|
|
|
|||||||
|
|||||||||
(Received for publication, August 12, 1996)
From the ABSTRACT A detailed analysis is reported of the binding of
the zinc finger protein THZif-1 to the nuclease-hypersensitive element
(NHE) in the promoter region of the c-MYC gene using the
electrophoretic mobility shift assay and a series of mutants of a
fusion protein composed of glutathione S-transferase and
THZif-1. The THZif-1 protein bound specifically to the single-stranded
(ss) pyrimidine-rich DNA of the NHE (ss c-myc NHE-C) with
an apparent dissociation constant
(Kd (app)) of 0.077 µM.
By contrast, no binding to the single-stranded purine-rich DNA of the
NHE (ss c-myc NHE-G) was detected. Moreover, the binding
affinity of THZif-1 protein was 2-fold higher for the single-stranded
5-methyl-2 INTRODUCTION Recent studies suggest that the c-Myc oncoprotein functions, in
part, as a sequence-specific transcription factor. This protein is
induced in a variety of cellular processes, which include regulation of
progression of the cell cycle, proliferation, differentiation, and
programmed cell death (apoptosis) (1, 2, 3, 4). The c-myc gene is
a member of a family of genes with basic, helix-loop-helix, and leucine
zipper domains, all of which encode sequence-specific DNA-binding
proteins (5). The c-Myc protein forms a heterodimer with the Max
protein that is required for the oncogenic activity of
c-myc. The Myc-Max complex recognizes the core sequence
CACGTG (5).
Evidence for complementary, but not fully redundant,
activities among members of the Myc family (c-, N-, and
L-myc) comes from studies of phenotypes of Myc-deficient
mice. Although inactivation of c-myc and N-myc
results in death of embryos by mid-gestation (6, 7, 8, 9), a phenomenon that
demonstrates that each is required for normal development, the survival
of the mutant embryos to such a late stage of embryogenesis suggests
that members of the c-myc family of genes might have
overlapping functions at early, but not later, stages of development.
At mid-gestation in the mouse, enhanced expression of c-myc
is correlated with active proliferation, and down-regulation is
associated with mitotic arrest and the onset of differentiation (10).
Furthermore, in most experiments with cultured cells and transgenic
mice, forced expression of c-myc prevents withdrawal from
the cell cycle and inhibits differentiation (1, 2, 3, 4, 5), indicating that
down-regulation of c-myc is required for mitotic arrest and terminal differentiation in the various cell lineages.
Transcription of the human c-MYC oncogene is subject to
complex and, thus far, poorly understood regulatory mechanisms. Obvious difficulties arise from the fact that transcription of the gene is
driven by at least three promoters, P0, P1, and P2 (11, 12, 13), which lack
absolute polarity (12), and moreover, transcription is modulated at
several different levels, such as initiation (14, 15, 16), elongation (14),
premature termination (13), and attenuation (2, 3). Several
cis- and trans-acting components that regulate
the initiation of transcription of the c-MYC gene have been
described (1, 2, 3, 4, 5).
It has also been suggested that transcription of c-MYC might
be regulated at the level of template structure (17, 18, 19, 20). A colinear
triplex formed between a site-specific oligodeoxynucleotide and
c-MYC duplex DNA at Davis et al. (20) reported the association of a
ribonucleoprotein (RNP), which appeared to involve RNA-DNA
hybridization, with the NHE sequence of c-myc. Postel and
co-workers (21, 44) demonstrated the binding to c-MYC NHE of
the protein, PuF, which they later cloned as PuF/NM23-H2/NDPK-3, a
putative suppressor of tumor metastasis (44). The nuclease-sensitive
element protein (NSEP-1) (45) and the heterogeneous nuclear (hn) RNA
protein K, which exhibit overlapping but distinct single-stranded
DNA-binding, double-stranded DNA-binding, and RNA-binding
specificities, have also been shown to interact with the NHE sequence
in the human c-MYC promoter (46, 47, 48). Zinc finger proteins,
such as SP1 (49), and cellular nucleic acid-binding protein (CNBP) (50), were also shown to bind to the NHE-III1 site of the human c-MYC gene. Distinct cis-acting elements,
designated MEla2, E2F, and MEla1, are required for the optimal
initiation of transcription from the P2 promoter (52). The DNase
I-hypersensitive site III2 is situated almost exactly in the center of
the sequence between the P1 and P2 promoters of the c-MYC
gene (20, 21, 22, 23, 24, 25). The zinc finger protein ZF87/Maz (or Pur-1) has been reported to bind to one of these sites, MEla1, in addition to binding
to the NHE-III1 site (37, 52, 53, 54, 55). Another zinc finger protein,
CCCTC-binding factor or CTCF (51, 56), has also been reported to make
contact with sequences in GC-rich core regions between the P1 and P2
promoters.
We showed previously that synthesis of the transcription factor
THZif-1, a MAZ-like zinc finger protein, can be induced in the nuclei
of HL60 cells that have been transformed with antisense c-MYC, and that it serves as a repressor of the endogenous
transcription of the c-MYC protooncogene via binding to the
NHE element (57, 58, 59, 60). This THZif-1 factor is a zinc finger protein with
strong binding affinity for the triple-helical conformation of the NHE
of the c-MYC promoter, as well as for the single-stranded and double-stranded NHE (60). In this report, we compared the relative
binding activities of THZif-1 protein to the methylated and
unmethylated forms of c-myc NHE. Moreover, we identified the region of THZif-1 that binds to the NHEs using deletion and
substitution mutants of the zinc finger motifs. The amino-terminal
second zinc finger of the THZif-1 protein is required for binding to
the methylated or unmethylated, single-stranded pyrimidine-rich NHE.
Our results imply a significant role for THZif-1 in the regulated
function of the NHE of the c-MYC gene during the growth and
differentiation of HL60 cells.
MATERIALS AND METHODS HL60
cells were grown in RPMI 1640 medium supplemented with 10% fetal
bovine serum (Life Technologies, Inc.) and 60 µg/ml kanamycin
monosulfate (Sigma). Transfection for long term
expression was carried out as described previously (61, 62). Assays of chloramphenicol acetyltransferase (CAT) activity were performed as
described elsewhere (61, 62, 63). Each thin-layer chromatography plate was
exposed to RX film (Fuji, Tokyo, Japan). The extent of conversion of
chloramphenicol to its acetylated form was determined with a
Bio-Imaging analyzer (model BAS 2000; Fuji). Oligodeoxynucleotides
were synthesized by standard phosphoramidite chemistry and purified by
reverse-phase chromatography on a Cruachem Oligonucleotide
Purification/Elution Cartridge (Cruachem Inc., Glasgow, Scotland). The
me5C-methylated oligodeoxynucleotides were synthesized by
the same phosphoramidite method but with 5-C-methylcytidine
dicyanoethylphosphoramidite (Cruachem) instead of cytidine
cyanoethylphosphoramidite. The methylated oligodeoxynucleotides were
deblocked, purified by reverse-phase chromatography on a Cruachem
cartridge, and isolated by polyacrylamide gel electrophoresis (20%)
under denaturing conditions. The methylated oligodeoxynucleotides in
specific bands were eluted from the gel in distilled water at 37 °C.
Concentrations were determined by measurements of absorption at 260 nm.
