acrylamide, 0.4%
N,N
-methylenebisacrylamide) containing 8 M urea
in TBE (14) and visualized by autoradiography as described above.
-32P-end-labeled DNA fragments used in the binding
reactions (described above) were alkylated with DMS such that, on
average, each DNA molecule contained only 1 modified nucleotide
position. Modified DNA fragments (<1 × 10
10
M) were incubated with a minimally saturating amount of Lrp
(2.6 × 10
8 M) and resolved by
electrophoresis through a 5% nondenaturing acrylamide gel at 25 °C
to separate Lrp bound from unbound fragments. DNA fragments from each
fraction were purified by standard gel elution techniques (14) and
analyzed by preferential base hydrolysis of the DNA molecules at the
modified nucleotide positions using Maxam-Gilbert sequencing methods
(31). Reaction products were separated by electrophoresis on a 6%
denaturing polyacrylamide gel (7.6% acrylamide, 0.4%
N,N
-methylenebisacrylamide) containing 8 M urea
in TBE (14) and visualized by autoradiography as described above.
-32P]UTP (3000 Ci/mmol), 0.1 mg/ml bovine serum
albumin, and 40 units of RNasin) for 10 min at 25 °C. Transcription
reactions were initiated by the addition of 2 µl of a 2 mM ATP, 2 mM GTP solution. Reactions were
terminated after 4 min with the addition of 20 µl of stop solution
(95% formamide, 0.025% bromphenol blue, 0.025% xylene cyanol).
Transcription under these conditions was determined to be linear with
respect to time to 6 min and was proportional with the amount plasmid
DNA template used. To correct for differences in the total amount of
transcription between reactions, a topologically independent runoff
transcript, produced by cutting the plasmid pUC13 at a unique
ScaI restriction site within the amp gene, was
included at a molar ratio of 1:100 with respect to the plasmid template
used, pDHWT. The reaction products were separated by electrophoresis on
an 8% denaturing polyacrylamide gel (7.6% acrylamide, 0.4%
N,N
-methylenebisacrylamide) containing 8 M urea
in TBE (14) and visualized by autoradiography as described above.
-Galactosidase Assays
-Galactosidase
activities were assayed by measuring
o-nitrophenyl-
-D-galactoside hydrolysis in
SDS-chloroform permeabilized cells at four different time points and
two extract concentrations where the assay was linear with respect to
time and extract concentration. Rates of o-nitrophenol
formation were determined by a linear regression analysis of an
o-nitrophenol versus time plot, and specific
activities were calculated according to the method of Miller (20).
Identification of an Lrp Consensus-like DNA-binding Site in the
ilvGMEDA Leader Region
Fig. 2.
Alignment of Lrp consensus-like sequences in
the ilvGMEDA operon. Y = C or T,
H = not G, W = A or T,
D = not C, r = A or G. * denotes
preferred orientation for alignment. Predicted binding energies (§)
are as defined by Cui et al. (33). Bases that differ from
the consensus sequence are identified by lower case
letters.
[View Larger Version of this Image (22K GIF file)]
10 M, Lrp forms two complexes
with the DNA fragment (complexes 1 and 2); while at an Lrp
concentration of 1 × 10
8 M, a third
complex (complex 3) is observed. As the Lrp concentration was
increased, a greater proportion of complexes 2 and 3 were formed. The
overall macroscopic equilibrium dissociation constant
(KD) for these Lrp-DNA interactions, measured by the
disappearance of the unbound (free) DNA fragment according to the
methods of Senear et al. (22), is 1.35 ± 0.14 × 10
9 M. The individual macroscopic
KD values for complexes 1, 2, and 3 are 2.40 ± 0.18 × 10
9 M, 2.14 ± 0.23 × 10
8 M, and 1.24 ± 0.27 × 10
7 M, respectively (Fig.
4).
Fig. 3.
