INTRODUCTION

Proteinase-3 (PR-3,¹ synonyms: myeloblastin and azurophil granule protein 7; AGP-7) a neutral serine proteinase with a broad spectrum of proteolytic activity is stored in the azurophil granules of polymorphonuclear leukocytes (PMNL) (1, 2). PR-3 is similar to but distinct from two other azurophil serine proteinases, human leukocyte elastase (HLE) and cathepsin G (Cat G). Physiologically, PR-3 may assist in the killing (3) and digestion (4) of bacteria and in the movement of PMNL through the basement membrane at sites of inflammation (5). Pathologically, since PR-3 degrades connective tissue proteins (6, 7, 8), it is potentially an important factor in destructive inflammatory diseases such as emphysema (1), the adult respiratory distress syndrome, rheumatoid arthritis, and glomerulonephritis (9). PR-3 cleaves the nuclear factor-B subunit (10) and also degrades the 28-kDa mammalian heat shock protein (11), previously linked to the differentiation of normal and neoplastic cells. As myeloblastin, PR-3 was implicated in the growth and differentiation of leukemic cells (12, 13). Perhaps most importantly, PR-3 is the antigen recognized by cytoplasmic staining by anti-neutrophil cytoplasmic antibodies present in patients with Wegener's granulomatosis (14, 15, 16).

PR-3 is found in cells of myeloid lineage, and its mRNA synthesis is confined to the promyelocytic stage of maturation. Upon differentiation beyond the promyelocytic stage, PR-3 is coordinately down-regulated along with HLE and Cat G.

The human gene for PR-3 has been characterized (17) and localized to chromosome 19 p13.3 (17), within 3 kb of HLE and 8 kb of azurocidin (an homologous protein with bactericidal but no proteolytic activity) forming a second serine proteinase gene cluster (18). A Cat G family of serine proteinases is located on chromosome 14 q11-12 (19, 20).

Because of its important physiologic and pathologic roles, understanding the mechanisms of PR-3 gene expression is fundamental to the control of PR-3 expression and to the development of new therapeutic strategies for Wegener's granulomatosis or emphysema. In this report we examined the human PR-3 promoter and identified two elements, a PU.1 binding site and a cytidine-rich site, important in PR-3 gene expression. A PU.1 site and a cytidine-rich site are also present in the promoters of HLE (21) and Cat G (22). These two elements appear to constitute major regulatory regions for the lineage and stage-specific expression of azurophil serine proteinases.

EXPERIMENTAL PROCEDURES

RPMI 1640, antibiotics, sodium pyruvate, non-essential amino acids, the Cell-Porator, and 0.4-cm electroporation cuvettes were from Life Technologies, Inc. Defined fetal calf serum was from Hyclone (Logan, UT). -³⁵S-dATP (1000 Ci/mmol), [-³²P]dCTP (3000 Ci/mmol), and [-³²P]ATP (6000 Ci/mmol) were from Amersham Corp. Qiagen tip-500 plasmid DNA kits were from Qiagen (Chatsworth, CA). Sephadex G-25 columns were from Intermountain Scientific (Salt Lake, UT). Protein reagent was from Bio-Rad. pGL3 vectors, luciferase, and molecular biology reagents were from Promega (Madison, WI). Polymerase chain reaction (PCR) reagents and the Gene-Amp PCR system 9600 were from Perkin-Elmer. Oligonucleotides were synthesized by the DNA/Peptide Facility, University of Utah (supported in part by National Cancer Institute Grant CA42014). All other reagents not specified were from Sigma.

Sequencing of the Human PR-3 5-UTR

The human PR-3 clone was a 40-kb human genomic DNA insert isolated by hybridization with human PR-3 cDNA probes. The cosmid library was constructed with DNA from normal peripheral blood lymphocytes and was a generous gift from Dr. R. Lemons. This clone contained 680 bp of the 5-upstream region of human PR-3. Sequence analysis of both strands was performed with the dideoxy chain termination method (23). Transcription factor binding sites were identified by searching the Gosh data base of previously identified sites (24).

U937, HL-60, PLB 985, and K562 cell lines were grown in RPMI 1640 supplemented with sodium pyruvate, non-essential amino acids, 10% fetal calf serum, and antibiotics to a density of 10⁶ cells per ml. Differentiation of U937, HL-60, and PLB 985 toward monocytic cells was obtained by adding 100 ng/ml phorbol myristate acetate (PMA) for 72 h. This dose of PMA was not toxic. The cells were grown at high densities (1-5 × 10⁶ cell/ml). Differentiation of HL-60 and PLB 985 cells toward granulocytes was achieved by growing the cells in retinoic acid (10⁶ M) for 24 h and then supplementing with dimethylformamide (DMF, 60 mM) for an additional 48 h (25).