Oligodeoxynucleotide integrity was verified by 5
Summary of the DNA-binding activity of THZif-1 protein to various
5-methyl-2 pMyc CAT2, pMycRN CAT, and pMycRN Conditions for all PCRs described herein were the same,
with the exception that concentrations of Mg2+ ions were
varied from 2.0 to 2.5 mM. The conditions for PCR were an
initial denaturation for 2 min with subsequent denaturation for 1 min
at 94 °C, annealing for 1 min at 56 °C, and extension for 3 min
at 72 °C.
Derivatives of pGEX-THZif-1
were introduced into Escherichia coli AD202. All fusion
proteins were induced with 1.0 mM
isopropyl- DNA probes for electrophoretic
mobility shift assays (EMSA) were prepared, as described by Boles and
Hogan (17), by incubating trace amounts of the
32P-radiolabeled purine (or pyrimidine) strand with
increasing concentrations of the pyrimidine-rich or purine-rich strand
of c-myc NHE in 10 mM Tris (pH 7.8) and 5 mM MgCl2 at 4 °C for 60 min. Samples were subjected to electrophoresis through polyacrylamide gels prepared with
89 mM Tris (pH 7.4), 89 mM boric acid, and 5 mM MgCl2. Gels were then dried and
autoradiographed. Each single-stranded, double-stranded, and
triple-stranded DNA probe was cut out from gels, eluted in 10 mM Tris (pH 7.8), and 5 mM MgCl2.
The EMSA
was performed basically as described by Durland et al. (34).
The 32P-radiolabeled oligodeoxynucleotide probe was
incubated in a reaction buffer (50 µl) that consisted of 10 mM Tris (pH 7.8), 5 mM MgCl2, 1 mM spermidine, 10% sucrose, 25 µM
ZnCl2, 5 mM dithiothreitol, and 1 µg
poly(dI-dC) (Pharmacia). The GST-THZif-1 fusion protein was added to
the reaction buffer at the indicated amount, and the mixture was
incubated for 60 min at 4 °C. In competition experiments, indicated
amounts of unlabeled oligomers were added, and incubation was continued
for a further 60 min at 4 °C. Samples were subjected to
electrophoresis at 4 °C at a constant current of 10 mA on
polyacrylamide gels (4 or 12%) in 50 mM Tris-based buffer
as described above. Gels were then dried and autoradiographed.
Similarly, the rabbit polyclonal THZif-1 specific
antiserum2 and preimmune serum were used
for the supershifting experiment of EMSA as described elsewhere (65).
Effect of proteinase K digestion on DNA-protein complex with the
THZif-1 protein and c-myc NHE was examined as described by
Fang and Cech (66).
After
washing with phosphate-buffered saline (PBS( RESULTS We reported
previously that the NHE sequence in the promoter region of the
c-MYC protooncogene is the target site of DNA-binding proteins that are induced in the antisense c-MYC transformed
cell line AM93-4-12 (57, 58, 59). We purified a DNA-binding protein specific for this NHE from a nuclear extract of AM93-4-12 cells and
isolated a recombinant cDNA clone (for THZif-1, In an attempt to examine the intrinsic activity of
c-myc NHE during the differentiation of HL60 cells, we
compared the CAT activities of c-MYC promoter-CAT
fusion constructs with and without NHE (pMycRNCAT
versus pMycRN Interaction of THZif-1 with the
c-myc NHE results in repression of transcription of the
c-MYC gene. A, intrinsic activity of the human
c-myc NHE during the differentiation of HL60 cells. Three
µg of pMycCAT2 (57), pMycRNCAT (58), pMycRN
To determine whether the THZif-1 protein was responsible for the
negative regulation of transcription of the c-MYC gene, we analyzed the effect of the THZif-1 protein on the promoter activity of
c-MYC gene by introducing CAT reporter fusion constructs of c-MYC with or without NHE and an expression plasmid pTHZif-1
or its mutant plasmid pTHZif-1m of second zinc-finger motif, into HL60
cells. We also constructed a promoter for the gene for thymidine kinase
(tk) from herpes simplex virus-1 with or without the NHE fused to the
gene for CAT and examined CAT activities (61, 64). These plasmids were
introduced into HL60 cells and isolated each stable clone. We
assayed the reporter activities of these clones. As shown in Fig.
1B, CAT activity of the c-MYC promoter-CAT with NHE (pMycRNCAT) was repressed from 8- to 9-fold by THZif-1,
whereas that of c-MYC promoter-CAT without NHE
(pMycRN To assess the possibility that the THZif-1 protein binds to
the c-myc NHE during the differentiation of HL60 cells, we
performed a DNA-binding assay with oligodeoxynucleotides that
corresponded to ds c-myc NHE-CG as a probe (Fig.
1C). The binding of nuclear proteins to c-myc
NHE-CG was detected as a sequence-specific protein-DNA complex in
extracts of differentiated HL60 cells (lane 2). The incubation of extracts with antiserum specific for THZif-1 resulted in
the supershifting of the DNA-protein complex (lane 3). The supershifted band disappeared in the presence of the GST-THZif-1 fusion
protein (lane 4). Moreover, control preimmune serum did not
cause any change in the complex (lane 5). Furthermore and to
our surprise, the antiserum specific for SP-1 also shifted the
DNA-protein complex (lane 6). By contrast, antiserum
specific for c-JUN and ZF87/Maz did not affect the binding to DNA
(lanes 7 and 8). However, we did not detect any
involvement of the THZif-1 protein in the formation of the DNA-protein
complex with c-myc NHE when we used nuclear extracts of
undifferentiated HL60 cells. This observation is consistent with
previous data (58, 59), and these observations, taken together,
indicate that the specific shifts observed in our DNA-binding assays
were due to the THZif-1 protein or a closely related protein.
To address the question of whether the negative expression of
c-MYC by the THZif-1 protein is primarily due to the binding of THZif-1 to the NHE sequence, we carried out a DNA-binding study using the single-stranded (ss), double-stranded (ds), and
triple-stranded (ts) forms of the NHE of the c-MYC gene as
DNA probes. The NHE of the c-MYC gene consists of
pyrimidine-rich sequences in one strand that seem to be sensitive to
de novo methylation and purine-rich sequences in the other
strand which remain unmethylated. Therefore, it seems highly likely
that the expression of the c-MYC gene is regulated by the
methylation of the pyrimidine-rich strand of the NHE. Thus, we also
attempted to study the effect of methylation of the cytosine residues
in the NHE of the c-MYC promoter on the DNA-binding activity
of the THZif-1 protein.
To characterize the DNA-binding properties of THZif-1, we
performed an EMSA study in the presence of Mg2+ ions (5 mM), using the recombinant GST-THZif-1 fusion protein and a
single-stranded (ss) NHE oligodeoxynucleotide as a DNA probe. To
circumvent the insolubility of recombinant intact THZif-1 protein in
E. coli cells, we used the fusion construct with pGEX to
produce a soluble protein for our assays. As shown Fig.
2A, the THZif-1 protein had the capacity to
bind to the pyrimidine-rich strand of NHE (ss c-myc NHE-C).