Gel mobility shift assay for Lrp binding in
the ilvGMEDA leader-regulatory region. Autoradiogram
of a gel mobility shift experiment performed with a 272-bp
32P-end-labeled DNA fragment (ilv bp 6-278) as
described under ``Materials and Methods.'' Lane 1, DNA
probe only; lanes 2-12: 3.2 × 10
3
nM; 8.0 × 10
3 nM; 1.6 × 10
2 nM; 8.0 × 10
2
nM; 1.6 × 10
1 nM; 8.0 × 10
1 nM; 1.6 nM; 3.2 nM; 8.0 nM; 16 nM; 32 nM Lrp, respectively.
[View Larger Version of this Image (33K GIF file)]
Fig. 4.
Binding isotherm analysis of Lrp binding to
the ilvGMEDA leader-regulatory region. These data were
obtained from four experiments of the type illustrated in Fig. 3
performed as described under ``Materials and Methods.'' The
percentage of DNA fragments bound by each of the Lrp-DNA complexes or
the percentage of remaining uncomplexed (Free) DNA fragment
is indicated on the ordinate. The curves are the best-fit
isotherms for the gel shift analysis of each of the three Lrp-DNA
complexes or the remaining uncomplexed DNA fragments. The overall
macroscopic equilibrium dissociation constant (KD ± S.D.) for these Lrp DNA interactions (measured by the disappearance of
uncomplexed DNA fragment) is 1.35 ± 0.14 × 10
9 M. The individual macroscopic
KD values for complexes 1, 2, and 3 are 2.40 ± 0.18 × 10
9, 2.14 ± 0.23 × 10
8, and 1.24 ± 0.27 × 10
7
M (22).
, free DNA fragment;
, complex 1;
,
complex 2;
, complex 3.
[View Larger Version of this Image (22K GIF file)]
7
M, no detectable Lrp-DNA complexes were observed with a DNA
fragment (ilv base pair positions 6-188) that does not
contain the consensus-like Lrp binding sequence or with a DNA fragment
(ilv base pair positions 6-278) that contains point
mutations in the consensus-like sequence (Fig. 2). These results
confirm that Lrp binds in a site-specific manner to the consensus-like
DNA sequence and suggest that Lrp binding to this site (complex 1) is
required for subsequent, cooperative binding to secondary sites which
give rise to complexes 2 and 3. However, no other DNA sequences with
detectable similarity to the consensus-like Lrp-binding site are
present on the DNA fragment used in the binding experiment.
and/or 3
ilv-specific flanking DNA sequences beyond those previously
defined by Cui et al. (33).
Fig. 5.
Gel mobility shift assay for the binding of
Lrp to a synthetic 33-mer DNA oligonucleotide containing a single Lrp
consensus-like site. Autoradiogram of a gel mobility shift
experiment performed with a 33-bp 32P-end-labeled
double-stranded DNA oligonucleotide containing a single Lrp
consensus-like binding site flanked by 5 ilv-specific base
pairs. The nucleotide sequence of the nontranscribed strand of this
oligonucleotide is
5
TCGACAATAACAGCACAAAATTCTGTTTCTCAG3
.
Lane 1, DNA probe only; lanes 2-10: 2.0 × 10
1 nM; 4.1 × 10
1
nM; 8.1 × 10
1 nM; 1.6 nM; 3.3 nM; 6.5 nM; 13 nM; 26 nM; 52 nM,
respectively.
[View Larger Version of this Image (55K GIF file)]
-32P-end-labeled on the transcribed
(ilv base pair positions 6-278) or nontranscribed
(ilv base pair positions 278-110) strand. The autoradiogram
in Fig. 6A shows that in the presence of
increasing concentrations of Lrp (5.0 × 10
10 to
3.25 × 10
8 M), three regions of DNase I
protection and two intervening regions of enhancement on the
nontranscribed DNA strand are observed. Site 1 (approximate base pair
position, 220-250), which contains the 15-bp Lrp consensus-like
binding sequence located between base pair positions 226 and 240, appears at the lowest Lrp concentration followed by the appearance of
site 2 (approximate base pair position 185-215) and then site 3 (approximate base pair position 155-180). The regions of DNase I
protection and enhancement induced by Lrp on the transcribed DNA strand
are identified in the autoradiogram shown in Fig. 6B. Again,
site 1 appears before site 2 as the Lrp concentration is increased. On
this strand, however, no DNase I protection in the region identified as
site 3 on the transcribed strand was observed.