Transient Transfection of the PR-3 5-UTR

pGL3 luciferase reporter vectors were used for assay of promoter activity. Fragments were generated using PCR and cloned into the BglII site of the pGL3 basic vector that contains no promoter or enhancer. All constructs were sequenced to determine correct insertion and proper orientation for functional promoter activity and to ensure no PCR-introduced errors. Specific mutations were constructed using PCR to insert primers containing the desired mutation. The PCR-derived fragments were cloned into pGL3 basic vector and sequenced to ensure that the mutation was correct and that no PCR-derived errors had occurred. Plasmid DNA for transfection was prepared using Qiagen tip-500 columns and frozen at 80 °C in 20-µg aliquots to prevent repeated freezing and thawing and to minimize handling. The DNA was not linearized prior to transfection. Three separate plasmid preparations were used for each construct to ensure that any change in efficiency was not a result of variation in the quality of DNA. The pGL3 control vector with promoter and enhancer activity was used to optimize transfection conditions for each cell line and as a positive control in each experiment. Using the pGL3 control vector, the most efficient conditions for transfection of K562 cells were 10⁷ cells/ml and 240 V at 1180 µF using a Cell-Porator and 0.4-cm cuvettes. Preparation of the cells and electroporation was as described by Baum et al. (26). The pSV -galactosidase plasmid (10 µg) was co-transfected with 20 µg of the experimental pGL3 construct. Twenty-four hours after transfection the cells were lysed in 1 × lysis buffer, and luciferase activity was measured. -Galactosidase enzyme activity and the protein content of each sample were determined to correct for transfection efficiency and cell number. At least three independent transfections in triplicate were carried out to determine the reporter activity of the different constructs.

Nuclear extracts were prepared from U937, HL-60, PLB 985, K562, and HeLa cells. For each extract 10⁸ cells/ml were harvested by centrifugation and washed twice with ice-cold phosphate-buffered saline. Nuclear proteins were obtained as described by Digman et al. (27) with the addition of proteinase inhibitors as follows: 1 mM phenylmethylsulfonyl fluoride, 1 µg/ml pepstatin A, 0.5 µg/ml chymostatin, 1 µg/ml antipain, 1 µg/ml leupeptin, and 4 µg/ml aprotinin. Protein concentrations of the extracts were determined spectroscopically using the Bio-Rad protein reagent. Aliquots of the nuclear extracts were frozen at 80 °C to prevent repeated freezing and thawing.

The following probes were generated. Initially, consecutive fragments (60-80 bp) of the entire 680-bp 5-upstream sequence of human PR-3 gene were generated using specific primers and PCR and analyzed by EMSA. Coupled with deletion analysis using reporter gene constructs, "hot-spots" were identified. Wild type and mutant constructs of these hot-spots were analyzed using duplex oligonucleotides as probes. Sense and antisense probes were annealed immediately prior to use by heating to 95 °C for 5 min and returning to room temperature over 30 min. After annealing, the duplex was labeled with [-³²P]ATP using T4 polynucleotide kinase (Promega). Free radionucleotide was removed using a Sephadex G-25 column.

Each probe (0.5 ng) was incubated with 10 µg of nuclear extract in 20 µl containing a final concentration of 10 mM Hepes, pH 7.5, 50 mM KCl, 5 mM MgCl₂, 1 mM dithiothreitol, 1 mM EDTA, and 5% glycerol plus 0.5 or 5 µg of poly(dI-dC) to reduce nonspecific binding. In some experiments unlabeled competitor probes were added to the nuclear extracts immediately prior to the addition of the radionucleotide probe. Incubations were carried out for 20 min at room temperature. Reactions were electrophoresed at 14 V/cm for 11/2-2 h on a 6% nondenaturing polyacrylamide gel cast in 0.5 × TBE (45 mM Tris borate, 45 mM boric acid, 1 mM EDTA) at 4 °C. Antibody supershifts were performed by adding 1 µl of a PU.1 rabbit antiserum against an amino-terminal peptide (a generous gift from Dr. R. Maki) or 1 µl of control rabbit serum to the nuclear extract and preincubating on ice for 15 min. The radiolabeled probe was then added, and the reaction was incubated for a further 15 min on ice. The complex was electrophoresed as above.

The method was essentially that of Wu et al. (28). Labeled hot-spot probes were incubated with nuclear protein extracts as above and then run on a 1% low-melting agarose gel until the bromphenol dye front has migrated about 5 cm. The gel was wrapped in Saran Wrap, placed upside-down on a UV transilluminator, and covered with ice to prevent overheating. The gel was irradiated for 7 min with UV light (300 nM) and then autoradiographed. The radiolabeled bands were excised, 10 µl of 2 × Laemmli buffer was added to each excised band, and the samples were boiled for 2 min and then while warm directly loaded onto an SDS-polyacrylamide gel electrophoresis gel (Ref. 29; 7.5% running gel and 4% stacking gel) prior to adding the electrophoresis buffer. After electrophoresis the gel was fixed (40% methanol, 10% acetic acid), dried, and autoradiographed.