The GST protein itself did not bind to any of the ss, ds, or ts
c-myc NHE oligodeoxynucleotides used in this study (data not
shown). It was also clear that a shifted DNA-protein complex appeared
when the concentration of THZif-1 protein was increased (position B1,
lane 2). When the dose of THZif-1 protein was increased
further, a new shifted band of a DNA-protein complex, which seemed to
be the complex of DNA with a dimer of the THZif-1 protein, appeared
(position B2, lanes 3 and 4). This result is
consistent with the previous results that the dimer of THZif-1 protein
had higher DNA-binding activity than that of the monomeric form of
THZif-1 protein (data not shown). Moreover, we were surprised that the
binding of THZif-1 to ss methylated NHE-C (ss c-myc
NHE-me5C) resulted in 2-fold higher affinity than that to
ss unmethylated NHE-C at all positions (compare lanes 2-4
with lanes 6-8; Table II). In contrast, the THZif-1 protein
did not bind to the purine-rich strand of NHE (ss c-myc
NHE-G) (lanes 10-12). When the reaction products were
treated with proteinase K, the shifted bands were lost in the case of
both the methylated and the unmethylated DNA probe (data not shown). In
addition, the antiserum raised against THZif-1 caused supershifting of
the DNA-protein complex (Fig. 2B). By contrast, the
preimmune serum had no such activity (Fig. 2B). Thus, we
concluded that these protease-sensitive bands really represented the
complexes between the THZif-1 protein and its target DNA.
Summary of results of the DNA-binding study with the THZif-1
protein
Volume 271, Number 49,
Issue of December 6, 1996
pp. 31322-31333
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
,,,,,
and**
Tsukuba Life Science Center, RIKEN (The
Institute of Physical and Chemical Research), 3-1-1 Koyadai, Tsukuba,
Ibaraki 305, Japan, the § Department of Mathematics,
Department of
Molecular Genetics, Beckman Research Institute of the City of Hope,
Duarte, California 91010
-deoxycytidine derivative of NHE (ss c-myc
NHE-me5C) than for the unmethylated NHE. In the case of the
binding of THZif-1 to methylated double-stranded (ds) NHE (ds
c-myc NHE-me5CG), no significant binding to the
DNA was observed. The decrease in binding to DNA of THZif-1 was
significant in the case of mutated ds c-myc NHE, in which
more than two sites of deoxycytidine residues were methylated. However,
the binding affinity of THZif-1 protein for methylated and for
unmethylated triple-helical DNA of the NHE was almost identical.
Moreover, the domain of the THZif-1 protein that made the major
contribution to binding to ss c-myc NHE-C or ss
c-myc NHE-me5C corresponded to the
amino-terminal second zinc finger motif. Taken together, the results
indicate that the THZif-1 protein exhibits preferential DNA-binding
activity with ss c-myc NHE-C, ds c-myc NHE-CG,
and ts c-myc NHE but not with ss c-myc NHE-G and ds c-myc NHE-me5CG in
vitro.
150 base pairs (bp1; counted
from the P1 initiation site) can repress transcription of
c-MYC from the P2 promoter in vitro (18, 19, 20, 21). This result suggests that the region around 150 bp of the
c-MYC promoter, which is rich in purine/pyrimidine sequences
and is also hypersensitive to nuclease (we named it a
nuclease-hypersensitive element III1 (NHE; 3, 12, 14, 17, 19-26), is
important for the transcription of the c-MYC gene. This
region is known as a putative intra- or intermolecular triple
helix-forming element (18, 19, 20, 27) that might serve as a target of a
specific transcription factor(s) needed for P2-directed expression.
Previous studies on triplex formation by polypurine/polypyrimidine
regions in gene promoters demonstrated the ability of a pyrimidine-rich
third strand to form Hoogsteen hydrogen bonds with the purine-rich
acceptor strand in the major groove of the target duplex (17). The
third strand in pyrimidine-purine-pyrimidine triple helices adapts a parallel orientation relative to the polypurine strand of the duplex
(28). The stability of a pyrimidine-purine-pyrimidine triplex is
dependent on nonphysiological acidic conditions required by the
C+GC triplexes that are responsible for sequence
specificity (29, 30, 31). In contrast, previous studies demonstrated
triplex formation by a purine-rich or mixed purine/pyrimidine third
strand that involved GGC and AAT or TAT triads at physiological pH
(32, 33, 34). These triple helices arise through reverse Hoogsteen bonding,
which results in the antiparallel orientation of the third strand (32,
35). Consistent with this view, it has been reported that this region
of the c-MYC protooncogene exerts a modest stimulatory
effect on P2-directed transcription and plays a much more important
role in utilization of the P1 promoter (15, 36, 37). Moreover, in a
recent report, Arcinas and Boxer (38) demonstrated that the
nuclease-hypersensitive sites III1 and III2 in the 5 end-flanking
region of the c-MYC gene exhibit a decrease in sensitivity
to DNase I during differentiation of HL60 cells. Thus, the changes in
DNase I-hypersensitive sites might be correlated with structural
changes in the NHE. Moreover, in vertebrate DNA, the cytosine residues
in the dinucleotide sequence CpG and homopurine/homopyrimidine stretches in the flanking regions of genes are often methylated. Such
CpG dinucleotides and homopurine/homopyrimidine stretches are often
found clustered within so-called CpG islands or
homopurine/homopyrimidine regions (29, 30, 39, 40). The presence of
unmethylated cytidine residues is indicative of the presence of active
genes. The 5 ends of most housekeeping genes are, for example, located within unmethylated CpG islands or unmethylated
homopurine/homopyrimidine regions (39, 40, 41). It was reported that the
methylation of cytosine strongly enhanced the stability of triplex DNA
(42) and that 5-methyl-2-deoxycytidine in single-stranded DNA directed the methylation of CpG sites on the same strand (43). The NHE in the
c-MYC promoter region can also be considered in these terms. It seems plausible that transcription factors that are involved in the
control of the expression of c-MYC during differentiation might bind near these DNase I-hypersensitive sites or that some modification of the NHE DNA might occur during the differentiation of
HL60 cells.
-Galactosidase activity
was assayed as described by Kimura et al. (61). The ratio of
CAT activity to that of -galactosidase was used for normalization of
results.
end radiolabeling
with [
-32P]ATP (5000 mCi/mmol; Amersham Japan, Tokyo,
Japan) and T4 polynucleotide kinase (Toyobo, Kyoto, Japan) that was
followed by gel electrophoresis (20%) under denaturing conditions and
by nucleotide sequencing. Sequences of the oligodeoxynucleotide probes
for studies of protein binding were as follows: 1) c-myc
NHE-G (purine-rich strand), 5-ggggagggtggggagggtggggaaggtggggagga-3;
2) c-myc NHE-m1G (purine rich-strand, mutant 1),
5-cccctgggtggcctgggtggccttggtggcctcct-3; 3) c-myc NHE-m2G
(purine-rich strand, mutant 2),
5-ggggaggcaccggaggcaccggaaccacgggagga-3; 4) c-MYC NHE-C
(pyrimidine-rich strand), 5-tcctccccaccttccccaccctccccaccctcccc-3; 5)
c-myc NHE-m1C (pyrimidine-rich strand, mutant 1),
5-aggaggccaccaaggccacccaggccacccagggg-3; 6) c-myc NHE-m2C
(pyrimidine-rich strand, mutant 2),
5-tcctcccgtggttccggtgcctccggtgcctcccc-3; 7) K-ras NHE-G
(purine-rich strand), 5-cgaggggagggagggaagggagggagggcg-3; 8)
K-ras NHE-C (pyrimidine-rich strand),
5-gctcccctccctcccttccctccctcccgc-3; 9) EGFR NHE-G
(purine-rich strand) 5-aggagcagaggaggaggagaatgcgaggaggaggga-3; 10) EGFR NHE-C (pyrimidine-rich strand),
5-tccctcctcctcgcattctcctcctcctctgctcct-3; 11) c-myc
NHE-me5C,
5-tMMtMMMMaMMttMMMMaMMMtMMMMaMMMtMMMM-3
(where M represents me5C); (12)
5-methyl-2-deoxycytidine derivatives with methylation of appropriate
positions in c-myc NHE were synthesized and their sequences
are summarized in Table I.