Fig. 6.
DNase I footprint of Lrp DNA interactions in
the ilvGMEDA leader-regulatory region. Autoradiogram
of DNase I protection patterns obtained in the absence and presence of
increasing amounts of purified Lrp bound to the nontranscribed
(ilv bp 110-278 (A)) or transcribed
(ilv bp 6-278 (B)) DNA strand of the
ilvGMEDA leader-regulatory region. Regions of protection are
indicated with brackets. Sites 1, 2, and 3 are as described under
``Results.''
, sites of enhanced DNase I sensitivity. Lanes
1 and 6, DNA probe only; lanes 2 and
7, 0.5 nM; lanes 3 and 8,
2.0 nM; lanes 4 and 9, 8.1 nM; lanes 5 and 10, 32.5 nM.
[View Larger Version of this Image (63K GIF file)]
-32P-end-labeled on either the transcribed or
nontranscribed DNA strands described above. At a minimally saturating
concentration of Lrp (2.6 × 10
8 M),
protection from hydroxyl radical cleavage was observed on the
transcribed DNA strand in all three of the regions identified as
Lrp-binding sites by DNase I protection (Fig.
7B). Protection was observed in site 1 at
base pair positions 220-225, 230-234, and 238-243. Protection was
observed on the opposite (nontranscribed) DNA strand between base pair
positions 223-227 and 233-238 (Fig. 7A). Thus, on one DNA
strand or another, nearly every base pair between positions 220 and 243 was protected from hydroxyl radical cleavage by Lrp. Two other regions
in site 2 on the transcribed strand (base pair positions 194-201 and
207-214) were also protected from hydroxyl radical cleavage by Lrp
(Fig. 7B). No clear hydroxyl radical protection data were
obtained for site 3. All of the protected regions lie within
Lrp-binding sites identified by the DNase I footprinting experiments
(Fig. 6).
Fig. 7.
Hydroxyl radical footprint of Lrp DNA
interactions in the ilvGMEDA leader-regulatory region.
Plots of the relative band intensities in digitized images of
autoradiograms of hydroxyl radical protection patterns obtained in the
absence (thin line) and presence (thick line) of
a minimally saturating amount of purified Lrp (2.6 × 10
8 M) bound to the nontranscribed
(ilv bp 110-278 (A)) or transcribed
(ilv bp 6-278 (B)) DNA strand of the
ilvGMEDA leader-regulatory region are shown.
[View Larger Version of this Image (26K GIF file)]
-32P-end-labeled on
either the transcribed or nontranscribed DNA strands described above.
The autoradiogram in Fig. 8B shows that in
the presence of a minimally saturating concentration of Lrp (2.6 × 10
8 M), 2 guanine residues separated by 9 base pairs (nearly one complete turn of the DNA helix) at base pair
positions 229 and 238 on the transcribed DNA strand were not alkylated
by DMS. Since DMS alkylates the N-7 position of guanine residues
exposed in the major groove of the DNA helix, this result shows that
the homodimeric Lrp molecule binds to adjacent major grooves positioned
on the same face of the DNA helix. In addition, alkylation of the N-7
position of a guanine residue at position 228 on the nontranscribed
strand was inhibited (Fig. 8A). Interestingly, this guanine
is related by dyad symmetry to the protected guanine at position 238. Thus, binding of Lrp to the consensus-like site appears to involve
symmetrical half-site contacts and interactions with adjacent major
grooves of the DNA helix. A third guanine residue at base pair position
231 in site 1 on the transcribed strand was also protected from DMS
alkylation (Fig. 8B). Because there is no sequence symmetry
in the secondary Lrp-binding sites, no other DMS protection sites
separated by an integral turn of the DNA helix were observed. However,
a single DMS protection site at a guanine residue located at base pair
position 199 in site 2 on the transcribed DNA strand was detected (Fig.
8B). In addition, a single, distal site of enhanced DMS
reactivity was observed at base pair position 176 on the nontranscribed
DNA strand (Fig. 8A).