Total RNA was prepared from myeloid cells by the method of Chomczynski and Sacchi (30). The RNA concentration was determined spectrophotometrically, and 5 µg were used for reverse transcription employing a standard protocol with Moloney murine leukemia virus reverse transcriptase. Excess RNA was digested with 2 µg of DNase-free RNase and incubated for 5 min at 37 °C. The reaction was extracted with phenol/chloroform and precipitated with ethanol at 20 °C overnight. The cDNA concentration was spectrophotometrically determined. Semi-quantitative PCR was performed by using a known amount of cDNA per reaction and analyzing the radioactive product on a polyacrylamide gel. Optimal cDNA amplification and number of cycles for amplification were determined by titration from 1 to 500 ng of cDNA and from 18 to 40 cycles. Optimal parameters were determined to be 200 ng of cDNA for 20 cycles. PCR buffer containing Mg²⁺ (Perkin-Elmer) and dNTP concentrations of 100 µM were used plus 0.25 µCi of [³²P]dCTP. For consistency of samples, a master mix for each set of primers was prepared. Reactions of 25 µl were amplified, and the PCR conditions were as follows: denaturation at 94 °C for 15 s, annealing at 59 °C for 15 s, and elongation at 72 °C for 30 s. Following PCR an aliquot was added to an equal volume of DNA sample buffer, heated to 95 °C for 5 min, and electrophoresed in a 6% acrylamide gel. Bands were detected by autoradiographic exposure and compared with each other and against amplified -actin as an internal control.

RESULTS

Human PR-3 5-Upstream Sequence and Putative Regulatory Elements

We sequenced 680 bp upstream from the initiation ATG of human PR-3 (Fig. 1). Analysis of the sequence revealed the following putative elements. There is a TATA box at position 44 but no CAAT box. A PU.1 regulatory element is at position 101. This member of the ets family has been shown to be important in myeloid cell development (31) and is contained in a 30-bp regulatory fragment of the HLE promoter identified by Srikanth and Rado (32). The core element of the ets family, GGAA (33), also occurs at 366 and 418 on the complementary strand. The immediate 5-region contains, in addition to the PU.1 binding site (101) and the TATA box (44), a potential binding site for the CAAT binding (C/EBP 82) and Myb (56) transcription factors. Other recognized elements include a NF-B element at 606 on the antisense strand (35) and five -globin-specific elements at 361, 539, 565, and 622. Three of the five -globin elements (361, 539, and 565) are preceded by a T forming the retinoic acid regulatory element, TCACC (36).

Human PR-3 5-UTR sequence and putative regulatory elements.

To analyze the 5-upstream region of the PR-3 gene for promoter activity, we cloned step-deletion constructs into pGL3-luciferase (Promega) reporter plasmids and transiently transfected them into myeloid (K562 and U937) or non-myeloid (HeLa) cells. K562 cells were used initially in the experiments because of their greater efficiency of transfection. The results were confirmed with U937 cells. K562 cells like U937 cells are derived from promyelocytic cells from a patient with chronic myelogenous leukemia (37). The data presented (Fig. 2A) is from one experiment with four determinations of each fragment. The experiment was repeated six times using three different plasmid preparations. Luciferase activity was consistently greatest in fragment 212 to 0, with fragments 174 to 0 and 91 to 0 showing the second and third highest activity levels, respectively. In the fragments from 284 to 0 to 680 to 0 the promoter activity was reduced by at least 75% compared with fragment 212 to 0 (Fig. 2A) suggesting the presence of a suppressor element between 484 and 212. Fragment 174 to 0 contains a PU.1, a C/EBP, and a Myb element as well as a TATA box; 91 to 0 contains the C/EBP and MYB sites plus the TATA box but not the PU.1 element. These results suggest that in addition to the 91 to 0 fragment that contains putative binding sites for C/EBP, Myb, and TATA elements, a PU.1 element and an unidentified element between 212 and 174 are required for maximum promoter activity.

Deletion analysis of PR-3 5-UTR for promoter activity.

To determine whether the response was specific to cells of myeloid origin, HeLa cells were transiently transfected by electroporation with the same constructs. In these non-myeloid cells neither the PU.1 containing fragment (174 to 0) nor the 212 to 0 fragment demonstrated promoter activity (Fig. 2B) implying that HeLa cells lack some or all of the trans-activating factors that are present in myeloid cells and necessary for PR-3 promoter activity.

In order to localize the unidentified sequence within the 212 to 174 fragment that conferred promoter activity when transiently transfected into myeloid cells, constructs were made that were sequentially reduced by 6 bp at the 5-end. The result presented in Fig. 3A is representative of four separate experiments where four determinations of each fragment were made. The promoter activity of fragment 188 to 0 was 50% less than the 212 to 0 fragment but was equal to the level of promoter activity of the PU.1 containing fragment (174 to 0). Moreover, the 50% reduction in promoter activity was sharply delineated and occurred between base pairs 194 and 188 (data not shown) which implied that an important element was present within these six base pairs. Compared with the 194 to 0 fragment, the 188 to 0 fragment removed two 5 cytidines of a four-cytidine sequence suggesting that all four cytidines were essential. These cytidines formed part of the sequence CCCCGCCC that was similar to the sequence CCCCACCC present in the promoters of HLE and Cat G (21, 22). We therefore concluded that this CG sequence was likely to be the essential element for the additional promoter activity. The PU.1 element and the CG element require the additional presence of the elements within the 91 to 0 fragment (Fig. 3B).