-deoxycytidine derivatives of c-mycNHE
DS oligomer
Sequence of oligomer
Binding of
THZif-1
1 5 10 15 20 25 30 35
c-myc
NHE-CG
5
tcctccccaccttccccaccctccccaccctcccc 3+
c-myc
NHE-me5CG
5
-MM-MMMM-MM-MMMM--MMM-MMMM-MMM-MMMM 3
mA
5
--M-------------------------------- 3+
mB
5
--M--M----------------------------- 3±
mC
5
--M--M----M--M--------------------- 3
mD
5
--M--M----M--M-----M---M----------- 3
mE
5
--M--M----M--M-----M---M----M----M- 3
mF
5
---------------------------------M- 3+
mG
5
----------------------------M----M- 3
mH
5
-------------------M---M----M----M- 3
mI
5
----------M--M-----M---M----M----M- 3
mJ
5
-----M----M--M-----M---M----M----M- 3
mK
5
-----M----------------------------- 3
mL
5
----------M------------------------ 3
mM
5
-------------M--------------------- 3
mN
5
-------------------M--------------- 3
mO
5
-----------------------M----------- 3
mP
5
----------------------------M------ 3
55 CAT were
constructed as described previously (57, 58, 59). The 493-bp
RsaI-Nae1 fragment, the 135-bp
RsaI-Nae1 fragment, and the 305-bp
SmaI-Nae1 fragment of the promoter region of
human c-MYC gene were recovered and ligated with
pHindIII linkers and inserted into the HindIII site in pSV00CAT (Nippon Gene Inc., Toyama, Japan). The triplicated NHE
was inserted into the BamHI site in pBL2CAT (=ptkCAT) under control of a promoter of the gene for thymidine kinase from herpes simplex virus-1 to generate ptk-NHE CAT (64). The entire cDNA for
THZif-1 was cloned into the EcoRI site of pGEX-3X
(Pharmacia Biotech, Uppsalà, Sweden) to generate
pGST-THZif-1. The regions encoding various appropriate zinc finger
portions of THZif-1 were amplified by PCR with DNA polymerase from
Pyrococcus furiosus (pfu; Stratagene, La Jolla,
CA) and the appropriate primers, as described below. Each DNA fragment
was digested with EcoRI or BamHI and cloned into
the EcoRI/BamHI site of pGEX-2T for production of
mutant GST-THZif-1 fusion proteins. Primers for PCR for genes for the
mutant forms of pGEX-THZif-1 were synthesized as follows (the numbers
correspond to position relative to the site of initiation of
translation): 1) GST-THZif-1, sense (nt 1)
5-tggatcctcgggtgctatgaagatgccg-3, antisense (nt 905)
5-agaattctcttcctcctttccttctggaggc-3; 2) GST-THZif-2, sense (nt 1)
5tggatcctcgggtgctatgaagatgccg-3, antisense (nt 601)
5-agaattcacagacatggtgaggaccctggctgt-3; 3) GST-THZif-3; sense (nt 1)
5-tggatcctcgggtgctatgaagatgccg-3, antisense (nt 515)
5-agaattcgcactttctcctcgtgtcgtactgtg-3; 4) GST-THZif-4, sense (nt 1)
5-tggatcctcgggtgctatgaagatgccg-3, antisense (nt 434)
5-agaattcagggccgttctgttgtgtgcacttg-3; 5) GSTTHZif-5, sense (nt 1)
5-tggatcctcgggtgctatgaagatgccg-3, antisense (nt 348) 5-agaattctagggcttctcacagcg-3; 6) GST-THZif-6, sense (nt 1)
5tggatcctcgggtgctatgaagatgccg-3, antisense (nt 247)
5-aggaattctcgtccgagtgcgacagctt-3; 7) GST-THZif-7, sense (nt 1)
5-tggatcctcgggtgctatgaagatgccg-3, antisense (nt 170)
5-agaattcttcttccggatgcgcttc-3; 8) GST-THZif-8, sense (nt 178)
5-tcggatcctgcgagatgtgtggcaaggc-3, antisense (nt 905)
5-agaattctcttcctcctttccttctggaggc-3; 9) GST-THZif-9, sense (nt 254)
5-tggatcctaccagtgcccggtgtgccag-3, antisense (nt 905)
5-agaattctcttcctcctttccttctggaggc-3; 10) GST-THZif-10, sense (nt 346)
5-tggatcctacaactgctcccactgtg-3, antisense (nt 905)
5-agaattctcttcctcctttccttctggaggc-3; 11) GST-THZif-11, sense (nt 424)
5-tggatccttcaaatgtgagaaatgtgaggc-3, antisense (nt 905)
5-agaattctcttcctcctttccttctggaggc-3; 12) GST-THZif-12, sense
(nt 501) 5-tggatccgaggagaaagtgccatgtcac-3, antisense (nt 905)
5-agaattctcttcctcctttccttctggaggc-3; and 13) GSTTHZif-13, sense
(nt 598) 5-tggatcctgcaacaaaggtactggtg-3, antisense (nt 905)
5-agaattctcttcctcctttccttctggaggc-3. 14) GST-THZif-14 was constructed
by ligation of constructs for GST-THZif-6 and GSTTHZif-10 via a
pHindIII linker to generate the in frame fusion protein. 15)
THZif-1 with a mutant second zinc finger, namely GST-THZif-15, was
generated by conversion of amino acids at positions 85 to 88 from CPVC
to RPVK (5-gtgcccggtgtg-3 to 5-ccgcccggtcaa-3) with a kit for
in vitro mutagenesis (Boehringer-Mannheim, Mannheim,
Germany). The entire cDNAs for THZif-1 and a mutant protein with a
mutated second zinc finger were cloned into the EcoRI
site of pcDNA 3 (Invitrogen, San Diego, CA) to generate pCMV-THZif-1 and pCMV-THZif-1m, respectively.
-D-thiogalactopyranoside when the absorption
of 595 nm (A595) of the culture had reached 0.6-0.8. After induction for 3 to 4 h at 30 °C, bacteria were harvested by centrifugation at 4,000 × g for 10 min.
Bacterial pellets were resuspended in 15 ml of phosphate-buffered
saline (PBS) with 1 mM phenylmethylsulfonyl fluoride, 2%
Nonidet P-40, and 2% Tween 20, and then cells were lysed by treatment
with 200 µg/ml lysozyme at room temperature. Bacterial DNA was
eliminated by treatment with 15 µg/ml DNase I in the presence of 20 mM MgCl2 and 2 mM MnCl2
for an additional 5 min at room temperature. The lysates were sonicated
three times for 20 s each with a UR-20P Sonicator (Tomy Seiko Co.,
Tokyo, Japan) at 40% output power. Lysates were clarified by
centrifugation at 12,000 × g for 20 min at 4 °C.