Fig. 8.
DMS protection footprint of Lrp DNA
interactions in the ilvGMEDA leader-regulatory region.
Autoradiogram of DMS protection patterns obtained in the absence and
presence of a minimally saturating amount of purified Lrp (2.6 × 10
8 M) bound to the nontranscribed
(ilv bp 110-278 (A)) or transcribed
(ilv bp 6-278 (B)) DNA strand of the
ilvGMEDA leader-regulatory region.
, protected nucleotide
positions;
, position of enhanced reactivity. Labels 1, 2, and 3 refer to the regions described under
``Results'' as sites 1, 2, and 3.
[View Larger Version of this Image (34K GIF file)]
-32P-end-labeled on either the nontranscribed or
transcribed strand (described above) were alkylated with DMS such that,
on average, each DNA molecule contained only 1 modified nucleotide
(30). These modified DNA fragments were incubated with a minimally
saturating amount of Lrp (2.6 × 10
8 M)
and resolved by electrophoresis on a nondenaturing polyacrylamide gel
to separate Lrp-bound and unbound fragments. In principle, DNA
fragments containing modifications that interfere with binding of Lrp
to its target site(s) should preferentially, if not exclusively, be
contained in the unbound fraction. An autoradiogram of the results of
the alkylation interference experiment is shown in Fig.
9. At the minimally saturating Lrp concentration used in
this experiment, only the Lrp-DNA complex containing two Lrp protomers
contained enough radioactivity to be suitable for further analysis. On
the nontranscribed strand, two bands were identified in the unbound
fraction that were missing in the bound fraction (Fig. 9). These bands
are located at nucleotide positions 228 and 235 in site 1. Since the
alkylation protection experiment identified the guanine at position 228 as a protected residue, it is likely that direct contacts between Lrp
and this guanine residue are important for high affinity binding of Lrp
to site 1. The interference observed with the modification of the
adenine residue at nucleotide position 235 can be interpreted either as
a site of direct contact with Lrp in the minor groove of the DNA helix
or as a residue the modification of which alters the local conformation
of the DNA helix. Analysis of Lrp-DNA complexes containing two
protomers bound to an ilvGMEDA leader-containing DNA
fragment labeled on the transcribed strand showed no detectable
differences in the populations of modified DNA fragments in the bound
versus the unbound fraction. Also, no DMS interference sites
were detected in site 2 on either DNA strand.
Fig. 9.
DMS interference footprint of Lrp DNA
interactions in the ilvGMEDA leader-regulatory region.
Autoradiogram of DMS interference patterns obtained in the absence and
presence of a minimally saturating amount of purified Lrp (2.6 × 10
8 M) bound to the nontranscribed
(ilv bp +110-+278) DNA strand of the ilvGMEDA
leader-regulatory region.
, protected nucleotide positions.
Labels 1 and 2 refer to the regions described
under ``Results'' as sites 1 and 2. Lane 1, G > A
sequence ladder; lane 2, G = A sequence ladder;
lane 3, unbound modified DNA fragments; lane 4, Lrp bound modified DNA fragments.
[View Larger Version of this Image (51K GIF file)]
Fig. 10.
Schematic representation of Lrp DNA
interactions in the ilvGMEDA leader-regulatory region.
, OH radical protection;
, DMS protection;
, DMS interference.
The DNA helix is oriented to the display the open face of the major
grooves of the Lrp binding sites.
[View Larger Version of this Image (16K GIF file)]
E. coli strains was examined.
The results reported in Table I show that in the absence
of a functional Lrp gene product, the expression of the reporter gene
was increased nearly 3-fold (compare strains IH-G2490 and IH-G2491). To
determine whether this increased transcription of the reporter gene was
the consequence of a direct effect on the expression of the ilvGMEDA
operon or an indirect pleiotropic effect of the Lrp
phenotype, the expression of the lacZ gene in a similar
transcriptional fusion construct containing a mutationally altered
primary Lrp-binding site (Fig. 2) was examined. In vitro, no
detectable binding of Lrp to a DNA fragment containing this mutated
site is observed at a Lrp concentration as high as 1 × 10
7 M. The results of this experiment are
also shown in Table I. Again, the expression of the reporter gene was
increased 3-fold (compare strains IH-G2490 and IH-G2492). These results
demonstrate that Lrp represses the expression of the
ilv::lacZ transcriptional fusion
construct described above and that this repression is dependent on a
site-specific interaction between Lrp and its consensus-like site
within the ilvGMEDA leader region.