PR-3 promoter activity lies within the first 212 bp of the 5-UTR.

To further characterize the cis-acting elements and to identify the trans-acting factors that bind these elements, electrophoretic mobility shift assays (EMSAs) were performed. Crude nuclear protein extracts were prepared from HL-60, U937, PLB 985, K562, and HeLa cells. Using crude nuclear protein extracts from HL-60 cells, strong shifts occurred with fragments 212 to 91 and 174 to 91. Both fragments contain a PU.1 element, but the larger fragment possesses both a PU.1 element and a CG element identified above, and two shifts can be observed with this larger fragment. The remaining 5-fragments upstream of the CG element showed only nonspecific shifts. Nuclear protein extracts from U937 and PLB 985 cells gave identical shifts to HL-60 extracts with fragments 212 to 91 and 174 to 91 (data not shown).

To identify the trans-acting factors binding to PR-3 PU.1 and CG elements, we used radiolabeled double-stranded oligonucleotide probes of these sites in EMSAs (PR-3 PU.1 element: 5-AGGCAAAAGGAGGAAGTGGGGACCCAGCCT; PR-3 CG element 5-CAGCCAGCCTCCCCGCCCCCACAAAGGTGG). The PR-3 PU.1 element gave a two-band (A and A^*) shift when incubated with myeloid nuclear protein extracts (Fig. 4). This is typical of PU.1 when incubated with nuclear extracts from cells with high proteolytic content, A^* being a proteolytic cleavage product of band A (38). In this experiment, with low (0.5 µg) poly(dI-dC), the PR-3 CG element gave an intense band (band B) with a faster electrophoretic mobility than PU.1, suggesting that this element binds a protein of lower molecular weight. Under low stringency (0.5 µg of poly(dI-dC)) the PR-3 CG element also gave a shift similar to that obtained with the PR-3 PU.1 element, but the shift was completely abolished by increasing the poly(dI-dC) to 5 µg per reaction. Band B occurred in the presence of high poly(dI-dC) indicating a strong binding reaction, whereas the binding affinity of PU.1-like protein to the PR-3 CG element was weaker. The PR-3 CG oligonucleotide used in the experiments contained the sequence AAAGGTGG at the 5-end which is similar to the PU.1 consensus. We, therefore, designed a new CG oligonucleotide without this potential PU.1 binding site (GTGGGTGACAGCCAGCCTCCCCGCCCCCAC). This modified PR-3 CG element under low stringency also gave a shift similar to that obtained with the PR-3 PU.1 element as well as the specific band B shift, and like the original PR-3 CG element this shift was abolished by increasing the poly(dI-dC) to 5 µg per reaction (data not shown).

The binding of labeled PR-3 PU.1 or PR-3 CG probes to their specific proteins was totally inhibited by addition of a hundred-fold excess of unlabeled probe (Fig. 4, lanes 3 and 6). The data presented in Fig. 4 were obtained with K562 nuclear protein extracts (lanes 1-6) and with PLB 985 nuclear protein extracts (lanes 7-12), and the results were identical. U937 and HL-60 nuclear protein extracts also exhibited identical shifts with the PU.1 and CG sites (data not shown).

To confirm that the shift of the PR-3 PU.1 probe was due to the binding of PU.1 protein, we used an antibody that specifically recognizes the amino-terminal end of PU.1. The binding complex formed when PR-3 PU.1 probe was incubated with myeloid nuclear protein extracts "supershifted" upon addition of the antibody (Fig. 5A). Moreover, the binding of PR-3 PU.1 probe to PU.1 protein from myeloid nuclear extracts could be blocked with a double-stranded oligonucleotide containing a PU.1 binding site from CD 11b (39) and from the SV40 enhancer (Fig. 5B; 40). These results confirm that the protein binding to PR-3 PU.1 probe was PU.1.

The specific shift obtained when the CG probe was incubated with myeloid nuclear protein extract (band B) did not "supershift" upon addition of the PU.1 antibody, indicating that a second protein was responsible for this shift. UV-cross-linking of the specific proteins that bind to the PR-3 PU.1 and CG elements, followed by separation on an SDS-polyacrylamide electrophoresis gel, gave sizes of approximately 45 and 40 kDa, respectively (Fig. 6). Because the sequence CCCCGCCC is complementary to an Sp1 binding element, it is possible that the protein complexing with PR-3 CG element is Sp1. However, cold competition with a 100-fold excess Sp1 consensus sequence (Promega) did not inhibit the formation of band B when PR-3 CG element was incubated with myeloid nuclear extracts. Moreover, the addition of Sp1 protein (Promega) did not result in a shift when incubated with the PR-3 CG element. Finally, Sp1 protein has a molecular mass between 95 and 105 kDa depending on glycosylation (41) which is much larger than the 40-kDa protein that bound to the CG element determined by UV-cross-linking. Thus the complex formed when the PR-3 CG element was incubated with myeloid nuclear extracts was not due to Sp1 binding. It did not appear to be myeloid-specific as EMSA studies with PR-3 CG element and nuclear extracts from HeLa cells gave results identical to those with myeloid nuclear extracts, compared with no shift with the PR-3 PU.1 element incubated with HeLa nuclear extracts (data not shown).