The supernatants were incubated with 300 µl of packed glutathione-agarose beads (Pharmacia) for at least 2 h at 4 °C. Beads were then washed in a column with PBS until
A280 was less than 0.002, and the protein was
eluted with 10 mM glutathione (Sigma) in
50 mM Tris (pH 8.0). The concentrations of protein were
estimated with a protein assay kit from Bio-Rad with bovine serum
albumin as the standard.
)), cells were harvested
and lysed in 100 µl (per 0.1 g of cells, wet weight) of lysis
buffer that contained 400 mM KCl, 10 mM Hepes
(pH 8.0), 15% (w/v) glycerol, 1 mM dithiothreitol, 0.1 mM phenylmethanesulfonyl fluoride (Sigma),
and 2.5 µg/ml each leupeptin, aprotinin, and pepstatin (all from
Sigma). After centrifugation at 40,000 × g at 4 °C for 15 min, each supernatant was divided into
aliquots and stored at 70 °C as described elsewhere (65). Cell
extracts were incubated on ice with 2 µg of poly(dI-dC) (Pharmacia)
in 20 µl of binding buffer (10 mM Hepes (pH 8.0), 4 mM MgCl2, 1 mM dithiothreitol, and
15% glycerol). After 10 min, the 32P-labeled probe
(c-myc NHE-CG) and competitor DNAs were added, and the
incubation was continued for 20 min. The reaction mixture was subjected
to electrophoresis on a 5% polyacrylamide gel in 0.5 × TBE (44.5 mM Tris, 44.5 mM boric acid, and 1.25 mM EDTA). The gel was dried and exposed to x-ray film at
80 °C. Monoclonal antibodies specific for SP-1 and for c-JUN
(Santa Cruz Biotech, Santa Cruz, CA) and polyclonal antiserum specific
for ZF87/Maz2 were used for the "supershifting"
experiment.
riple
elix-binding 
nc-
inger
protein-1) of the corresponding gene (60). The deduced THZif-1 is a
polypeptide of 253 amino acids with a molecular mass of 27,830 kDa.
Nucleotide sequencing of the cDNA for THZif-1 demonstrated the
extremely high degree of similarity to the Myc-associated zinc finger
protein ZF87/Maz and to another zinc finger protein, Pur-1, that binds
to purine-rich sequences (98.2 and 96.9% homology, respectively, at
the amino acid level; 53-55). It appears that THZif-1 is a member of
the ZF87/Maz (or Pur-1) family. However, the DNA sequence that encodes
the second zinc finger motif is different from that of the gene for
ZF87/Maz (33.3% homology at the amino acid level). Therefore, THZif-1
seems to be a protein that is similar to but distinct from ZF87/Maz.
This conclusion is reflected by the difference in size of the
corresponding mRNAs (1.6 versus 2.6 kilobase pairs) and
the distribution of THZif-1 mRNA in human tissue. Furthermore, a
major difference is that the THZif-1 protein regulates the expression
of the c-MYC gene in a negative manner, whereas the ZF87/MAZ
protein up-regulates the expression of this gene (54, 55). However, we
cannot rule out the possibility that THZif-1 might be a product of a
transcript that is differentially spliced after transcription from the
same genomic sequence as that encoding ZF87/Maz.
55CAT; Fig. 1A). A
significant reduction in the promoter activity of the c-MYC
gene was observed 2 days after the short of treatment with
12-O-tetradecanoyl-phorbol-13-acetate (TPA; lanes
9-12). This reduction was similar to that in the case of pMycCAT2
(lanes 1-4). However, the deletion reporter construct of
c-myc NHE did not show such a repression (lanes
5-8). Thus, the intrinsic activity of the c-myc NHE
reflects the fact that the c-myc NHE is one of the major
regulatory elements in the expression of the c-MYC gene
during the differentiation of HL60 cells. Therefore, the
characterization of factors that bind to c-myc NHE is
important if we are to understand the mechanism of repression of the
c-MYC promoter during the differentiation of HL60 cells
(52, 53, 54, 55, 56, 57, 58, 59).
Fig. 1.
55CAT (58) or pSV00CAT,
3 µg of pSV2neo (61), and 5 µg of pCH110 (61) were used to
transfect HL60 cells to obtain the respective stably transformed
clones. These clones were treated with TPA (Sigma) at
10
6 M as described elsewhere (57, 58, 59), and
respective cell lysates prepared 24, 48, and 120 h after treatment
with TPA were analyzed for CAT activity. The percent conversion of
chloramphenicol to its acetylated form is indicated. Results typical of
one of five independent assays are shown. B, the second zinc
finger motif of pTHZif-1 is responsible for the c-myc
NHE-mediated repression of transcription of the c-MYC gene.
Five µg of pMycRNCAT (58), pMycRN55CAT (58), ptkCAT (64), or
ptk-NHECAT (64), 3 µg of pSV2neo (61), and 5 µg of pCH110 (61) were
used to cotransfect HL60 cells together with (lanes 1, 4, 7, 10, 13, 16, 19, and 22) or without (lanes 2, 5, 8, 11, 14, 17, 20, and 23) the pCMV-THZif-1 expression
plasmid (5 µg) or with (lanes 3, 6, 9, 12, 15, 18, 21, and
24) the plasmid that encoded the protein with a mutant second zinc finger, pTHZif-1m (5 µg). After incubation with G418 (500 µg/ml) for 4 weeks, the respective stably transformed clones were
isolated. Cell lysates were prepared and analyzed for CAT activity as
described under "Materials and Methods." The percent conversion of
chloramphenicol to its acetylated form is indicated. Results typical of
one of five independent assays are shown. C, effects of
THZif-1-specific antibodies on the DNA-protein complex in the
DNA-binding assay. Nuclear extracts (4 µg) from TPA-treated differentiated HL60 cells were incubated on ice for 30 min without (lane 2) or with 2 µg of affinity-purified
THZif-1-specific polyclonal antibodies in the presence (lane
4) or absence (lane 3) of 5 µg of GST-THZif-1 protein
or monoclonal antibodies (1.5 µg) against SP-1 (lane 6) or
c-JUN (lane 7) or 3 µg of affinity purified MAZ-specific polyclonal antibodies (lane 8) or rabbit preimmune IgG serum
(control, lane 5). Then mixtures were analyzed in the
DNA-binding assay with 38-meric c-myc NHE-CG as probe (see
"Materials and Methods"). Lane 1, without nuclear
extracts. The arrowhead indicates the supershifted complex
and arrowheads labeled B indicate shifted DNA-protein
complexes. F, free DNA probe. An open star
indicates the nonspecific shifted bands.
[View Larger Version of this Image (46K GIF file)]
55CAT) was not (lanes 1, 2, 4, and 5).