Strain
Relevant genotype
-Galactosidase
specific activity ONPa
nmol ONP/min/mg
proteinb
IH-RS551
ilvPG::lacZNDa
IH-G2490
ilvPGatt::lacZ
2973
± 80
IH-G2491
ilvPGatt::lacZ,
lrp
8161 ± 642
IH-G2492
ilvPGatt::lacZ,
lbs (Lrp-binding site 1 mutation)
8516 ± 950
a
ONP, o-nitrophenol; ND, not detectable.
b
Mean ± S.D. obtained from the results of at least
three separate experiments.
A
purified in vitro transcription system was employed to
examine the effects of Lrp on the production of attenuated RNA
transcripts from the promoter-attenuator region of the
ilvGMEDA operon on a negatively supercoiled DNA template.
The autoradiogram in Fig. 11 shows that the production
of the attenuated RNA transcripts which originate from the
ilvPG1 and ilvPG2
promoters (36) is repressed by Lrp. Additionally, the concentration of
Lrp required for half-maximal repression is comparable to the
concentration of Lrp required for half-maximal saturation of the Lrp
binding sites.
-lactamase in a pUC13 DNA
template linearized with ScaI. ilvPG1
and ilvPG2 identify the 258- and 186-nucleotide
RNA transcripts that originate from these promoters, respectively. The
ilvPG1 transcript originates from an AT-rich
region in the upstream DNA sequence (42); The 108-nucleotide
ori transcript originates from the RNA-I promoter.
Leucine Inhibits but Does Not Abolish Lrp-DNA Interactions
To evaluate the effect of L-leucine on Lrp-DNA interactions in the ilvGMEDA leader region, gel mobility shift assays were performed under equilibrium binding conditions in the presence of increasing amounts of L-leucine.2 The results of these experiments showed that L-leucine coordinately destabilizes all of the Lrp-DNA complexes. The apparent macroscopic inhibition constant (Ki) for this L-leucine-mediated inhibition of Lrp-DNA binding activity, measured by the appearance of the uncomplexed (free) DNA fragment, is approximately 2 mM. However, even at a saturating concentration of L-leucine (20 mM) (37) inhibition is incomplete and about 20% of the DNA fragments remain complexed with Lrp. Thus, although L-leucine significantly destabilizes binding of Lrp in the ilvGMEDA leader region, it does not abolish it. While L-isoleucine or L-valine also inhibit Lrp-DNA interactions, significantly higher concentrations of each are required and different levels of maximal inhibition are observed for each complex.2
The results of the experiments reported here
clearly identify a high affinity Lrp binding site located within the
leader region of the ilvGMEDA operon. This site, located
between the transcriptional termination site of the ilvGMEDA
attenuator and the beginning of the ilvG structural gene
exhibits a 13- of 15-bp match to a PCR-derived consensus sequence (33).
Cui et al. (33) have estimated the relative binding
affinities of sites with sequence similarities to the consensus site by
assigning arbitrary values that were based on theoretical binding
energies to each of the 15 base pair positions. This results in a
predicted relative binding energy value for each consensus-like Lrp
binding site. The consensus-like site identified within the
ilvGMEDA leader region yields a predicted value of 4.81 which is similar to the predicted value (5.01) of a known high affinity
Lrp binding site, site 2, in the ilvIH promoter region (33).
A systematic search of the DNA sequence of the ilvGMEDA
operon from base pair position
460 to +278 did not reveal any other
Lrp consensus-like DNA binding sites with predicted values greater than
3.0. Cui et al. (33) suggest that sequences with predicted
values less than 3.0 are not likely to be specific Lrp binding
sites.