Other myeloid genes contain sequences similar to the PR-3 CG element (CCCCGCCC). For example, the sequence CCCCACCC is found in the promoters of HLE (21), Cat G (22), and myeloperoxidase (42). In other myeloid genes the central A is substituted by a T (42, 43, 44, 45). This implies that the central non-cytidine nucleotide can either be an A or a T. To investigate the relevance of a G instead of A or T and to confirm the importance of the flanking cytidines, we constructed three mutations of the PR-3 CG element: CG mut 1 was identical to wild type PR-3 CG element with the exception of a 1-bp substitution of the G at position 15 to an A (and A to G mutation is conservative). CG mut 2 substitutes the 2 Cs at positions 11 and 12 for 2 As which disrupted the 5 four Cs of the core element. CG mut 3: substituted the 2 Cs at positions 18 and 19 which disrupted the 3 three Cs of the core element.

The three mutants and wild type constructs were analyzed by reporter gene expression and EMSA. In transient transfection studies CG mut 1 had the same activity as wild type, but in CG mut 2 and 3 the activity was reduced to the level of the constructs that contain only PU.1 and TATA elements, thus abolishing completely the increased activity due to the PR-3 CG element (Fig. 7A). The effect of the mutations on protein binding is shown in Fig. 7B. Lane 4 confirms that the substitution of G for an A did not have an effect on the binding of the protein that constitutes band B compared with wild type. Mutation of Cs at positions 11 and 12 to As totally abolished binding (Fig. 7B, lane 6), whereas mutation of Cs at positions 18 and 19 to As considerably reduced band B and increased the binding of PU.1 protein to this probe (Fig. 7B, lane 8). Additional experiments showed that CG mut 3 was also able to completely abolish band B. The use of CG mut 1, 2, and 3 as cold competitors (100-fold excess) for the CG wild type probe confirmed that substitution of G to A was unimportant as CG mut 1 competed with CG wild type, whereas CG mut 2 and mut 3 did not (data not shown). Thus, the cytidines are essential whereas the central non-cytidine nucleotide can be an A, T, or a G. The consensus sequence for this element is, therefore, CCCCXCCC.

Expression of the protein that binds to the CG element is not confined to myeloid cells since EMSA studies using nuclear extracts from HeLa cells showed an identical shift to that obtained with myeloid cells with the CG element. There was no shift of the PR-3 PU.1 element with nuclear extracts from HeLa cells (data not shown).

PR-3 gene expression is stage-specific being confined to the promyelocytic stage of granulocyte maturation (18). Therefore transcriptional factors involved in regulating the PR-3 gene may show a similar stage-specific expression. Differentiation of HL-60, U937, and PLB 985 cells to monocytes with PMA and of HL-60 and PLB 985 cells to granulocytes with retinoic acid plus DMF inhibited PR-3 mRNA expression and protein production. Retinoic acid plus DMF resulted in more efficient granulocytic maturation than either factor alone (25), and reverse transcriptase-PCR analysis indicated that PR-3 gene expression was reduced by more than 80% following this treatment (data not shown).

In order to determine whether the PU.1 and CG transcriptional elements are similarly reduced upon myeloid differentiation, we prepared nuclear protein extracts from myeloid leukemic cells stimulated to differentiate with PMA or retinoic acid plus DMF and compared their ability to shift PR-3 PU.1 and PR-3 CG probes with extracts from untreated cells. Differentiation of U937, HL-60, and PLB 985 to monocytes with PMA reduced the degree of binding to both the PU.1 and CG probes (Fig. 8, A and B). In Fig. 8A PMA failed to reduce the binding of U937 nuclear proteins to the CG element. Further experiments with PMA-treated U937 cells did show a reduction in binding to the CG element (Fig. 8). A similar reduction in binding was obtained when PLB 985 cells were treated with retinoic acid and DMF. Conversely the treatment of K562 cells with PMA had no effect (Fig. 8A). In these experiments nuclear protein extracts of all the samples were prepared at the same time to minimize experimental variation. Ice-cold buffers containing a mixture of proteinase inhibitors (see "Experimental Procedures") were used to reduce degradation.

Additional experiments were carried out to confirm that PMA treatment inhibited PR-3 gene expression under the same conditions that reduced the degree of nuclear protein binding to PU.1 and CG probes. Immediately prior to nuclear protein extraction, an aliquot of each sample was taken and analyzed for PR-3 gene expression using reverse transcriptase-PCR. In an experiment using U937 cells treated with 1 and 10 ng/ml PMA for 48 h, only the higher concentration reduced nuclear protein binding to the PR-3 PU.1 probe and switched-off PR-3 gene expression. In K562 cells where PMA does not affect nuclear protein binding to the PU.1 and CG probes (Fig. 8A), there is also no switch-off in PR-3 gene expression. These data suggest that both the PU.1 and CG sites in the PR-3 promoter are intimately involved in PR-3 expression.