Moreover this repression activity was not detected in the case of
THZif-1 mutant construct of second zinc finger motif (lanes
3 and 6). These results indicate that at least the
second zinc finger motif of THZif-1 protein is corresponded to the
regulated expression of c-MYC-CAT reporter gene in HL60 cells. Similarly, we also observed a reduction in CAT activity in the
case of the tk promoter-CAT with NHE (ptk-NHECAT) (lanes 7, 8, 10, and 11). We observed that the CAT activity of
pMycRNCAT was reduced in the differentiated HL60 cells (7-fold
reduction; lanes 13 and 14) and, however, the CAT
activity of pMycRN55CAT was not affected (lanes 16 and
17). We detected the similar reduction of ptk-NHECAT in the
differentiated HL60 cells. It is clear that this repression was also
detected at a significant level in U937 cells but not in F9 or P19
embryonic carcinoma cells (data not shown). These variations in CAT
activity might reflect variations in endogenous levels of THZif-1
protein in the respective cells (data not shown). These data suggest
that at least THZif-1 protein, one of the transcription factors that
bind to the NHE, is involved in the NHE-mediated negative regulation of
the transcription of the c-MYC gene.
Fig. 2.
Electrophoretic mobility shift assay (EMSA)
of the binding of the GST-THZif-1 fusion protein to single-stranded
methylated and unmethylated c-myc NHE-C. A,
indicated amounts of GST-THZif-1 protein were incubated with
32P-radiolabeled ss c-myc NHE-C
oligodeoxynucleotide (lanes 1-4) or with the
5-methyl-2-deoxycytidine derivative (ss c-myc
NHE-me5C; lanes 5-8) or with ss
c-myc NHE-G oligodeoxynucleotide (lanes 9-12) at
4 °C for 60 min. Resultant complexes were resolved in nondenaturing
4% polyacrylamide gels. The concentrations of GST-THZif-1 protein were
as follows: lanes 1, 5, and 9, no GST-THZif-1
protein; lanes 2, 6, and 10, 0.2 µg;
lanes 3, 7, and 11, 0.3 µg; lanes 4, 8, and 12, 0.4 µg, respectively. B1 and
B2, DNA-protein complexes; F, free DNA probe. The
GST protein as a control did not bind to the DNA probes of ss
c-myc NHE-C, ss c-myc NHE-me5C, and
ss c-myc NHE-G. B, effect of antiserum against
THZif-1 protein on the migration of the DNA-protein complex in the
EMSA. Lanes 1 and 8, without antiserum;
lanes 2-4 and 9-11, in the presence of
preimmune antiserum; lanes 5-7 and 12-14, in
the presence of antiserum against THZif-1; lanes 2, 5, 9,
and 12, 104 dilution of antiserum; lanes
3, 6, 10, and 13, 103 dilution of
antiserum; lanes 4, 7, 11, and 14,
102 dilution of antiserum. The upper and
lower arrowheads indicate the supershifted band of the
DNA-protein complex and the DNA-protein complex between ss
c-myc NHE and THZif-1 protein, respectively.
[View Larger Version of this Image (61K GIF file)]
Substrate
Kd(app)a
µm
Single-stranded c-myc NHE-C
0.077
Single-stranded c-myc NHE-me5C
0.04
Double-stranded c-myc NHE-CG
4.3
Double-stranded
c-myc NHE-me5CG
>100.0
Triple-stranded
c-myc NHE-CGG
0.89
Triple-stranded c-myc
NHE-me5CGG
0.80
a
Kd(app), apparent
dissociation constant of THZif-1 protein for DNA probes of NHE of
c-myc protooncogene.
ABSTRACTUnder the same conditions
as the EMSA for which results are shown in Fig. 2, we performed a
competition experiment using various single strand unmethylated
oligodeoxynucleotides that corresponded to the known CT-elements
reported by other investigators (45). As shown in Fig.
3A, the non-radiolabeled
oligodeoxynucleotides that corresponded to the pyrimidine
rich-strand of c-myc NHE (ss c-myc NHE-C)
competed for binding to the THZif-1 protein (lane 3). In
addition, the methylated oligodeoxynucleotide that corresponded to the
pyrimidine-rich strand of c-myc NHE (methylated to yield the
me5C derivative of the pyrimidine-rich strand of
c-myc NHE, ss c-myc NHE-me5C) as a
competitor gave a similar result (lane 4). We mutated the
oligodeoxynucleotides by changing pyrimidine-rich sequences of the NHE
to purine residues and analyzed their effects. Mutated oligodeoxynucleotides, such as ss c-myc NHE m1C and m2C, did
not compete for binding to THZif-1 with radiolabeled ss
c-myc NHE-C. The oligodeoxynucleotides corresponding to
other NHEs, included K-ras and EGFR
(K-ras NHE-C; EGFR NHE-C), clearly competed for binding to THZif-1 with ss c-myc NHE-C (lanes 7 and 8). Similarly, we also examined competition with the
radiolabeled methylated pyrimidine-rich strand of DNA (ss
c-myc NHE-me5C) as a probe. As shown in Fig.
3B, the competition pattern obtained with each inhibitor was
almost the same as in the case with the DNA probe of ss
c-myc NHE-C, with the exception of patterns obtained with
K-ras and EGFR NHE-Cs. The competition by the
oligodeoxynucleotides that corresponded to K-ras and
EGFR NHEs in the formation of DNA-protein complexes with ss
c-myc NHE-me5C as DNA probe was weak as compared
with that with the ss c-myc NHE-C as probe DNA (lanes
7 and 8 in Fig. 3, A and B). The
competition with the methylated forms of K-ras and
EGFR NHEs was complete when each homologous DNA was used as
probe (data not shown). Thus, the DNA-binding specificity of the
THZif-1 protein to the NHEs of K-ras or EGFR
might be slightly different from the binding to the NHE of
c-MYC gene. These results imply that the sequence specificity of the binding to DNA of THZif-1 protein is restricted to
single-stranded pyrimidine-rich sequences of c-myc NHE,
irrespective of the presence or absence of methylation. The neu-1,
neu-2, and Y-box NHEs, as well as poly(dC)12-18 and
poly(dT)12-18, did not compete in the binding of
GST-THZif-1 protein to ss c-myc NHE-C (45; data not shown).
Thus, it appears that the THZif-1 protein binds preferentially to the
pyrimidine-rich ss DNA of the c-myc NHE (ss
c-myc NHE-C) in a sequence-specific manner.
Fig. 3. Specificity of the binding to DNA of the THZif-1 protein. A, competition for binding of GST-THZif-1 protein to ss c-myc NHE-C. The GST-THZif-1 protein was incubated with a 100-fold molar excess of the indicated unradiolabeled oligodeoxynucleotides as competitors for 10 min at 4 °C and then mixed with the radiolabeled c-myc NHE-C oligodeoxynucleotides and incubated further for 50 min. The resultant DNA-protein complexes were resolved in a nondenaturing 4% polyacrylamide gel. Lane 1, without GST-THZif-1 protein; lanes 2-8, 0.2 µg of GST-THZif-1 protein; lane 3, ss c-myc NHE-C; lane 4, ss c-myc NHE-me5C; lane 5, ss c-myc NHE-m1C; lane 6, ss c-myc NHE-m2C; lane 7, ss K-ras NHE-C; lane 8, ss EGFR NHE-C. B, DNA-protein complex; F, free DNA probe. B, competition for binding of GST-THZif-1 protein to ss c-myc NHE-me5C. The GST-THZif-1 protein was incubated with the indicated unradiolabeled oligodeoxynucleotides as competitors at a 100-fold molar excess for 10 min at 4 °C and then mixed with radiolabeled c-myc NHE-me5C oligodeoxynucleotide and incubated for another 50 min. The resultant DNA-protein complexes were resolved in a nondenaturing 4% polyacrylamide gel. Lane 1, without GST-THZif-1 protein; lanes 2-8, 0.2 µg of GST-THZif-1 protein; lane 3, ss c-myc NHE-C; lane 4, ss c-myc NHE-me5C; lane 5, ss c-myc NHE-m1C; lane 6, ss c-myc NHE-m2C; lane 7, ss K-ras NHE-C; lane 8, ss EGFR NHE-C. B, DNA-protein complex; F, free DNA probe.