The Lrp binding site in the ilvGMEDA operon is highly conserved in sequence, position, and alignment orientation in the four closely related enterobacteria, S. typhimurium, E. tarda, S. marscescens, and K. aerogenes. The significance of these conserved features is underscored by the observation that little sequence conservation is observed in other noncoding regions of the ilvGMEDA operon (11).
Evidence for site-specific binding of Lrp to this consensus-like site comes from the observations that Lrp binds with high affinity to an ilv DNA fragment containing this site but binds with a much weaker affinity (~2 orders of magnitude) to an ilv DNA fragment lacking this site or containing a Lrp binding site altered by site-directed mutagenesis. The specific Lrp-DNA interactions at this site are defined by the results of the DNase I, hydroxyl radical, and DMS protection and interference footprinting data. In the presence of Lrp, a 30-bp region of DNase I protection from base pair position 220-250 covering the Lrp, consensus-like DNA binding site (base pair position 226-240), was observed. Lrp also protected a contiguous region of the DNA in this region (base pair positions 220-243) from cleavage by hydroxyl radical. These results suggest that the center of the Lrp binding site is coincident with the center of the dyad symmetry of the consensus-like site (Fig. 10). The observation that symmetrically spaced guanine residues on opposite DNA strands in the consensus-like site are protected from alkylation by DMS demonstrates that the homodimeric Lrp molecule forms symmetrical half-site contacts in this palindromic, consensus-like site. Since DMS alkylates the N7 position of guanines in the major groove of the DNA helix the DMS protection patterns also demonstrate that, like other homodimeric helix-turn-helix DNA binding proteins, the Lrp protomer binds in adjacent major grooves on the same face of the DNA helix. Together, these results support the sequence-derived inference that Lrp is a helix-turn-helix DNA binding protein (38).
Lrp Binds directionally and Cooperatively to Adjacent Non-consensus-like Secondary SitesIn spite of the fact that only
one, consensus-like, Lrp DNA binding site was identified in the nearly
750 base pairs around the promoter of the ilvGMEDA operon,
the results of gel mobility shift experiments (Fig. 3) showed that Lrp
forms three complexes with an ilv DNA fragment containing
this site. The results of DNase I footprinting experiments (Fig. 6)
showed that these complexes are formed by the binding of Lrp to its
primary, consensus-like, site followed by the sequential and
directional binding to two adjacent secondary sites that possess no
sequence similarity to the Lrp consensus site. The further observations
that Lrp does not bind with high affinity to an ilv DNA
fragment containing a mutationally altered or deleted primary binding
site suggest that the binding of Lrp to these secondary sites requires
cooperative interactions associated with the binding of an initial Lrp
protomer to the primary consensus-like sequence. The DNase I
footprinting results also suggest Lrp-induced conformational changes in
the DNA helix in the regions flanking each of the Lrp binding sites
(25). Since there are no identifiable consensus-like sequence elements
at these secondary sites, it is possible that these Lrp-induced
alterations of the DNA helix might be an important parameter of these
cooperative interactions. It is unlikely that this cooperativity is
solely attributable to specific protein interactions between adjacently
bound Lrp protomers since Willins et al. (39) have
demonstrated that, in solution, Lrp exists exclusively in a homodimeric
form at concentrations up to and exceeding 1 × 10
6
M.
The results of the hydroxyl radical footprinting experiments (Fig. 7) show that the primary consensus-like binding site (site 1) and the adjacent secondary binding site (site 2) are separated from one another by one integral turn of the DNA helix (Fig. 10). The results of the DMS protection experiments further demonstrate that these two sites (sites 1 and 2) are aligned along the same face of the DNA helix.