PR-3 is one of three serine proteinases present in the azurophil granules of polymorphonuclear leukocytes along with HLE and Cat G. We determined by PCR analysis coordinate mRNA expression of PR-3, HLE, and Cat G genes. The specific primers were designed to generate fragments of non-homologous regions to ensure no cross-reactivity among the related genes. Differentiation of U937 cells with PMA resulted in a loss of 80% within 8 h of all three serine proteinase transcripts (Fig. 9).

Because PR-3, HLE, and Cat G genes are coordinately expressed, we hypothesized that elements similar to PU.1 and CG play a role in regulating all three genes. Analysis of the promoters of HLE and Cat G compared with PR-3 reveals that the three genes have a CG-like element (CCCCXCCC; Table I) and a PU.1 element within the first 300 bp of the 5-upstream sequence; moreover, the CG-like element is always 5 of the PU.1 site with at the most 60 intervening base pairs.

Table I. Putative transcriptional control elements present in the proximal promoters (first 300 bp) of PR-3, HLE, and Cat G PR-3, HLE, and Cat G are similar but distinct serine proteinases found in azurophil granules of PMNL. mRNA expression of all three serine proteinases is confined to the promyelocytic stage of maturation. Control element Azurophil serine proteinases Consensus PR-3 HLE Cat G TATA + + + CAAT   + + C/EBP T(T/G)NNGNAA(T/G) + +   Myb (T/C)AACC(T/G)G + +   PU.1 RRRGAGGAAG + + + CCCCXCCC + + +

We synthesized duplex oligonucleotides of the 30 bp flanking HLE and Cat G PU.1 and CG-like elements and compared their EMSA with PR-3 PU.1 and CG elements. The three PU.1 sites (Fig. 10A) and the three CG-like elements (Fig. 10B) showed identical shifts when incubated with nuclear protein extracts from U937 cells. The Cat G PU.1 element consistently gave an identical pattern of binding, but the degree of binding was always less than that with either the PR-3 or HLE PU.1 element. These results indicate that both PU.1 protein and the unknown protein binding to CG-like elements to form band B are likely common control factors for gene regulation of the three azurophil neutral serine proteinases.

DISCUSSION

In the present investigation analysis of 680 bp of human PR-3 promoter indicates that the first 200 bp is sufficient to give maximal and myeloid-specific expression of a reporter gene. Seventy-five percent of the activity is conferred by a CG element (190) plus a PU.1 element (101). This activity, however, is dependent on the presense of the 91 to 0 fragment that contains potential sites for C/EBP and Myb in addition to a TATA site. Interestingly a TATA site is present in all neutrophil azurophil granule serine proteinase promoters (17, 18, 20, 21, 42) but is not present in almost all the other myeloid genes including CD11b (38), CD18 (43), CD11a (44), and the CSF receptor genes (62).

The 91 to 0 fragment confers 24% promoter activity compared with 100% for the 212 to 0 fragment. The 91 to 0 fragment contains a potential binding element for C/EBP (82), Myb (56), and TATA (44). All three sites are present in the immediate 5-promoters of HLE, mouse neutrophil elastase, and azurocidin (18, 34). There is no C/EBP or Myb site, only a TATA site in the immediate 5-region of the Cat G promoter (20). Thus C/EBP and Myb sites are not ubiquitous to all azurophil serine proteinase gene promoters, and consequently these sites are unlikely to be major elements in controlling coordinate expression of azurophil serine proteinase genes (Table I).

The element at 101 is a binding site for the PU.1 transcription factor. PU.1, a member of the ets family of transcription factors, is expressed only in cells of myeloid and B-cell lineage (40, 47). PU.1 was first identified as the product of the Spi-1 oncogene in Friend virus-induced erythroleukemia (48, 49, 50). Subsequently, many genes have been identified where PU.1 plays a role in regulation of their expression in a myeloid-specific manner (38, 51, 52, 53, 54, 55, 56, 57, 58, 59).

Previously a PU.1 transcription factor was reported to be essential for the myeloid-specific expression of HLE (32). A PU.1 binding sequence also is present within the first 200 bp of human Cat G (22) and human myeloperoxidase promoters (42). The results of the present investigation confirm and extend the previous studies by demonstrating PU.1 involvement in the expression of all neutral serine proteinases contained within the azurophil granules.

PU.1 is involved in multiple steps of myeloid development. In addition to its involvement in the expression of azurophil serine proteinase genes, PU.1 is functional in the promoters of M-CSF receptor (60), the GM-CSF receptor  (61), and the G-CSF receptor (58) suggesting a role for PU.1 in early myelopoiesis as well as azurophil serine proteinase development. In the CSF receptor genes as in the azurophil serine proteinase genes, PU.1 is present within a 100 bp of the transcription start site (62). Thus the presence of PU.1 within azurophil serine proteinase promoters constitutes a second group of myeloid genes in which PU.1 plays a central and perhaps unique role.