[View Larger Version of this Image (50K GIF file)]
Binding to Double-stranded Unmethylated or Methylated c-myc NHE
We prepared unmethylated DNA probes from the double-stranded
(ds) NHE of the c-MYC gene, whose pyrimidine-rich strand or
the purine-rich strand had been radiolabeled. Each probe was isolated from a nondenaturing gel as described under "Materials and
Methods." The DNA-binding activity of THZif-1 protein was analyzed by
the EMSA. As shown in Fig. 4A, a shifted band
(band B) appeared, and the formation of the DNA-protein
complex was dose-dependent in the case of ds
c-myc NHE-CG, of which pyrimidine-rich strand was radiolabeled (lanes 1-4). However no shifted bands were
detected with the tested range of concentrations of THZif-1 protein in the case of ds c-myc NHE-me5CG, of which all
cytosine residues were methylated (lanes 5-8). When the ds
c-myc NHE-CG, of which the purine-rich strand had been
radiolabeled, was used, the similar shifted band (band B) and the formation of the DNA-THZif-1 protein complex appeared (Table
I). Thus we conclude that the THZif-1 protein has an
ability to bind the ds c-myc NHE-CG.
Fig. 4. Binding of THZif-1 protein to ds c-myc NHE-CG. A, comparative binding of GST-THZif-1 protein to all 5-methyl-2
-deoxycytidine (me5C)
or unmethylated ds c-myc NHE. The indicated amount of the
recombinant fusion protein GST-THZif-1 was incubated with duplex
c-myc NHE that consisted of radiolabeled c-myc
NHE-C (lanes 1-4) or c-myc NHE-me5C
(lanes 5-8) and unradiolabeled c-myc NHE-G for
60 min at 4 °C. The resultant DNA-protein complex was resolved in
nondenaturing 4% polyacrylamide gels. Lanes 1 and
5, without GST-THZif-1 protein; lanes 2 and
6, 1 µg of GST-THZif-1 protein; lanes 3 and
7, 4 µg of GST-THZif-1 protein, and lanes 4 and
8, 8 µg of GST-THZif-1 protein. B, DNA-protein
complex; F, free DNA probe. The GST protein did not bind to
the DNA probe of ds c-myc NHE-CG. B, competition for binding of GST-THZif-1 protein to ds c-myc NHE-CG. The
indicated unlabeled duplex DNAs, as competitors, at a 100-fold molar
excess were incubated with GST-THZif-1 protein (4 µg) after 10 min at 4 °C, and then the 32P-radiolabeled ds c-myc
NHE-CG (radiolabeled DNA strand is c-myc NHE-C) was added as
DNA probe, and the mixture was incubated for another 50 min at 4 °C.
The resultant complexes were resolved in nondenaturing 4%
polyacrylamide gels. Lane 1, without GST-THZif-1 protein;
lane 2, without competitor DNA; lane 3, ds
c-myc NHE-CG; lane 4, ds c-myc
NHE-m1CG; lane 5, ds c-myc NHE-m2CG; lane
6, ds K-ras NHE-CG and ds EGFR NHE-CG.
B, DNA-protein complex; F, free DNA probe.
C, effects of antiserum against the THZif-1 protein on the
migration of the DNA-protein complex in the EMSA. Lane 1,
without antiserum; lanes 2-4, addition of preimmune
antiserum; lanes 5-7, addition of antiserum against
THZif-1. Lanes 2 and 5, 104
dilution of antiserum; lanes 3 and 6,
103 dilution of antiserum, lanes 4 and
7, 102 dilution of antiserum. The
upper and lower arrowheads indicate the
supershifted bands of the DNA-protein complex and the DNA-protein complex between ds c-myc NHE-CG and the THZif-1 protein,
respectively. DNA probe was prepared as in A.
[View Larger Version of this Image (45K GIF file)]
We next examined the sequence specificity of the binding of THZif-1 protein to ds c-myc NHE-CG. As shown in Fig. 4B, oligodeoxynucleotides with the same sequence as ds c-myc NHE-CG competed for binding of THZif-1 protein (lanes 4 and 5) while the mutant oligodeoxynucleotides of ds c-myc NHE-CG did not have such inhibitory activity. It is noteworthy that ds NHE-CG of K-ras competed for the binding of THZif-1 protein with ds c-myc NHE-CG, but this was not the case for ds NHE-CG of EGFR (lanes 6 and 7). The differential binding of THZif-1 to the ds NHEs might have been due to the higher degree of similarity between the sequence of the NHE-CG of the K-ras gene and that of the c-MYC gene than is the case for EGFR NHE-CG. Antiserum against THZif-1 caused supershifting of the DNA-protein complex, an indication that the THZif-1 protein is included in this DNA-protein complex (Fig. 4C). Therefore, the sequence specificity of the binding to DNA of the THZif-1 protein was more restricted in the case of the ds NHE-CG of the c-MYC gene, even though the binding affinity for the ds NHE was lower than for the ss c-myc NHE-C (Table II). The specificity of the binding of the THZif-1 protein to the ds NHE-CG might be slightly different from that of ss c-myc NHE-C.
We then examined the DNA-binding activity of the THZif-1 protein to
various forms of double-stranded c-myc NHE-CG, in which the
deoxycytidine residues were methylated at different positions (Fig.
5, Table I). To our surprise, the ds c-myc
NHE probes, in which deoxycytidine residues at positions 3 or 33 were
methylated, bound THZif-1 (Fig. 5). However, methylation at additional
positions of NHE resulted in the absence of specific DNA-binding
activity of THZif-1 (Fig. 5). These results are summarized in Table I. These data indicate that the effect of methylation of deoxycytidine residues at at least two positions, namely 3 and 6 (or 29 and 33), in
c-myc NHE resulted in a decrease in the DNA-binding activity of the THZif-1 protein (Table I and Fig. 5).
Fig. 5. Binding of the THZif-1 protein to various 5-methyl-2
-deoxycytidine derivatives of ds c-myc
NHE-CG. Eight µg of the recombinant fusion protein
GST-THZif-1 were incubated with the indicated
5-methyl-2-deoxycytidine derivatives with methylation at various
positions in c-myc NHE. The reaction mixtures conformed to
radiolabeled c-myc NHE-G and unlabeled c-myc
NHE-C oligodeoxynucleotides and were incubated for 60 min at 4 °C.