Since Lrp binding to site 3 did not reach saturation (Fig. 4),
sufficient data was not obtained to accurately define the position of
this third Lrp binding site. However, the results of in
vitro DNase I and hydroxyl radical footprinting experiments in
this region suggest that this site is most likely also separated from
site 2 by one integral turn of the DNA helix and aligned along the same
face of the DNA helix as sites 1 and 22. However, it is
likely that Lrp does not bind to this site in vivo. This
suggestion is based on the following observations: (i) Lrp
concentrations in excess of 1 × 10
8 M
are required to form detectable Lrp DNA complexes at this site in
vitro (Fig. 4); (ii) the estimated total intracellular
concentration of Lrp is about 1 × 10
6 M
(39); and (iii) Lrp is thought to bind nonspecifically to over 1000 sites on the bacterial chromosome (6). Thus, the free intracellular
concentration of Lrp might be too low to form Lrp-DNA complexes at this
site in vivo.
The results of both in vitro transcription assays with purified Lrp protein and in vivo assays of a reporter gene transcriptionally fused to the ilvGMEDA promoter-attenuator region demonstrate that Lrp represses transcription through the leader-attenuator region of the ilvGMEDA operon. However, given the unusual position of the primary Lrp binding site 226 bp downstream from the transcriptional initiation site and 40 bp downstream of the transcriptional termination site of the attenuator at base pair position 186, it is unclear how Lrp affects transcription from the upstream promoter.
L-Leucine Inhibits Lrp-DNA Interactions in the ilvGMEDA Leader RegionRicca et al. (37) have shown that L-leucine decreases the affinity of Lrp for its consensus-like DNA binding site (site 2) in the ilvIH operon. However, even at high concentrations, L-leucine did not abolish the ability of Lrp to bind to this site. L-Leucine also inhibits but does not abolish Lrp binding to its primary and secondary sites in the leader region of the ilvGMEDA operon (Fig. 11). Given this observation and the results of the in vitro transcription and in vivo reporter construct assays (Fig. 11 and Table I), it is expected that high concentrations of L-leucine would relieve Lrp-mediated repression of ilvGMEDA operon expression.
A Possible Role for Lrp in the Regulation of the ilvGMEDA OperonDuring L-leucine starvation, the synthesis of all three of the AHAS isozymes is increased (9). However, the activities of the two isozymes with substrate preferences for L-leucine (and L-valine) biosynthesis (40), AHAS I and AHAS III, are feedback inhibited by L-valine, while the activity of AHAS II, with a substrate preference for L-isoleucine biosynthesis, remains unchecked (41). It is possible that this situation might compromise the abilities of AHAS I and III to compete with AHAS II for pyruvate required for L-leucine biosynthesis. If this were the case, then an increase in the rate of pyruvate biosynthesis and a lowering of the expression of the ilvGM genes for AHAS II during L-leucine starvation might be advantageous [under these conditions, the expression of the distal genes of the ilvGMEDA operon might be sufficiently sustained by the activity of the internal ilvPE promoter (16)]. Thus, Lrp might function to repress the production of AHAS II during conditions of L-leucine starvation. The results reported here are consistent with such a role for Lrp in the regulation of branched chain amino acid metabolism.
To whom correspondence should be addressed: Tel.: 714-824-5858;
Fax: 714-824-8598; E-mail: gwhatfie{at}uci.edu.
We are grateful to Joseph M. Calvo for providing strains and plasmids and for many helpful discussions. We also thank Donald F. Senear for help with data analysis and Elaine Ito and Becky Irwin for technical assistance.
This article has been cited by other articles:
![]() |
K. A. McFarland, S. Lucchini, J. C. D. Hinton, and C. J. Dorman The Leucine-Responsive Regulatory Protein, Lrp, Activates Transcription of the fim Operon in Salmonella enterica Serovar Typhimurium via the fimZ Regulatory Gene J. Bacteriol., January 15, 2008; 190(2): 602 - 612. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Park, K. H. Lee, T. Y. Kim, and S. Y. Lee Metabolic engineering of Escherichia coli for the production of L-valine based on transcriptome analysis and in silico gene knockout simulation PNAS, May 8, 2007; 104(19): 7797 - 7802. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Wagner and M. H. Mulks Identification of the Actinobacillus pleuropneumoniae Leucine-Responsive Regulatory Protein and Its Involvement in the Regulation of In Vivo-Induced Genes Infect. Immun., January 1, 2007; 75(1): 91 - 103. [Abstract] [Full Text] [PDF |