In the present investigation, we identified a cis-acting element with a core sequence of CCCCGCCC that was essential for maximal expression of the human PR-3 gene. By substitution analysis we found that both clusters of cytidines were necessary for binding and promoter activity, whereas the central guanidine was not. Studying the promoter of CD11a Shelley et al. (44) identified a similar sequence (CCCCCCC) that bound a specific protein termed MS-2. These authors demonstrated, in contrast to our data, that the 3 cytidines were non-essential and only the 5 cytidines complexed with nuclear proteins (44). The molecular mass of MS-2 is unknown and therefore cannot be compared with the CG-binding protein that has a molecular mass of approximately 40 kDa.

The sequence CCCCCCC is found in the promoters of several myeloid genes. It is present within 300 bp of the initiation site of azurophil myeloperoxidase (42), HLE (21), Cat G (22), and CD43 (44) genes. The sequence CCCCTCCC which is also similar to the CG element is present in the promoters of CD18 (43), CD11a and 11b (44), and aminopeptidase N (CD13; 45) genes suggesting that substitution of the central adenosine to a thymidine does not alter protein binding (Table II). The site in PR-3 is unique in substituting the non-cytidine residue to a guanidine. We therefore suggest that a consensus element CCCCXCCC is important in myeloid gene regulation.

Table II. Identification of putative CG-like elements The non-cytidine nucleotide is commonly an A or a T. Only PR-3 has a central guanidine; however, the central nucleotide appears to be interchangable (see "Results"). Consensus sequence, CCCCXCCC Gene promoter CCCCCCC PR-3 CCCCCCC HLE Cat G MPO CD43 CCCCCCC CD11a CD11b CD18 CD13

The trans-acting factor that binds the PR-3 CG element is unknown. It is not PU.1 as the complex that has greater electrophoretic mobility than the PU.1 complex, and the CG binding protein is smaller than the PU.1 protein. It could, however, be Sp1 because the CG site is complementary to the Sp1 binding site. Despite being universally expressed (63, 64, 65), Sp1 is essential for myeloid-specific promoter activity in the CD11b gene (66). However, neither Sp1 protein nor a known Sp1 binding site (Promega) competed with the complex formed upon incubation of the PR-3 CG element with myeloid cell nuclear proteins. Moreover, Sp1 (95-105 kDa) is too large to be the CG binding protein. Another possible candidate for the factor that binds PR-3 CG element is a C2H2 zinc finger gene MZF-1 (67). The gene is preferentially expressed in myeloid cells and binds two core sequences one of which has the sequence 5-CGGGnGAGGGGGAA-3 and is thus similar to a complementary sequence to the CG consensus. However, it is likely that MZF-1 with an approximate molecular mass of 48 kDa is too large to be the putative CG binding protein.

The CG-like element in azurophil neutral serine proteinase genes is always upstream and within close proximity (within 60 bp) of the PU.1 element. EMSA studies with the CG-like element from all three azurophil serine proteinase genes indicated that this element binds a second protein resulting in a PU.1-like complex, which was inhibited by increasing the concentration of poly(dI-dC) in the binding reaction, whereas the faster migrating complex with the 40-kDa protein was not inhibited by the high concentration of poly(dI-dC). The PU.1-like complex is competed by the addition of cold CD11b or cold PR-3 PU.1 elements, suggesting that the CG-like element is binding PU.1 or a related ets protein in addition to the 40-kDa protein.

PR-3, HLE, and Cat G gene promoters all contain a CG-like, a PU.1, and a TATA element organized identically within the first 300 bp of sequence implying that these three elements and the factors that bind them associate to form an important regulatory complex of azurophil neutral serine proteinase gene expression (Table I). Among the neutral serine proteinases of immune/inflammatory cells, gene regulation via PU.1 and a CG-like element appears to be specific to enzymes contained in azurophil granules of PMNL as neither site is present in the promoters of the closely related granzyme serine proteinase family present in T lymphocytes nor in mast cell proteases. Thus, the presence and close proximity of both PU.1 and CG-like elements appears to be unique to the azurophil serine proteinases PR-3, HLE, and Cat G.

The requirement for cooperative interaction of the CG and PU.1 elements for myeloid-specific expression is suggested by studies using non-myeloid HeLa cells. Transient transfection studies showed that HeLa cells do not transcribe the PR-3 promoter construct that contains PU.1, CG, and TATA sites. HeLa cells are known to lack endogenous PU.1 activity (38, 40, 68), but EMSA studies indicate that they do contain a 40-kDa protein that binds the PR-3 CG element (data not shown). Whether this protein is identical to that present in myeloid cells remains to be determined.

In contrast to the present study, a previous study did not identify the CG-like element in the HLE promoter as an important regulatory element, whereas a PU.1 element was found to be essential (32). We found that PR-3 PU.1 and CG elements have different conditions for optimal binding of their respective proteins, so it is possible that conditions that allow footprinting of the PU.1 element failed to footprint the CG element. However, in the previous study, the elastase CG-like element was not recognized by deletion analysis (32). In our studies the increase in luciferase activity due to the CG element was 200-fold above control compared with 100-fold above control when the construct contained only PU.1 and TATA elements. Perhaps the contribution made to the promoter activity by the CG-like element in HLE was missed because the less sensitive CAT reporter system was used in the previous study (32).