The resultant DNA-protein complexes were resolved in nondenaturing 5%
polyacrylamide gels. In some cases, the unlabeled double-stranded
oligodeoxynucleotides, as competitors, were incubated at 100-fold molar
excess with GST-THZif-1 protein (4 µg) after 10 min at 4 °C, and
then the 32P-radiolabeled 5-methyl-2-deoxycytidine
derivatives of ds c-myc NHE-CG were added as DNA probes, and
mixtures were incubated for another 50 min at 4 °C. Lanes
1 and 2, without GST-THZif-1 protein; lanes
3 and 4, 4 and 8 µg of GST-THZif-1 protein,
respectively; lane 5, ds c-myc NHE-CG, and
lane 6, ds c-myc NHE-m1CG. Lane 1, the
DNA probe was radiolabeled ss c-myc NHE-G; lane
2, the DNA probe was a 5-methyl-2-deoxycytidine derivative of ds
c-myc NHE-CG. B(ds), DNA-protein
complex. F(ss), the free DNA probe, namely ss
c-myc NHE-G; F(ds), the free DNA
probe, namely a 5-methyl-2-deoxycytidine derivative with methylation
at appropriate positions in ds c-myc NHE-CG. As defined in
Table I, A, mA; B, mB; C, mF;
D, mC; E, mG; F, mH; G, mK,
H, mP.
[View Larger Version of this Image (111K GIF file)]
We compared the Kd values of the THZif-1 protein for its binding to various ss, ds, or ts forms of the c-myc NHE (Table II). It was clear that the THZif-1 protein had lower affinity for ds c-myc NHE-CG. The binding avidity of THZif-1 protein for ds c-myc NHE-CG was about 50-fold lower than that for ss c-myc NHE-me5C (all positions were methylated). Therefore, the methylation of the ds NHE of the c-MYC gene might be critical to the regulation of the affinity of the DNA for the THZif-1 protein, at least under our assay conditions.
Potential Triple-helical Structure of the NHE of the c-MYC GeneWe examined the structural differences associated with the
formation of the triple-helical structure CGG with respect to the effect of methylation of the pyrimidine-rich strand of c-myc
NHE (CGG versus me5CGG). We radiolabeled the
oligodeoxynucleotides that corresponded to the pyrimidine-rich strand
and the methylated me5C-derivatives of NHE-C and tested the
capacity for triplex formation at a given concentration of the
pyrimidine-rich strand, after addition of increasing amounts of the
oligodeoxynucleotides that corresponded to the purine-rich strand of
the NHE-G in the presence of 5 mM Mg2+ ions
(Fig. 6). In both cases (Fig. 6, A and
B) slowly migrating bands corresponding to double-stranded
and triple-stranded NHEs appeared, and that formation was dependent on
the concentration of the unlabeled purine-rich
oligodeoxynucleotides that corresponded to NHE-G. However, in the
absence of Mg2+ ions, we did not detect the triple-helical
NHE on gels, and we only found the shifted band corresponded to the ds
NHE (Fig. 6, C and D). Then we radiolabeled the
purine-rich NHE-G of the c-MYC gene, and the pyrimidine-rich
strand of the NHE-C or the methylated pyrimidine-rich
NHE-me5C was then added to the reaction mixture at a given
concentration of the radiolabeled purine-rich NHE-G, in an attempt to
produce a triplex such as CGC+ or CGCme at both
acidic and neutral pH. We detected only the ds DNA-protein complex and
no triple-helical DNA-protein complex, no matter what the acidic or
neutral pH (data not shown). Thus, we concluded that the NHE of the
c-MYC gene was able to form a
Mg2+-dependent triplex, such as CGG and
me5CGG, irrespective of the methylation of NHE-C. There was
no difference in the extent of the migration of the triple complex that
consisted of unmethylated NHE or methylated NHE of c-MYC
gene on a gel (Fig. 6). Moreover, we did not detect any significant
difference in Kd values for binding of THZif-1
protein to the ts DNA probe when the probe was in an unmethylated or a
methylated form (Table II).
Fig. 6. EMSA of CGG and me5CGG triplex formation with human c-myc NHE. The indicated amounts of unlabeled ss c-myc NHE-G oligodeoxynucleotide were added to a reaction mixture that consisted of 32P-radiolabeled ss c-myc NHE-C (A and C) or c-myc NHE-me5C (B and D) oligodeoxynucleotides in the presence (A and B) or absence (C and D) of 2 mM Mg2+ ions. After heating of the reaction mixture at 70 °C for 15 min, the mixture was gradually cooled to room temperature. The resultant mixtures were analyzed on nondenaturing 12% polyacrylamide gels. A and B, lane 1, without unlabeled c-myc NHE-G; lanes 2-8, the amount of unradiolabeled c-myc NHE-G was 1, 2, 4, 8, 16, 36, and 80 pmol, respectively. C and D, lane 1, without unlabeled c-myc NHE-G; lane 2, 1 pmol of c-myc NHE-G; lane 3, 8 pmol of c-myc NHE-G; lane 4, 16 pmol of c-myc NHE-G. The positions of ss, ds, and ts DNA are indicated by S, D, and T, respectively.
[View Larger Version of this Image (55K GIF file)]
Domains of the THZif-1 Protein That Bind to Unmethylated and Methylated ss-NHEs
In view of observations that the binding to DNA of the THZif-1 protein is specific for ss c-myc NHE-C and for the methylated derivative of the NHE of the c-MYC gene (ss c-myc NHE-me5C), we next attempted to identify the domain(s) of the THZif-1 protein required for the specific binding to the DNA. We constructed a set of serially deleted mutant GST-fusion proteins with removal of each zinc finger motif of THZif-1 from either the amino terminus or the carboxyl terminus, and we examined their binding to the ss pyrimidine-rich NHE-C in both its methylated and its unmethylated form (Fig. 7). We compared the radioactivity of the shifted bands of DNA-protein complexes relative to the total radioactivity of the input DNA probe and calculated the relative DNA-binding efficiency based on the binding avidity of clone 1 as a control, which encoded the intact recombinant GST-fusion protein with five zinc fingers and for which the results are indicated as 100%. With ss c-myc NHE-C as probe, the mutant construct without the fifth finger motif in the carboxyl-terminal region had about half the DNA-binding activity of the intact GST-THZif-1 fusion protein (see Fig. 7, lines 2 and 3). The mutant without the carboxyl-terminal four fingers exhibited an approximately 5-fold reduction in DNA-binding activity, as compared with that of clone 5 (Fig. 7, lines 5 and 6). We next examined a series of constructs with deletions from the amino terminus of the THZif-1 protein. Loss of the second amino-terminal zinc finger resulted in a significant reduction in the binding to ss c-myc NHE-C (Fig. 7, lines 9 and 10). In the case of amino-terminal deletions, we did not detect any contribution of the fifth finger motif of the THZif-1 protein to DNA-binding activity. Thus, the second amino-terminal zinc finger motif seemed to play a crucial role in the binding to ss c-myc NHE-C. The methylated NHE-me5C was used as the DNA probe in the same assays, and slightly different specificities of binding to DNA were obtained with various mutant proteins. The carboxyl-terminal deletion of three zinc fingers caused a 50% reduction in binding to DNA (Fig. 7, lines 4 and 5), and the deletion of four carboxyl-terminal zinc fingers resulted in a 4-fold reduction in DNA-binding activity as compared with that of clone 5 (lines 5 and 6). The results with the amino-terminally deleted GST-THZif-1 protein yielded a similar conclusion (lines 9-11). The second and third zinc fingers of the THZif-1 protein, counted from the amino terminus, and in particular the second finger motif, were important for binding of THZif-1 protein to ss c-myc NHE-me5C. Therefore, it appears that