Other cis-acting elements have been reported to be relevant in myeloid gene expression. Two sites were identified in the murine myeloperoxidase promoter (69). The protein binding to the second site with a core sequence of 5-AACCACA was identified as polyomavirus enhancer binding protein 2/core-binding factor (PEBP2/CBF) (34). A similar sequence (GGCCACA) occurs in murine elastase (34), and this sequence is present at 319 and 250 on the negative strand of human PR-3 promoter. These sites appear to be inactive as neither EMSA nor deletion analysis identified them. The element CCCTTCC is present in CD11b (70), myeloperoxidase (42), Cat G (22), c-fes (71), and CD13 (45) but is not present in PR-3. A myeloid regulatory element was located in the functional promoter region of human interleukin-5 receptor  subunit gene (72). No sequence similar to this was found in PR-3. A pyrimidine-rich sequence was described as a myeloid activating transcriptional element on the FcyR1 gene (73), and similar sequences occur in CD11b (70), Cat G (22), and HLE (21). The sequence on the negative strand around PU.1 in PR-3 and HLE is similar to myeloid activating transcriptional element. Therefore it is likely that myeloid activating transcriptional element is an inverted PU.1 site. A potential C/EBP site (82) and a potential Myb site (56) may contribute to the promoter activity conferred by fragment 91 to 0 that also contains a TATA site. As discussed the C/EBP and Myb sites are conserved in HLE and azurocodin as well as PR-3 (18) and functional in murine neutrophil elastase (34). They are absent from the immediate 5 Cat G promoter. The Cat G gene is located on chromosome 14 at q11.2 (20) unlike the other azurophil serine proteinases PR-3, HLE, and azurocidin that are clustered on chromosome 19 p13.3. Because Cat G appears to be coordinately expressed with PR-3 and HLE during azurophil development, it is unlikely that C/EBP and Myb transcription factors play a significant role in developmental expression of these three genes. However, as PR-3, HLE, and Cat G do contain both a PU.1 and CG element with similar organization in all three genes, the transcription factors that bind to these sites may play a central role in the developmental expression of these genes.

Expression of the PR-3, HLE, and Cat G genes is restricted to the promyelocytic stage of differentiation. A PU.1 site is present in the promoter of many myeloid genes, so its role in differentiation-specific expression is likely to be complex. We found that differentiation of myeloid cells to either monocytes or granulocytes reduced the ability to shift both the PU.1- and CG-like elements. Moreover, increasing the percentage of cells undergoing differentiation by using retinoic acid in conjunction with DMF further decreased the intensity of the shifts. This result is in accordance with Hromas et al. (74) who found that PU.1 was absent in differentiated bone marrow myeloid cells. Conversely, Chen et al. (47) reported that peripheral blood PMNL have the highest levels of PU.1 compared with other myeloid cells and that differentiation of HL-60 and U937 cells did not significantly change PU.1 expression. While it is difficult to reconcile these data, they were obtained using widely varying techniques. Our data indicate that PMA treatments of HL-60 and U937 cells that are effective in switching-off PR-3 gene expression also reduce nuclear protein binding to the PR-3 PU.1 element. This does not necessarily imply a reduction in PU.1 protein under these conditions. A recent report by Carey et al. (75) suggests that PMA treatment of U937 cells alters the phosphorylation state of PU.1 which in turn affects the binding pattern on EMSA. We examined PU.1 gene expression using reverse transcriptase-PCR in myeloid cells after treatment with PMA and found no change in expression (data not shown) confirming the result of Chen et al. (47). One explanation of the consistent reduction in the formation of band A and A* with the PR-3 PU.1 element upon PMA treatment is a change in the phosphorylation state of the PU.1 protein. The mechanisms by which PU.1 affects myeloid differentiation are complex and largely unknown.

Azurophil neutral serine proteinase genes are switched-off upon myeloid differentiation. The possibility that the CG binding protein cooperates with PU.1 in the regulation of these genes is heightened by the fact that there is a reduction in the specific binding to the CG element upon myeloid differentiation. This further excludes the possibility that the unidentified protein binding to the PR-3 CG element is MS-2 that binds a similar site in CD11a (44). MS-2 has an opposite pattern of expression being absent in undifferentiated and present in differentiated myeloid cells (44).

In the present study we have identified two common transcriptional control elements (PU.1 and CG) that are essential for the expression of PR-3. That PU.1 has a role appears certain but to confer specificity it requires cooperation of other transcriptional factors, such as the protein binding to the PR-3 CG element. HLE and CAT G promoters, but not other granule-associated serine proteinases of immune and inflammatory cells, possess both a PU.1 and CG-like element with a similar organization and a similar pattern of shift on EMSA to PR-3. This suggests a unique function for these elements in azurophil serine proteinases.